ID: 944540117

View in Genome Browser
Species Human (GRCh38)
Location 2:200746499-200746521
Sequence CCTCCTGGAATCCAGCCCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944540111_944540117 -10 Left 944540111 2:200746486-200746508 CCCAGCCGGCCCTCCTCCTGGAA No data
Right 944540117 2:200746499-200746521 CCTCCTGGAATCCAGCCCTGAGG No data
944540109_944540117 1 Left 944540109 2:200746475-200746497 CCTCGTCAGTTCCCAGCCGGCCC No data
Right 944540117 2:200746499-200746521 CCTCCTGGAATCCAGCCCTGAGG No data
944540107_944540117 17 Left 944540107 2:200746459-200746481 CCTGCTCTGAGTCAGGCCTCGTC No data
Right 944540117 2:200746499-200746521 CCTCCTGGAATCCAGCCCTGAGG No data
944540105_944540117 24 Left 944540105 2:200746452-200746474 CCTGTCACCTGCTCTGAGTCAGG No data
Right 944540117 2:200746499-200746521 CCTCCTGGAATCCAGCCCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944540117 Original CRISPR CCTCCTGGAATCCAGCCCTG AGG Intergenic
No off target data available for this crispr