ID: 944545886

View in Genome Browser
Species Human (GRCh38)
Location 2:200798473-200798495
Sequence CAGGTAGACATGAATTTGGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944545878_944545886 2 Left 944545878 2:200798448-200798470 CCAAATAAGGCCACTTCTGAGGT No data
Right 944545886 2:200798473-200798495 CAGGTAGACATGAATTTGGGGGG No data
944545880_944545886 -8 Left 944545880 2:200798458-200798480 CCACTTCTGAGGTTCCAGGTAGA No data
Right 944545886 2:200798473-200798495 CAGGTAGACATGAATTTGGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944545886 Original CRISPR CAGGTAGACATGAATTTGGG GGG Intergenic
No off target data available for this crispr