ID: 944540111

View in Genome Browser
Species Human (GRCh38)
Location 2:200746486-200746508
Sequence TTCCAGGAGGAGGGCCGGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944540111_944540122 2 Left 944540111 2:200746486-200746508 CCCAGCCGGCCCTCCTCCTGGAA No data
Right 944540122 2:200746511-200746533 CAGCCCTGAGGGGCTACATGAGG No data
944540111_944540118 -9 Left 944540111 2:200746486-200746508 CCCAGCCGGCCCTCCTCCTGGAA No data
Right 944540118 2:200746500-200746522 CTCCTGGAATCCAGCCCTGAGGG No data
944540111_944540117 -10 Left 944540111 2:200746486-200746508 CCCAGCCGGCCCTCCTCCTGGAA No data
Right 944540117 2:200746499-200746521 CCTCCTGGAATCCAGCCCTGAGG No data
944540111_944540125 9 Left 944540111 2:200746486-200746508 CCCAGCCGGCCCTCCTCCTGGAA No data
Right 944540125 2:200746518-200746540 GAGGGGCTACATGAGGCTCATGG No data
944540111_944540119 -8 Left 944540111 2:200746486-200746508 CCCAGCCGGCCCTCCTCCTGGAA No data
Right 944540119 2:200746501-200746523 TCCTGGAATCCAGCCCTGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944540111 Original CRISPR TTCCAGGAGGAGGGCCGGCT GGG (reversed) Intergenic
No off target data available for this crispr