ID: 944541888

View in Genome Browser
Species Human (GRCh38)
Location 2:200761931-200761953
Sequence GACATTGAGTGCTACATTAA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 115
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 106}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944541888 Original CRISPR GACATTGAGTGCTACATTAA CGG Intergenic
907285741 1:53378346-53378368 GACCTTGAGTGCCAAGTTAAGGG + Intergenic
911225794 1:95304306-95304328 GACACTGAGTTACACATTAATGG - Intergenic
918698994 1:187583156-187583178 CACATTTAGTGTTACATAAATGG - Intergenic
920646691 1:207809000-207809022 GACATTGCCTGCTATACTAAAGG - Intergenic
923693824 1:236225988-236226010 AAAATTTAGTGCTACTTTAATGG - Intronic
1066248293 10:33606645-33606667 AACATTGTTTACTACATTAATGG - Intergenic
1070659418 10:78293923-78293945 GCCATGGAGTGCTACATTTCTGG + Intergenic
1074974178 10:118567004-118567026 GACAATGAGTTCTTCATTGATGG + Intergenic
1078235439 11:9480496-9480518 GACATTGAGTGATACTGTTAGGG + Intronic
1082853502 11:57786064-57786086 GCCATTAAGTCCTACATTACTGG - Intronic
1082886959 11:58095592-58095614 GAGAGTGAGTGCTGCATGAAGGG + Intronic
1085016688 11:73178485-73178507 GACAGTGAGAGTTACATTGATGG - Intergenic
1085904232 11:80740437-80740459 GCCATTTAGTGATCCATTAATGG - Intergenic
1087632230 11:100663817-100663839 TACATTTAGTGCTTCATTCAAGG + Intergenic
1089805905 11:121088826-121088848 TACATTCAGTGTAACATTAAAGG + Exonic
1090202938 11:124868921-124868943 AACATTGAGTGGTACAAGAACGG + Exonic
1091581389 12:1792559-1792581 CACAGTGAGAGCAACATTAAGGG - Exonic
1096414845 12:51404152-51404174 GACATCGGGAGCTACATGAAGGG + Intronic
1098028875 12:66234305-66234327 GACATGGTGTGCTCCATTGAGGG + Intronic
1105632885 13:22188628-22188650 GATATTGAGTTCTACCTGAATGG - Intergenic
1108968015 13:56337005-56337027 GAAATTGAGAGATACATTAAAGG + Intergenic
1109650551 13:65319595-65319617 CACATTGTGTGCTACATGATGGG + Intergenic
1111487388 13:88921523-88921545 GCCATTGAGTGCTACTTTCCAGG - Intergenic
1116221196 14:42089853-42089875 GACATTGAATGCTACAATCAAGG - Intergenic
1120509278 14:85394124-85394146 GACTTTGTGTGCAACATTTATGG + Intergenic
1121880784 14:97498621-97498643 GACATTGTGTGCTACAATGTGGG + Intergenic
1123538103 15:21260074-21260096 GAAATTCAGTGTTACGTTAATGG - Intergenic
1125243766 15:37609412-37609434 GACAGACAGTGCTTCATTAATGG + Intergenic
1126229550 15:46309154-46309176 GACAGTAAGTGCTCAATTAAAGG - Intergenic
1127725270 15:61743631-61743653 GACAGAGAGTGCTAAATGAATGG + Intergenic
1130754907 15:86752882-86752904 GACATTAATTGCTAAATTAATGG + Intronic
1133854039 16:9532844-9532866 GAACTTGAGTGCTTCATGAATGG - Intergenic
1135222721 16:20626837-20626859 GACATTTGGTGCTGCATTAGAGG + Intronic
1135805510 16:25538930-25538952 GGCCTTGAATGCTACACTAAGGG + Intergenic
1140495042 16:75378657-75378679 GATAGTTAGTGCTACAATAAAGG + Intronic
1143699953 17:8651075-8651097 GAGAATGAGTGCTACCTAAACGG - Intergenic
1147176512 17:38659226-38659248 GACCCTGAGTGCTCCATTCAGGG - Intergenic
1147943631 17:44067498-44067520 GACATTGATTCCTACCTCAAAGG - Exonic
1153396303 18:4625389-4625411 GAGATAGAGTACTACATAAAGGG - Intergenic
1153471479 18:5451343-5451365 GACATTGAGAGCATCATTATGGG - Intronic
1153877850 18:9391330-9391352 GACGTTGAGTACAACATTCATGG - Intronic
1165087507 19:33361333-33361355 GACATTGATGGCCACATTCACGG + Intergenic
925125673 2:1453955-1453977 AACAGTGATTGCTACATCAAAGG - Intronic
927039038 2:19209674-19209696 GACAATGAGTGCCCTATTAATGG - Intergenic
927188348 2:20498345-20498367 CACAGTAAGTGCTCCATTAATGG - Intergenic
927261761 2:21098652-21098674 TACATTAAGTGCTATACTAAGGG + Intergenic
930278815 2:49345017-49345039 GACATTCAGTGATTCATTGACGG + Intergenic
930735851 2:54777747-54777769 TACATGGAGTGTTACATTAATGG + Intronic
941009143 2:160278621-160278643 GACATGGTGTGCTCCATTGAGGG + Exonic
941081578 2:161067170-161067192 GACATTTGGGGCTACATTACAGG - Intergenic
943988491 2:194655261-194655283 GACACTGAGAGCTACTTTAGAGG + Intergenic
944541888 2:200761931-200761953 GACATTGAGTGCTACATTAACGG + Intergenic
944868130 2:203882181-203882203 AACATTGAGTGCAAGATTTAAGG - Intergenic
945584239 2:211638359-211638381 GGCAAGGAGAGCTACATTAAGGG + Intronic
946546103 2:220745705-220745727 AACTTTGAAAGCTACATTAATGG - Intergenic
947163447 2:227237453-227237475 TACATTGTGTTCTACATAAAAGG + Intronic
1170597351 20:17816140-17816162 GACATTTATTGCTAGATTTAGGG - Intergenic
1170836394 20:19888408-19888430 GACATTGAGGGCGATATTTAGGG - Intronic
1174747988 20:53083263-53083285 AACATTGATAGCTACATTTAAGG - Intronic
1175445925 20:59019220-59019242 GAGAGTGAGTGCAAGATTAAAGG - Intergenic
1177099378 21:16880811-16880833 CACATTGAGTGCTTCCTTCAGGG - Intergenic
1178842945 21:36152632-36152654 GACATTGATTCCTACCTTAAAGG - Intergenic
1181850574 22:25747160-25747182 GGGATTGAGTGCTCCATCAAAGG - Intronic
950608780 3:14110934-14110956 GACATAGAGTGATTCATTCATGG - Intergenic
955351082 3:58193543-58193565 GACTTTGAGCGCCACATGAAAGG - Intronic
955940156 3:64139684-64139706 GCCATTTAGGGCTATATTAATGG - Intronic
958869701 3:99543385-99543407 GACATTGAGTGCCAGAGGAAGGG - Intergenic
960367227 3:116787260-116787282 GACATTGAGGACTACAAGAAGGG - Intronic
964484356 3:157172669-157172691 TACATGGAATGCTACATGAAAGG + Intergenic
974711955 4:65608657-65608679 GATATTGTGTGCTAATTTAAAGG + Intronic
975537433 4:75466376-75466398 GTCTTTGGGTGGTACATTAAGGG + Intergenic
976963026 4:91002942-91002964 GACAGAGAGTACTACATCAAGGG - Intronic
976990902 4:91364936-91364958 GACATTGAGAGATATACTAATGG - Intronic
978237179 4:106473401-106473423 GTCATTGTGTACTATATTAAAGG + Intergenic
980449909 4:132958023-132958045 GACACTGTGTGAAACATTAAGGG - Intergenic
980589848 4:134871360-134871382 GAGTTTGGGTGCTACTTTAATGG + Intergenic
984531031 4:180916496-180916518 CACATTAAGTCCTAAATTAATGG + Intergenic
986851841 5:11822234-11822256 GACAGTTACTGCCACATTAATGG - Intronic
987165569 5:15194508-15194530 GAGAATGAGTGCTAAATGAAGGG - Intergenic
995138697 5:108708233-108708255 GACACTGACTGCTACATCTAGGG - Intergenic
998285357 5:140855205-140855227 GAGAATGAGTGCTTCATAAATGG - Intronic
998422707 5:142002299-142002321 CACAGTGAGTACTACATTCATGG + Intronic
999070021 5:148734640-148734662 TACCTTAAGTGCCACATTAAAGG - Intergenic
1003307574 6:4943581-4943603 GCCATTGACTGCTACAATAATGG - Exonic
1003822630 6:9916506-9916528 GACACTGACTGCATCATTAATGG + Intronic
1008339832 6:50351491-50351513 GCTAGTGAGTGCTACATGAATGG + Intergenic
1013867701 6:114718958-114718980 TACATTGATTCCTAGATTAAAGG + Intergenic
1015356112 6:132278648-132278670 GACATTGACTTCTACACTAGGGG - Intergenic
1015538489 6:134291031-134291053 GGCCTTGGGTGCCACATTAAGGG + Intronic
1016146605 6:140684827-140684849 GACACTGACTGCTACAGTACAGG + Intergenic
1018141032 6:160837499-160837521 GCCCTTGAATCCTACATTAAGGG + Intergenic
1020221674 7:6243171-6243193 GACATTGAGTGCAAAAATTAGGG + Intronic
1021791253 7:24208096-24208118 GACATTGATGTCTACATCAATGG - Intergenic
1021800662 7:24303191-24303213 GAGAATGAATGCTACATCAATGG - Intergenic
1024417651 7:49125917-49125939 AATCTTGAGTGCTAAATTAAAGG - Intergenic
1024773343 7:52752350-52752372 GACACTGAGTAAAACATTAAAGG + Intergenic
1030939386 7:115627565-115627587 GACAGTGTGTGCTCAATTAAAGG - Intergenic
1031485193 7:122316352-122316374 GACATTGAGTAAAATATTAAGGG - Intergenic
1031951599 7:127898292-127898314 GAAATTGAGTCCTACAGTCAAGG - Intronic
1032329069 7:130960742-130960764 AACAGTGACTGTTACATTAAAGG - Intergenic
1040681150 8:49811339-49811361 GACATTGTGTACTACATTTTGGG + Intergenic
1045075800 8:98566523-98566545 GAAATTCGCTGCTACATTAAGGG - Intronic
1048154236 8:131928308-131928330 GACATTAAATGCTAAATGAAGGG + Intronic
1048684782 8:136892262-136892284 TACATAGAGTGTTTCATTAATGG + Intergenic
1049924398 9:394688-394710 GACATGAAGTTCCACATTAAGGG + Intronic
1053328245 9:37176881-37176903 TATATTGACTGCTACAGTAAAGG - Intronic
1055351636 9:75394921-75394943 GACATTGGGTGCCACATTGATGG - Intergenic
1055417554 9:76099773-76099795 GTGATTGAGTGCTACAGGAATGG + Intronic
1056333283 9:85539753-85539775 GAAATTGAGTGCCTCTTTAATGG - Intergenic
1186705140 X:12133055-12133077 GACAGTAAGTGCTAGATTAAGGG + Intergenic
1188857881 X:35220052-35220074 GACACTGCGTGCCAGATTAATGG + Intergenic
1193040800 X:77001626-77001648 AACATTGAGTGCTACATAGTGGG - Intergenic
1193866639 X:86740092-86740114 GAGATTGAATGATACAGTAAAGG - Intronic
1194414363 X:93592245-93592267 GGCCTTGAGTGCTATGTTAAGGG - Intergenic
1200305756 X:155024645-155024667 GACATTGACTTCTACACTGAGGG + Intronic