ID: 944540107

View in Genome Browser
Species Human (GRCh38)
Location 2:200746459-200746481
Sequence GACGAGGCCTGACTCAGAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944540107_944540118 18 Left 944540107 2:200746459-200746481 CCTGCTCTGAGTCAGGCCTCGTC No data
Right 944540118 2:200746500-200746522 CTCCTGGAATCCAGCCCTGAGGG No data
944540107_944540122 29 Left 944540107 2:200746459-200746481 CCTGCTCTGAGTCAGGCCTCGTC No data
Right 944540122 2:200746511-200746533 CAGCCCTGAGGGGCTACATGAGG No data
944540107_944540119 19 Left 944540107 2:200746459-200746481 CCTGCTCTGAGTCAGGCCTCGTC No data
Right 944540119 2:200746501-200746523 TCCTGGAATCCAGCCCTGAGGGG No data
944540107_944540117 17 Left 944540107 2:200746459-200746481 CCTGCTCTGAGTCAGGCCTCGTC No data
Right 944540117 2:200746499-200746521 CCTCCTGGAATCCAGCCCTGAGG No data
944540107_944540110 2 Left 944540107 2:200746459-200746481 CCTGCTCTGAGTCAGGCCTCGTC No data
Right 944540110 2:200746484-200746506 TTCCCAGCCGGCCCTCCTCCTGG No data
944540107_944540108 -10 Left 944540107 2:200746459-200746481 CCTGCTCTGAGTCAGGCCTCGTC No data
Right 944540108 2:200746472-200746494 AGGCCTCGTCAGTTCCCAGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944540107 Original CRISPR GACGAGGCCTGACTCAGAGC AGG (reversed) Intergenic
No off target data available for this crispr