ID: 944544560

View in Genome Browser
Species Human (GRCh38)
Location 2:200786183-200786205
Sequence GTAAATTCTGGCTGGCACGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944544560_944544564 10 Left 944544560 2:200786183-200786205 CCACCGTGCCAGCCAGAATTTAC No data
Right 944544564 2:200786216-200786238 CATTTGATCAAATTACAACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944544560 Original CRISPR GTAAATTCTGGCTGGCACGG TGG (reversed) Intergenic