ID: 944550966

View in Genome Browser
Species Human (GRCh38)
Location 2:200844579-200844601
Sequence GCTCATCCTGGGCCACACTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944550966_944550971 1 Left 944550966 2:200844579-200844601 CCTGAGTGTGGCCCAGGATGAGC No data
Right 944550971 2:200844603-200844625 GGTGATCTTCAGTGAGGAGCTGG 0: 1
1: 1
2: 1
3: 13
4: 178
944550966_944550970 -5 Left 944550966 2:200844579-200844601 CCTGAGTGTGGCCCAGGATGAGC No data
Right 944550970 2:200844597-200844619 TGAGCTGGTGATCTTCAGTGAGG 0: 1
1: 1
2: 2
3: 13
4: 136

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944550966 Original CRISPR GCTCATCCTGGGCCACACTC AGG (reversed) Intergenic
No off target data available for this crispr