ID: 944546009

View in Genome Browser
Species Human (GRCh38)
Location 2:200799636-200799658
Sequence CTGTGACTATGTAGGTTACA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944546005_944546009 -8 Left 944546005 2:200799621-200799643 CCTAATCCCTAGAAACTGTGACT No data
Right 944546009 2:200799636-200799658 CTGTGACTATGTAGGTTACATGG No data
944546004_944546009 -2 Left 944546004 2:200799615-200799637 CCATGTCCTAATCCCTAGAAACT No data
Right 944546009 2:200799636-200799658 CTGTGACTATGTAGGTTACATGG No data
944546003_944546009 8 Left 944546003 2:200799605-200799627 CCAAAGACATCCATGTCCTAATC No data
Right 944546009 2:200799636-200799658 CTGTGACTATGTAGGTTACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944546009 Original CRISPR CTGTGACTATGTAGGTTACA TGG Intergenic
No off target data available for this crispr