ID: 944534474

View in Genome Browser
Species Human (GRCh38)
Location 2:200695761-200695783
Sequence GCAAAGGCACAGCTGCAGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 267
Summary {0: 1, 1: 0, 2: 3, 3: 28, 4: 235}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944534474_944534478 -2 Left 944534474 2:200695761-200695783 CCCATCTGCAGCTGTGCCTTTGC 0: 1
1: 0
2: 3
3: 28
4: 235
Right 944534478 2:200695782-200695804 GCCACCTTCTGCCCCCAAGGAGG 0: 1
1: 0
2: 3
3: 21
4: 247
944534474_944534486 23 Left 944534474 2:200695761-200695783 CCCATCTGCAGCTGTGCCTTTGC 0: 1
1: 0
2: 3
3: 28
4: 235
Right 944534486 2:200695807-200695829 TTTGTACAACTGTCACCCTCAGG 0: 1
1: 0
2: 0
3: 12
4: 110
944534474_944534477 -5 Left 944534474 2:200695761-200695783 CCCATCTGCAGCTGTGCCTTTGC 0: 1
1: 0
2: 3
3: 28
4: 235
Right 944534477 2:200695779-200695801 TTTGCCACCTTCTGCCCCCAAGG 0: 1
1: 0
2: 2
3: 31
4: 272

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944534474 Original CRISPR GCAAAGGCACAGCTGCAGAT GGG (reversed) Intergenic
900928599 1:5721417-5721439 GGCAAGGCACAGATGCAGATTGG - Intergenic
901144724 1:7057209-7057231 CCAAAGGCAAAACTGGAGATAGG - Intronic
901414135 1:9105369-9105391 GCCAAGGCACAGCTGCAGGGAGG - Intronic
901953615 1:12768854-12768876 GCAAAGGCAGGGCTGCAGGAAGG - Intergenic
904928239 1:34065232-34065254 CCAAAGGCAGAGCTGGACATGGG - Intronic
905491099 1:38344476-38344498 GCAAAGGAAGAGCCGTAGATAGG + Intergenic
906056875 1:42924583-42924605 GCGACGGCACAGCTGCCGGTCGG - Intergenic
909222101 1:72978434-72978456 GAGAAAGCACAGTTGCAGATTGG + Intergenic
912125424 1:106531689-106531711 TCAAAAGCCCAGCTGCAGAGAGG - Intergenic
919776056 1:201194601-201194623 TCAAAGCCACTGCTGCAGAGAGG + Intronic
919825805 1:201502350-201502372 GCAAAAGCCGAGCTGCAGATTGG - Intronic
920299064 1:204977411-204977433 GGAGAGGCACAGTTGCAGAGAGG + Intronic
920376505 1:205511319-205511341 GCAAAGGCAGAGTGGCAGAGTGG + Intronic
920803385 1:209209946-209209968 GCACAGGCAAACCTGCAGAGAGG - Intergenic
924854701 1:247864719-247864741 GCAGAGGCAGCGCTTCAGATTGG + Exonic
1063022777 10:2146338-2146360 GCAAAGGCACAGCTGTCGTGCGG + Intergenic
1063300124 10:4843632-4843654 GCACAGGCACTGTTACAGATGGG - Intronic
1063301118 10:4849648-4849670 GCAAGGACACAGTTGCAGTTGGG + Intergenic
1065267444 10:23992465-23992487 ACAAAGGCAAAGCAGCAGAAAGG + Intronic
1065465858 10:26021176-26021198 TCAAATGCACAGCTAAAGATTGG - Intronic
1065696612 10:28386397-28386419 CCAAAGGCAGAGCAGCAGCTTGG - Intergenic
1066584305 10:36914795-36914817 GCAATGTCACAGCAGAAGATTGG + Intergenic
1066984655 10:42454400-42454422 GCAAAGGCACAGATGGTGACAGG - Intergenic
1067166496 10:43869841-43869863 GTACAGGCACAGCTCCAGAATGG + Intergenic
1067461982 10:46465085-46465107 GCAAAGGCACAGAGGCAGGAAGG + Intronic
1067625213 10:47919513-47919535 GCAAAGGCACAGAGGCAGGAAGG - Intergenic
1068066177 10:52134866-52134888 GCAGAGACACAGTTGCAGAATGG + Intronic
1070410385 10:76134101-76134123 GCAAAGGGTCAGCTGCAGAGTGG - Intronic
1070746688 10:78937948-78937970 GATGAGGGACAGCTGCAGATAGG - Intergenic
1070777370 10:79117750-79117772 ACAAAGACCCAGCTGAAGATGGG + Intronic
1073366462 10:102946281-102946303 GGAAAGGCACAGAGGCAGAAAGG + Intronic
1074336363 10:112580464-112580486 GCAAAGGCCCAGCTGAGGTTAGG + Intronic
1074357193 10:112796830-112796852 GCCAAGGCAGAACTGCAGAAAGG - Intronic
1076400649 10:130182493-130182515 TCAAGGGCACAGCTACAGATTGG + Exonic
1076778565 10:132711317-132711339 CAAAAGGCCCAGCTGTAGATGGG - Intronic
1077270106 11:1672724-1672746 GCAGAGGCAAAGCCGCAGAGAGG - Intergenic
1078139259 11:8680165-8680187 GCAAAGGCAAAAATGCAAATGGG + Intergenic
1078170603 11:8926355-8926377 GCAAAGGCAGAGCTTCAGCCTGG + Intronic
1078412215 11:11134126-11134148 GCACAGGCTTAACTGCAGATCGG + Intergenic
1078597918 11:12704423-12704445 GCAAAGGCACAGAGGCAAAAAGG - Intronic
1078713324 11:13816095-13816117 ACACAGGCATAGATGCAGATGGG + Intergenic
1079035489 11:17015912-17015934 GCAAAGACAGAGCAGCAGCTGGG + Intergenic
1079243858 11:18739404-18739426 GCAAAGGCACAGGAGGAGAAAGG + Intronic
1080344680 11:31311263-31311285 GCAACGGCCCAGCTGGAGATAGG + Intronic
1080753952 11:35177526-35177548 GCAAAAGCACAGCTACAGGCTGG - Intronic
1081876909 11:46414671-46414693 CCAGAGGCACAGCAGCAGCTTGG + Intronic
1082891573 11:58144531-58144553 TTGAAGGCAGAGCTGCAGATAGG + Intronic
1083947200 11:65930759-65930781 GCAAAAGAACAGTTTCAGATGGG + Intergenic
1084328581 11:68416296-68416318 GCAAAGACAGGGCTGCAGGTGGG - Intronic
1084398717 11:68931492-68931514 GCAGATCCACAGCTGCAGTTTGG + Intronic
1084730101 11:71067233-71067255 GCAAGGGCACAGATGCAAACAGG + Intronic
1085521491 11:77141662-77141684 GCAAAGGCCCTGCGGCAGAAAGG - Intronic
1086123565 11:83326638-83326660 ACAAAGGCACTGCTCCAGAGTGG - Intergenic
1088474854 11:110224935-110224957 GGGAAGGCACAGCTACAGAAGGG - Intronic
1088576749 11:111279581-111279603 ACAAAGACACAGATGCAGATGGG - Intronic
1089935902 11:122363713-122363735 GTAAAGGCACATATGCAGACAGG - Intergenic
1091825530 12:3509833-3509855 GCAAAGTCAGAGTTGCAGAGAGG + Intronic
1091994414 12:4982031-4982053 GCAATGGCACAGCTACACACTGG - Intergenic
1096071567 12:48778228-48778250 GCAGAGGAACAGCAGCACATTGG + Exonic
1097241747 12:57580503-57580525 GCAAGGGCACAGTAGCAGTTTGG - Intronic
1098448354 12:70590813-70590835 GCAAAGGCCCAGAGGCAGAAGGG - Intronic
1104377968 12:128281746-128281768 ACAAAGGCACAGCCAGAGATGGG - Intronic
1104758011 12:131280929-131280951 CCAAAGGCAGAGCTACAGAGCGG + Intergenic
1105214771 13:18277754-18277776 GCACAGGAACTGCTGCAGGTGGG + Intergenic
1106407220 13:29484507-29484529 GCAAAGGCACAGCCCCGCATGGG + Intronic
1107464071 13:40632868-40632890 GCAATGGCACAACTTCAGCTCGG - Intronic
1108044449 13:46370166-46370188 GCAGAGGCACAGCTGGTGAACGG - Intronic
1108137124 13:47377161-47377183 TCAAAAGCAAAGCCGCAGATTGG - Intergenic
1110184448 13:72656867-72656889 GAAAAGGTACAGCTGTAGGTGGG + Intergenic
1116788439 14:49313367-49313389 GAATATGCACAGCTCCAGATTGG - Intergenic
1118320154 14:64748240-64748262 CCAAAGTCCCAGCTGCAGACAGG + Exonic
1120205542 14:81583271-81583293 GCTGAGGCACTGCTGAAGATGGG + Intergenic
1120895318 14:89525560-89525582 GCATAGGCAGAGCAGCAGCTCGG - Intronic
1124137704 15:27049244-27049266 GCAAAGACACATCAGCAGCTGGG - Intronic
1125361052 15:38865327-38865349 TCAAAGGCACATCTCCAGCTGGG - Intergenic
1126300972 15:47195871-47195893 GGAAAGGCTCACCTACAGATGGG + Intronic
1128080800 15:64855766-64855788 GGAATGGCCCAGCCGCAGATGGG - Intronic
1130309729 15:82742706-82742728 GAAAAGGAACTGCTGCAAATAGG - Intergenic
1131222534 15:90597084-90597106 ACCAAGGCACAGCTGCAGCTGGG + Intronic
1131983404 15:98017477-98017499 GCAAAGGCACTGCTGCAGGGAGG - Intergenic
1133019696 16:2961905-2961927 GCAGATGCACAGGTGCAGATTGG - Intergenic
1133769663 16:8860381-8860403 TCAAAAGCACAGCAGCAGCTAGG - Intronic
1134382944 16:13745246-13745268 GCAAAGGCCCTGCGGCAGAAAGG - Intergenic
1135814709 16:25621961-25621983 GCAAAGGCCCAGATGCAGGAAGG - Intergenic
1137522255 16:49204403-49204425 GCCAGGGCTCAGCTGCATATTGG - Intergenic
1137586510 16:49667022-49667044 CTAAAGGCAGAGCTGCAGACTGG - Intronic
1137927545 16:52555031-52555053 GCAAATGAACAGCAGCTGATGGG - Intergenic
1138149026 16:54637903-54637925 CAAAAGGCAGAGCTGGAGATAGG + Intergenic
1139326502 16:66156467-66156489 GGAAATGCACAGCTGCAGTCTGG + Intergenic
1141126461 16:81404238-81404260 GCAACGGCACAGGTGCACAAAGG - Intergenic
1141829753 16:86503490-86503512 GGGAAGACAGAGCTGCAGATGGG + Intergenic
1141962436 16:87418306-87418328 GCAAAGTCACACCTGCTGACTGG + Intronic
1142401271 16:89860030-89860052 GCTGAGGCACAGCTCCAGGTGGG - Intronic
1143933001 17:10450543-10450565 GCCAAGGCTGAGCTGCAGAGGGG - Exonic
1144531843 17:16046736-16046758 GAAACGGCACAGCTTCAGAAAGG + Intronic
1146034396 17:29392359-29392381 ACAAAGAAACAGCTGCAGAAAGG - Intronic
1148850926 17:50554797-50554819 ACAGAGGCAAACCTGCAGATGGG - Intronic
1149811801 17:59681731-59681753 GCAAAAGCCCAGTTGCAGAAAGG + Exonic
1151449258 17:74187653-74187675 GCAAAGGCAGAGGTGGAGAAAGG + Intergenic
1151841370 17:76620430-76620452 GCAAAGGCAAAACTGCAAAAAGG + Intergenic
1152018797 17:77769676-77769698 GCAAACCCACAGCAGCGGATGGG + Intergenic
1153472982 18:5467910-5467932 CCAAATCCACAGCTGCAGCTGGG - Intronic
1155385789 18:25275812-25275834 GGAAGGGCACAGCTGCAAAAAGG - Intronic
1158107587 18:53903590-53903612 GCAAAGGCAAAGAAACAGATTGG - Intergenic
1159370896 18:67526587-67526609 GTAGCGGCACAGCTGCAGATAGG - Intergenic
1159725483 18:71952380-71952402 GCAAAGGCTCTGCTTCAGATAGG - Intergenic
1161142013 19:2653695-2653717 GCAACGGAACAGCTCTAGATGGG - Intronic
1162297576 19:9823953-9823975 ACCGAGGCACAGCTGCAGCTAGG + Intronic
1166300925 19:41911827-41911849 GCACAGGCACAGCTAGAGAGAGG + Intronic
1166532536 19:43551676-43551698 GCAAAGGCACAGCTGGTGGGGGG + Exonic
925823449 2:7823106-7823128 GGAAAGGAGCAGCGGCAGATTGG - Intergenic
925918693 2:8624952-8624974 GCAAGGGCCCTGCTGCAGACTGG - Intergenic
927096254 2:19749757-19749779 GCACAGGTACACCTGCAGGTTGG + Intergenic
927398686 2:22685767-22685789 TCAAATGCACAGCTGCAGTCAGG + Intergenic
929675985 2:43930212-43930234 GGAAAGGCAAAACAGCAGATAGG + Intronic
929870009 2:45751096-45751118 GCAAAGGCACAGAGGCTGAAAGG - Intronic
930302139 2:49629870-49629892 ACAAAGACATAGTTGCAGATTGG + Intergenic
931902259 2:66802874-66802896 GCAAATACACAGCCACAGATGGG - Intergenic
933299246 2:80524051-80524073 ACAAAAGCATAGCTGCTGATGGG + Intronic
934299550 2:91768983-91769005 GCACAGGAACTGCTGCAGGTGGG - Intergenic
934658804 2:96132307-96132329 GCTAAGGCACAACTACAGGTGGG + Intronic
936786067 2:116095222-116095244 ACAAAGGCACTGCTCCAGAGAGG - Intergenic
937017355 2:118618392-118618414 GCAGAGGCAGAGCTGCAGGCAGG + Intergenic
942971300 2:181961399-181961421 GCAGAGGGACAGCACCAGATCGG - Intronic
944055472 2:195518021-195518043 GCAAAGGATCAGCTGTACATAGG + Intergenic
944534474 2:200695761-200695783 GCAAAGGCACAGCTGCAGATGGG - Intergenic
945322706 2:208444087-208444109 GCAAAGGCACAGATCCAGACAGG - Intronic
946693689 2:222331048-222331070 GCAAAGGTACTGCTGCACGTAGG - Intergenic
948224621 2:236299238-236299260 GGAAAAGAACTGCTGCAGATAGG + Intergenic
948388547 2:237596616-237596638 GCAAAGGCACAGCTGTCAATAGG + Intronic
1168964513 20:1891201-1891223 GCAAAGGCCAAACTCCAGATAGG + Intergenic
1169683314 20:8241910-8241932 GTAAAGGCACAGATGAAGACAGG + Intronic
1170893497 20:20395183-20395205 GCAAAGCCACCCCTGCAGCTGGG + Intronic
1171300035 20:24052085-24052107 GCAGGGGCACAGTTGCAGGTTGG + Intergenic
1172624388 20:36338895-36338917 GCAAAGGCACCGAGGCAGGTGGG + Intronic
1173431048 20:42987435-42987457 GCTAAGCCAGAGCTGCAGACAGG - Intronic
1174354263 20:49987892-49987914 GCGAAGGCACGGCTGCAGTGGGG - Exonic
1175259753 20:57667097-57667119 CCAAAGACACAGCTGGAGGTGGG - Intronic
1175883365 20:62273266-62273288 GGACAGGCACAGCTTCAGTTAGG - Intronic
1178642745 21:34359097-34359119 GCATAGGCAAAGCTGAAGAGAGG - Intergenic
1178943428 21:36926261-36926283 GCAAAGGGACAGCTTCAGCTCGG + Intronic
1179084561 21:38206056-38206078 GCAAAGGCAGAGCCACAGAGGGG - Intronic
1181026444 22:20130428-20130450 GCAAGGGCAAGGCTGGAGATGGG + Intronic
1181697909 22:24603083-24603105 GCACAGGAACTGCTGCAGGTGGG - Intronic
1181949356 22:26542883-26542905 GGATAGGCCCAGCTGCAGACTGG - Intronic
1182051434 22:27315675-27315697 TCAAAGGCACAGCCGGTGATGGG - Intergenic
1182276518 22:29192629-29192651 GCAAACGCACATCTGCAGGGCGG - Intergenic
1184491847 22:44814430-44814452 GCCGAGGCACAGCTGCAAGTCGG - Intronic
1184722322 22:46322230-46322252 GCAACAGCACAGCTGCTGCTGGG - Intronic
1185004280 22:48266302-48266324 GAAAAGTCACAGCTGCTGAGTGG - Intergenic
1185045929 22:48528773-48528795 GCAAGCGCACAGCTGCTGAGTGG - Intronic
949736512 3:7178641-7178663 GGAAAGGCAAAATTGCAGATGGG + Intronic
950315122 3:11995322-11995344 GGTAAGGCACAGCTGCAGAAAGG - Intergenic
952348466 3:32510832-32510854 GGAAAGGGACAGATACAGATGGG + Intergenic
952691731 3:36215006-36215028 GAAAAGGCACAGATACAGAAGGG - Intergenic
953280183 3:41547587-41547609 GCAATGGCACCGCTCCAGACAGG + Intronic
953469012 3:43151020-43151042 GGAAAGGCAAAGGTGCTGATGGG - Intergenic
954046864 3:47939061-47939083 GCAAAGGCACAGGGGCAGAGTGG - Intronic
954128003 3:48543513-48543535 GCAAAGGCACAGATGTGGATGGG + Intronic
954901091 3:54020713-54020735 GCAAGGGCTGAGCTGCAGAGAGG + Intergenic
955933823 3:64083276-64083298 GCAAAGGCAGAACTGGAGACTGG + Intergenic
956811493 3:72867866-72867888 GCAAAGGCACGGATGAAGCTTGG + Intergenic
958771214 3:98428338-98428360 GCAATGGCACTGCTTCAGAGAGG + Intergenic
959053405 3:101545983-101546005 GCATAGGCAGAGCAGCAGCTTGG + Intergenic
959358753 3:105365430-105365452 GAAAAATCACAGCTGAAGATAGG + Intergenic
960263882 3:115598282-115598304 GGAAAGGAGCAGCTGGAGATTGG - Intergenic
962336345 3:134534930-134534952 ACATGGGCACAGATGCAGATAGG - Intronic
965456214 3:168903873-168903895 GAATAGGCACAGCTGCAAAGAGG + Intergenic
967049150 3:185766032-185766054 CCAAAGGCACACATGAAGATGGG + Intronic
968659093 4:1791901-1791923 CCCAAGGCACAGCAGCACATTGG - Intergenic
969497627 4:7535085-7535107 GCAAAGTCACAGGTGCAGACAGG + Intronic
969526722 4:7707612-7707634 GCAAGGGCAACCCTGCAGATGGG - Intronic
971092326 4:23360445-23360467 ACCCAGCCACAGCTGCAGATGGG + Intergenic
973537392 4:51897021-51897043 GCAAAGGCCCAGAAGCAGATGGG - Intronic
973691704 4:53440731-53440753 GCAAAGGCAGAGCTGAAAATAGG - Intronic
973755154 4:54066796-54066818 TTAAAGGAACAGCTGCAAATGGG + Intronic
975244962 4:72109808-72109830 ACAAGGGCACACCTGCACATTGG - Intronic
975247004 4:72131102-72131124 CCAATGGCACAGCAGCAGAGTGG - Intronic
977326262 4:95578670-95578692 TCAAATGCACAGATGCACATAGG - Intergenic
980745973 4:137016263-137016285 TCAAAGGCACACTTTCAGATGGG + Intergenic
982279198 4:153666394-153666416 GCAAAGCCACAGGGGCAGAGTGG + Intergenic
982291669 4:153788680-153788702 GCCGTGGCACAGCTGCAGGTTGG + Exonic
982532197 4:156558864-156558886 GCAATGGCACTGCTCCAGAGAGG - Intergenic
984857334 4:184206194-184206216 GCATACGCACAGCTCCAGGTAGG - Intronic
986029350 5:3880874-3880896 ACAGAGGCACAGCTGGAGCTCGG + Intergenic
986471901 5:8084157-8084179 GCCAAGGAACAGGCGCAGATGGG - Intergenic
988071623 5:26296827-26296849 GCAAAGGCAGAACTTTAGATTGG - Intergenic
992536278 5:77707207-77707229 GTACAGGTACAGATGCAGATAGG + Intronic
993137922 5:83993543-83993565 GCAAAGGTAAGGATGCAGATAGG - Intronic
997372123 5:133368754-133368776 CCAAGGGCACAGCTGCCCATGGG - Intronic
997681021 5:135750739-135750761 CCAAGGGCACAGATCCAGATGGG - Intergenic
998016390 5:138735499-138735521 GCAAAGGCACACAGGCAGCTGGG - Intronic
1001049674 5:168404252-168404274 GCAGTGGCCCTGCTGCAGATGGG - Intronic
1001546848 5:172575549-172575571 GCAGAGGTCCAGCTGCAGAGAGG - Intergenic
1001931963 5:175679495-175679517 GCAAAGGCACAGAATCAGAATGG + Intronic
1003473856 6:6463028-6463050 CCATAGGCACAGCAGCAGCTTGG - Intergenic
1004004795 6:11628714-11628736 CCAAAGGCAGAGCTGCAGGAGGG - Intergenic
1006006318 6:31004643-31004665 GCAAAGGCACAGGTCTAGATGGG - Intergenic
1007106260 6:39285194-39285216 GCAAAGGGACAGAGGCAGACAGG + Intergenic
1007601278 6:43083222-43083244 GCCCAGGCACAGCAGCAGAGAGG - Intronic
1008085365 6:47238896-47238918 GCAAGGACACAGCTGGAAATGGG - Intronic
1008970734 6:57364983-57365005 CCAACAGCACAGCAGCAGATGGG - Intronic
1009004625 6:57768337-57768359 GGAAAGGCAAAACTGCAAATAGG + Intergenic
1009159698 6:60266790-60266812 CCAACAGCACAGCAGCAGATGGG - Intergenic
1009814242 6:68710481-68710503 GCAAAAGCACATCTGCAGCCAGG - Intronic
1010627329 6:78154312-78154334 CCATAGGCACAGCAGCAGCTTGG - Intergenic
1013727637 6:113119197-113119219 TCAAAGGTACAGATGCAGGTTGG - Intergenic
1015230266 6:130907262-130907284 GCAAAGTAACAACTGCAGAAGGG + Intronic
1017544756 6:155438730-155438752 GCAAGCGCATAGCTGCAGAGTGG - Intronic
1017738801 6:157386407-157386429 GCAAAGCCACAGCTTCACAGAGG - Intronic
1018154987 6:160977404-160977426 GAAGAGACACAGCTGCAGACAGG + Intergenic
1019494573 7:1331787-1331809 TCTTAGCCACAGCTGCAGATGGG - Intergenic
1021384759 7:20015686-20015708 GAAATGGCACAGCAGGAGATGGG - Intergenic
1022949839 7:35327478-35327500 GCAAAAGCATAGCTGCGGAATGG + Intergenic
1024257878 7:47551873-47551895 GCTAAGGCACAGCTGGAGCGGGG + Intronic
1024970162 7:55061861-55061883 GCAAAGGCTCAGCTGCTAAGTGG + Intronic
1026844359 7:73689630-73689652 GCAGAGGCACAGATGCCGGTGGG + Intronic
1029433671 7:100548950-100548972 GCAAAGCCCCACCTGCAGATAGG - Intronic
1032177777 7:129646608-129646630 GAAGAGGCACAGCTGGAGTTGGG + Intronic
1032478320 7:132227184-132227206 GGCAAGGAACAGCTGCAGAGAGG - Intronic
1032517115 7:132514945-132514967 GCAAAGGCACAGATGCCCAGAGG - Intronic
1032820440 7:135519660-135519682 GCAATGGCAGAGGTGCAGAAAGG + Intergenic
1033429352 7:141274786-141274808 GCAAAGGCACAGCTGGAGGAGGG + Intronic
1035680342 8:1483141-1483163 GCAAACGCCCAGCAGCAGCTCGG - Intergenic
1036226113 8:6958963-6958985 GAAAAGGCAGAGCAGTAGATGGG + Intergenic
1038751725 8:30302287-30302309 GCAAAGTCACCGCTGCGGGTGGG + Intergenic
1039135010 8:34312085-34312107 GCGAAGGCACAGCTAGAGACTGG - Intergenic
1040335973 8:46416181-46416203 GCAAAAACAAAGCTGCAGGTTGG + Intergenic
1041687373 8:60656898-60656920 GCAAAGGCAGAGATGCAGAAAGG + Intergenic
1044614830 8:94129252-94129274 GAAAAGGCACAGAGGCAGAAGGG + Intronic
1045280929 8:100749245-100749267 GCAAAGGCCCCTCTGCAGAGAGG + Intergenic
1045816026 8:106277441-106277463 GCAAGGGCACAGCTGAAGTGTGG - Intronic
1047991196 8:130288466-130288488 GTAAATGCACAGCTGCAGGTAGG - Intronic
1048369537 8:133765710-133765732 AGGAAGGCACTGCTGCAGATGGG - Intergenic
1048942955 8:139418403-139418425 GCAAAGCCACAGCTGCAAAAGGG - Intergenic
1049606816 8:143533376-143533398 GCACAGGGCCAGCTGCAGAGAGG - Intronic
1052879958 9:33595685-33595707 GAAAATGCACAGATGCAGCTTGG + Intergenic
1053049389 9:34946468-34946490 GCAAAGTCACATCTTCAAATGGG - Intergenic
1053496015 9:38548535-38548557 GAAAATGCACAGATGCAGCTTGG - Intronic
1053664407 9:40307513-40307535 GCAAAGCCACAGGTGCAGATTGG + Intronic
1054520207 9:66068772-66068794 GCAAAGCCACAGGTGCAGATTGG - Intergenic
1055595607 9:77862064-77862086 GCAAAGCCACAGGGGCAGAACGG - Intronic
1056586124 9:87928346-87928368 GAAAATGCACAGATGCAGCTTGG - Intergenic
1056610758 9:88124597-88124619 GAAAATGCACAGATGCAGCTTGG + Intergenic
1057062722 9:92019944-92019966 GGTAAGGCTAAGCTGCAGATAGG + Intergenic
1057402095 9:94732883-94732905 GCACAGAGACTGCTGCAGATAGG - Intronic
1057675944 9:97136053-97136075 GAAAATGCACAGATGCAGCTTGG - Intergenic
1059456583 9:114403696-114403718 GCAAAGGCAGAGCTGAAACTGGG + Intronic
1059687911 9:116655577-116655599 GAAAAGGCAGGGCTGGAGATGGG - Intronic
1059887978 9:118768249-118768271 GCAAAGGCACAGAGGCAGGAAGG - Intergenic
1060720570 9:125974231-125974253 ACAAAGGCACAGCCGGAGCTGGG + Intergenic
1062052928 9:134456817-134456839 GGGAAGGCACAGCTGGAGCTCGG - Intergenic
1062227814 9:135463457-135463479 GCCAATGCACAGCTGCTGCTGGG + Intergenic
1062631970 9:137467126-137467148 GAGAAGGCACAGATGCAGGTTGG - Intronic
1062635405 9:137487913-137487935 GCCAAGGCTCAGCTGCAGTGAGG - Intronic
1187285088 X:17897428-17897450 GGGAAGGCACAGTTGCAGGTAGG - Intergenic
1188844846 X:35059891-35059913 CCCAAGCCACAGCTGCAGCTAGG + Intergenic
1190337993 X:49274441-49274463 GCAAAGGCCCTGCAGCAGAAAGG - Intronic
1190928403 X:54928665-54928687 CCACAGCCACAGCTGCAGCTTGG - Exonic
1191191276 X:57670314-57670336 GCAAAGCCCCAGCTGCAGATCGG + Intergenic
1193291889 X:79783369-79783391 GCAATGGCTCAACTGCACATCGG + Intergenic
1194380173 X:93181345-93181367 TCAAATCCACAGCTGCAGTTTGG - Intergenic
1194449743 X:94029806-94029828 GCAAAGGCACAGAAGCAAAAAGG - Intergenic
1194901825 X:99521096-99521118 GCACAGGCACAGGTTCAGAATGG + Intergenic
1198120679 X:133589634-133589656 GCAAAGGCACACCAGCACTTTGG - Intronic
1199697273 X:150351687-150351709 CCAAAGCCCCAGCTGCAGATGGG - Intergenic
1199859981 X:151792695-151792717 GCAAAGGCACAGTAGCAGGGAGG - Intergenic