ID: 944539591

View in Genome Browser
Species Human (GRCh38)
Location 2:200743059-200743081
Sequence CTGGGGCACCAGGATGAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944539575_944539591 22 Left 944539575 2:200743014-200743036 CCCCTAGCTCAGCCCCCAAAGTC No data
Right 944539591 2:200743059-200743081 CTGGGGCACCAGGATGAGGATGG No data
944539576_944539591 21 Left 944539576 2:200743015-200743037 CCCTAGCTCAGCCCCCAAAGTCC No data
Right 944539591 2:200743059-200743081 CTGGGGCACCAGGATGAGGATGG No data
944539581_944539591 8 Left 944539581 2:200743028-200743050 CCCAAAGTCCCAGAGAGGAGCAG No data
Right 944539591 2:200743059-200743081 CTGGGGCACCAGGATGAGGATGG No data
944539579_944539591 10 Left 944539579 2:200743026-200743048 CCCCCAAAGTCCCAGAGAGGAGC No data
Right 944539591 2:200743059-200743081 CTGGGGCACCAGGATGAGGATGG No data
944539580_944539591 9 Left 944539580 2:200743027-200743049 CCCCAAAGTCCCAGAGAGGAGCA No data
Right 944539591 2:200743059-200743081 CTGGGGCACCAGGATGAGGATGG No data
944539583_944539591 0 Left 944539583 2:200743036-200743058 CCCAGAGAGGAGCAGCCAAGACT No data
Right 944539591 2:200743059-200743081 CTGGGGCACCAGGATGAGGATGG No data
944539584_944539591 -1 Left 944539584 2:200743037-200743059 CCAGAGAGGAGCAGCCAAGACTC No data
Right 944539591 2:200743059-200743081 CTGGGGCACCAGGATGAGGATGG No data
944539582_944539591 7 Left 944539582 2:200743029-200743051 CCAAAGTCCCAGAGAGGAGCAGC No data
Right 944539591 2:200743059-200743081 CTGGGGCACCAGGATGAGGATGG No data
944539577_944539591 20 Left 944539577 2:200743016-200743038 CCTAGCTCAGCCCCCAAAGTCCC No data
Right 944539591 2:200743059-200743081 CTGGGGCACCAGGATGAGGATGG No data
944539574_944539591 23 Left 944539574 2:200743013-200743035 CCCCCTAGCTCAGCCCCCAAAGT No data
Right 944539591 2:200743059-200743081 CTGGGGCACCAGGATGAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944539591 Original CRISPR CTGGGGCACCAGGATGAGGA TGG Intergenic
No off target data available for this crispr