ID: 944565074

View in Genome Browser
Species Human (GRCh38)
Location 2:200981666-200981688
Sequence AGGGCTCTCACTGGATTTGA TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 211
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 195}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944565074 Original CRISPR AGGGCTCTCACTGGATTTGA TGG Exonic
900773106 1:4561529-4561551 AGGGGTCTCAGTGGGTGTGATGG + Intergenic
904057252 1:27679593-27679615 ATGGCTCTCACAAGATCTGATGG - Intergenic
904741179 1:32677235-32677257 AGGCCAATCACTTGATTTGAGGG + Intronic
907987879 1:59550720-59550742 ATGGCTCTCACTGAGTTTCATGG + Intronic
908860586 1:68482773-68482795 AAGGCACTCAGTTGATTTGAAGG + Exonic
916924038 1:169498807-169498829 AGGGTTCTCACAAGATCTGATGG - Intergenic
917642878 1:176999779-176999801 TGGGTTCTCACAAGATTTGATGG + Intronic
917647698 1:177045241-177045263 ATGGCTCTGACTGGACTTGCAGG + Intronic
919331686 1:196180561-196180583 AGGGCTCTCTCTGGCTGTGTAGG + Intergenic
919449663 1:197755823-197755845 ATGGGTCTCACAGGATCTGATGG - Intronic
921012000 1:211150909-211150931 AGGGCTCTCCAGGTATTTGAAGG - Intergenic
923881797 1:238111597-238111619 AGGGCTGTTACTGAATTTGCAGG + Intergenic
923970144 1:239191575-239191597 AGGGCTTTCAATGACTTTGATGG - Intergenic
1064098182 10:12439951-12439973 AGGTCTCTCACGAGATCTGATGG - Intronic
1068170839 10:53391986-53392008 TGGGCTCTCGCTGGATATGTTGG + Intergenic
1068321887 10:55429609-55429631 AGGACACTCACTTGCTTTGAAGG + Intronic
1069057466 10:63859765-63859787 AGAGCTCTCACAAGATCTGATGG - Intergenic
1069574650 10:69517770-69517792 AGGGCTCTGCCAGGGTTTGAGGG + Intergenic
1074640774 10:115378001-115378023 AGGGCTGCCACTGGATTTCTGGG + Intronic
1074776483 10:116771403-116771425 AGGCCTGTCACTGGCTTTGCTGG - Intergenic
1075995534 10:126873532-126873554 GGGGCCCTCACTGAATTGGAAGG - Intergenic
1077401713 11:2361760-2361782 TGGGCCCTCAGTGGATTGGATGG - Intergenic
1080431186 11:32201432-32201454 TGGGCCCTCAATGGATTGGATGG - Intergenic
1082720412 11:56668408-56668430 AGAGCTATCACAGGATTTGTAGG + Intergenic
1083367722 11:62151595-62151617 AGGGCGTTCTCTGGGTTTGATGG + Intronic
1087397388 11:97617449-97617471 AGGGTTCTCACAGCATTTTAAGG + Intergenic
1088872962 11:113908359-113908381 TGGGCTGTCAGTGGTTTTGATGG - Intronic
1090096126 11:123743033-123743055 TGGGCCCTCAATGGATTGGATGG + Intergenic
1091322983 11:134664844-134664866 GGGGCTCTCACTGGAGCAGAGGG + Intergenic
1091807060 12:3364364-3364386 AGGGCTGGCTCTGGATCTGAAGG + Intergenic
1092210299 12:6641569-6641591 AGGGAGCTCACTGGATTTGATGG - Intronic
1094501232 12:31022947-31022969 GGGGCACTCACAGTATTTGAGGG - Intergenic
1096839865 12:54373655-54373677 AGGCATCTCTCTGGATTTGGTGG + Intronic
1098771460 12:74558807-74558829 AGAGCTCTCACAAGATCTGATGG - Intergenic
1098870205 12:75808886-75808908 ATGGTTCTCACGGGATCTGATGG + Intergenic
1100766928 12:97876749-97876771 ATGGATTTCAATGGATTTGAAGG + Intergenic
1101449289 12:104761627-104761649 AGGGTTCTAACTGGTTGTGATGG - Exonic
1103453771 12:121048840-121048862 CAGGCTCTCAGTGGATTGGACGG - Intergenic
1103988642 12:124783923-124783945 AGCATTCTTACTGGATTTGAGGG + Intronic
1104337823 12:127917000-127917022 ATGGGTCTTACTGGATTTGCAGG - Intergenic
1105209069 13:18247337-18247359 GTGGCTCTCAGGGGATTTGAGGG - Intergenic
1106582194 13:31027978-31028000 AGGGGTCTAAGTGGCTTTGAGGG - Intergenic
1106708618 13:32308232-32308254 AGAGCTCTGACTGGATTCTATGG - Intronic
1106878647 13:34104981-34105003 CGGGGTCTCACTGGAGCTGAGGG - Intergenic
1108805939 13:54156596-54156618 TGGGCTCCTAGTGGATTTGACGG - Intergenic
1110914733 13:81007975-81007997 TGAGTTCTCACAGGATTTGATGG + Intergenic
1111903024 13:94222940-94222962 GGGGCTATCTCTGAATTTGATGG - Intronic
1112178961 13:97057785-97057807 AGGGCTCACACTGTATTTCATGG + Intergenic
1112188003 13:97146494-97146516 AGGGATCTCACTTGATTGGTGGG + Intergenic
1116762230 14:49027958-49027980 ATGGCTCTCACAAGATCTGATGG + Intergenic
1117816537 14:59604832-59604854 GGGGCTCTCACTGAATTTGCTGG - Intronic
1118863814 14:69686704-69686726 ATGGGTCTCACAAGATTTGACGG - Intronic
1119612100 14:76072169-76072191 AGTACTCTCCATGGATTTGATGG - Intronic
1121438955 14:93936829-93936851 AGGGCTTTCTCTGGCTCTGAGGG - Intronic
1122182017 14:99962264-99962286 CGGGCTCTCTCTGGAACTGATGG - Intergenic
1123171520 14:106377446-106377468 AGGGCTTTGAGTGGATGTGATGG - Intergenic
1124685789 15:31780795-31780817 AGGGCTGTCATTGGATCTGATGG + Intronic
1127774752 15:62256079-62256101 AGGGCTCTCCCTGGTTTTGCTGG + Intergenic
1129619034 15:77126876-77126898 AGGGCTTTTCCTGGATTTGAAGG - Intronic
1132178683 15:99734858-99734880 ATGAGTCTCACTAGATTTGATGG + Intergenic
1133816912 16:9204435-9204457 AGTGCTCTCCCTGCATATGAAGG - Intergenic
1134275182 16:12769653-12769675 CGGGCTCATACTGGATGTGAAGG + Intronic
1135656910 16:24257986-24258008 AGGGAAGTCACTGGATTAGAGGG + Intronic
1136452313 16:30360221-30360243 ATCGGTCTCACTGGATTTCATGG + Intronic
1137407366 16:48200239-48200261 AGGGCTCTGACTGTGATTGACGG - Intronic
1137638787 16:50010353-50010375 AGGGCTTTCACTGTGTTTGGAGG + Intergenic
1137747103 16:50830607-50830629 AGAGCTCTCACTGCAGATGATGG - Intergenic
1139335109 16:66226091-66226113 TGGGCTCTGACTGACTTTGAAGG - Intergenic
1139425887 16:66879872-66879894 AAGCCTCTCACTTGATTTTACGG - Intronic
1139942166 16:70613137-70613159 AGGGGTGTCACTGGAAGTGAAGG + Intronic
1140147038 16:72321080-72321102 ACGAGTCTCACAGGATTTGATGG - Intergenic
1141868851 16:86770546-86770568 AGGACTTTCACTAGATGTGATGG + Intergenic
1145736203 17:27233528-27233550 TGAGTTCTCACGGGATTTGATGG - Intergenic
1151684450 17:75638624-75638646 ACGGGTCTCACTGGCTTTGGGGG - Exonic
1154049634 18:10941955-10941977 AGGGGTCTCACGAGATCTGATGG + Intronic
1156819465 18:41355184-41355206 AGAGCTCTCACTGGAGAGGAAGG - Intergenic
1157135999 18:45056329-45056351 GGGGATCTCACTGGCTTTCAGGG - Intronic
1158125950 18:54099953-54099975 AAGCCTCTCACCAGATTTGAAGG + Intergenic
1158994056 18:62899254-62899276 AGGACTCACACTGGGGTTGAAGG - Intronic
1159650260 18:70970315-70970337 ATGGGTCTCACAGGATCTGATGG - Intergenic
1162573637 19:11486415-11486437 AGGACTGGGACTGGATTTGAGGG + Intronic
1163472032 19:17503094-17503116 AGGGGTCTCACGAGATTTGATGG - Intronic
1165944630 19:39434472-39434494 TTGGCTGTCACTGTATTTGAAGG - Intronic
1166042221 19:40210858-40210880 TGGGCCCTCAGTGGATTGGATGG + Intronic
1167418352 19:49389054-49389076 AGGGGTCTGACTGGATTTCTGGG - Intronic
1167418402 19:49389263-49389285 GGGTCTCTGACTGGATTTCAGGG - Intronic
1167418419 19:49389348-49389370 AGGGCTCTGACAGGATTTTGGGG - Intronic
1167463708 19:49639515-49639537 AAGGCTCTCAATGGCTTAGAGGG + Intronic
925381058 2:3426582-3426604 AGGGCCCTCACTGGTGTTGCTGG + Intronic
926209967 2:10862475-10862497 AGGGCTCTCTCTGGCTGTGTGGG - Intergenic
926803974 2:16687508-16687530 AGTGCTCTCAATGCATTTCAAGG - Intergenic
928368773 2:30723524-30723546 AGGGCTGGCACTGGAGTGGAGGG + Intronic
928408554 2:31034158-31034180 AGAGATGTCACAGGATTTGATGG - Intronic
928598817 2:32883848-32883870 ATTGCTCTCACTTGATTTGCTGG - Intergenic
931524096 2:63133579-63133601 AGAGTTCTCACAAGATTTGATGG + Intronic
932414955 2:71568013-71568035 TGGGCTCTCAGTGGATGAGAAGG + Exonic
932756019 2:74410101-74410123 AGAGATCTCACAAGATTTGATGG - Intergenic
934700997 2:96439855-96439877 TGAGCTCTCACTAGATCTGATGG + Intergenic
941320032 2:164042426-164042448 ATGGGTCTCACAAGATTTGATGG - Intergenic
943675915 2:190716395-190716417 AGGGCTCTCTCTGTCTTTAAAGG + Intergenic
943732886 2:191321926-191321948 AGGGCTCCCAAAGGATTTCATGG - Intronic
944011607 2:194980593-194980615 TGGGCTCTCACACGATCTGATGG - Intergenic
944111173 2:196132404-196132426 GGGGCTCGCCCAGGATTTGAAGG - Intergenic
944565074 2:200981666-200981688 AGGGCTCTCACTGGATTTGATGG + Exonic
945312141 2:208326133-208326155 AGGGATCTCTCTGGACTTCAGGG + Exonic
945407431 2:209466851-209466873 CTGGCTCTCACTGGATGAGAGGG + Intronic
945713818 2:213333436-213333458 AGGGGTCACACTGAATTTGTAGG - Intronic
948446478 2:238037500-238037522 GGGGCTCTGGCTGGATTTGGTGG + Intronic
1169195573 20:3680623-3680645 AGGGCTCTGAGTGGATGTGGGGG + Intronic
1169417861 20:5432992-5433014 CGGGCCCTCAGTGGATTGGACGG + Intergenic
1170037654 20:12005594-12005616 ATGGGTCTCACTAGATCTGATGG + Intergenic
1171290241 20:23979051-23979073 GTGGCTCTCAGGGGATTTGAGGG - Intergenic
1173042482 20:39477398-39477420 TGGGCTCTCACTGAATCTGGAGG - Intergenic
1173595302 20:44255210-44255232 AGGACTCCCACTGGATAAGAGGG + Intronic
1173860681 20:46281307-46281329 AGGCATCTCACAGGATTAGAAGG - Intronic
1174003636 20:47392941-47392963 AGGACTCTCACTGGAACTGTTGG + Intergenic
1175753563 20:61515385-61515407 AGGGTCCTCACTGGCTTTGCAGG - Intronic
1176171322 20:63697632-63697654 AGGGGCCACAGTGGATTTGAGGG + Intronic
1177900285 21:26906032-26906054 ATGGGTCTCACAAGATTTGATGG + Intergenic
1180767187 22:18351961-18351983 GTGGCTCTCAGGGGATTTGAGGG + Intergenic
1180779123 22:18510418-18510440 GTGGCTCTCAGGGGATTTGAGGG - Intergenic
1180811843 22:18767738-18767760 GTGGCTCTCAGGGGATTTGAGGG - Intergenic
1180870022 22:19140707-19140729 AGGACTGTCACTAGACTTGAAGG - Intronic
1181197998 22:21201980-21202002 GTGGCTCTCAGGGGATTTGAGGG - Intergenic
1181401748 22:22653825-22653847 GTGGCTCTCAGGGGATTTGAGGG + Intergenic
1181570421 22:23765244-23765266 ACGGCCCACACTGGGTTTGAAGG + Intronic
1181647806 22:24243280-24243302 GTGGCTCTCAGGGGATTTGAGGG - Intronic
1181703704 22:24634919-24634941 GTGGCTCTCAGGGGATTTGAGGG + Intergenic
1182361630 22:29749782-29749804 AGAGTTCTCACAGGATCTGATGG + Intronic
1182636078 22:31728088-31728110 AGAGCTCCCACTGGATCTGGAGG - Intronic
1182979737 22:34657601-34657623 AGAGTTCTCACAAGATTTGATGG + Intergenic
1203228808 22_KI270731v1_random:92855-92877 GTGGCTCTCAGGGGATTTGAGGG + Intergenic
949954507 3:9256581-9256603 ATGGCTTCCACTGGGTTTGAGGG + Intronic
951093211 3:18599020-18599042 ATGGCTCTCACAAGATCTGATGG - Intergenic
952527104 3:34222227-34222249 TGGGCTCTCACTGCATTGGGTGG + Intergenic
952978184 3:38713965-38713987 CGGGCTCTTTCTCGATTTGAAGG - Exonic
956028084 3:65005466-65005488 AGTGCTCGCACTGTATTCGAAGG - Intergenic
957684491 3:83483365-83483387 ATGGGTCTCACTAGATCTGATGG + Intergenic
959021343 3:101190799-101190821 TGGGCTCTCCCAGGGTTTGAAGG - Intergenic
963280601 3:143381305-143381327 ATGGGTCTCACTAGATCTGATGG + Intronic
963385444 3:144586461-144586483 AGGGCTGATACTGGATTTGGAGG - Intergenic
964897715 3:161618127-161618149 TGGGCACTCAATGGATTGGATGG + Intergenic
969169279 4:5346973-5346995 TGGGTTCTCACAGGATCTGATGG - Intronic
970987243 4:22172806-22172828 AGAGTTCTCACCAGATTTGAAGG - Intergenic
972966234 4:44513839-44513861 TGGGCTCTCATTGGATTGGATGG - Intergenic
974230035 4:59100100-59100122 ATGGGTCTCACAAGATTTGATGG - Intergenic
979423431 4:120534584-120534606 CGGGCGCTCAGTGGATTAGATGG - Intergenic
980338775 4:131513550-131513572 TGAGCTCTCACGAGATTTGATGG + Intergenic
981103442 4:140855285-140855307 ATGGCTCTCAGTGGAATGGATGG + Intergenic
982403665 4:154997267-154997289 TGAGTTCTCACTAGATTTGATGG - Intergenic
985294124 4:188416396-188416418 TGGGCCCTCAGTGGATTGGATGG + Intergenic
986089837 5:4493329-4493351 CGGGCTCTCAATGGATTGGATGG - Intergenic
986829747 5:11562914-11562936 ACGGCTCTCACTGACTTTCAGGG + Intronic
986906759 5:12503792-12503814 TGAGTTCTCACAGGATTTGATGG + Intergenic
987047380 5:14120519-14120541 AGGATTCTTAATGGATTTGAAGG - Intergenic
989268764 5:39507219-39507241 ACCGCTCTCACTGGATTGCAAGG - Intergenic
991586422 5:68206639-68206661 AGAGTTCTCACTAGATCTGATGG + Intergenic
992212175 5:74491664-74491686 AGTGCTCTCACTGGATGTCATGG - Intergenic
999280789 5:150364241-150364263 AAGGCTCTTACTGGCTTTGGCGG - Exonic
1000034684 5:157436218-157436240 ATGGGTCTCACGAGATTTGATGG + Intronic
1001570178 5:172725670-172725692 AGGGATCTCACTGCCTTTGGAGG - Intergenic
1002441379 5:179266140-179266162 AGGGCTTTGGCTGGATTTGCAGG - Intronic
1002441736 5:179267797-179267819 AGGGCTTTGTCTGGATTTGCTGG + Intronic
1002459628 5:179366890-179366912 AGGGCTCAAGCTGGGTTTGAGGG + Intergenic
1002667521 5:180836512-180836534 TGAGGTCACACTGGATTTGAGGG - Intergenic
1003016689 6:2473797-2473819 AGGCATCTCACTGGAATGGATGG - Intergenic
1008024841 6:46623525-46623547 CAGGCTCTCAGTGGATTGGATGG - Intronic
1009044045 6:58216335-58216357 TGGGCCCTCAGTCGATTTGATGG - Intergenic
1009219873 6:60970603-60970625 TGGGCCCTCAGTCGATTTGATGG - Intergenic
1009663768 6:66649492-66649514 AGGGCACTAACTTGACTTGAAGG + Intergenic
1009996482 6:70900968-70900990 ATGGGTCCCATTGGATTTGATGG - Intronic
1010323956 6:74544037-74544059 ATGGGTCTCACTAGATCTGATGG - Intergenic
1012956805 6:105579853-105579875 TGAGCTCTCACTGGATCTGATGG - Intergenic
1014944266 6:127478221-127478243 AGGGGTCTCATTGGATTGTATGG + Intronic
1019007830 6:168817150-168817172 TGGACTCCCACTCGATTTGATGG - Intergenic
1019906419 7:4068538-4068560 AGGGCTCTCACTGGAGGGCAGGG - Intronic
1022313257 7:29217875-29217897 ATGTCTCTTCCTGGATTTGAAGG + Intronic
1022612026 7:31885542-31885564 AGGGCTCGCTCTGGATCTGAGGG - Intronic
1022777827 7:33545532-33545554 GGGGCACTCACAGTATTTGAGGG + Intronic
1024021289 7:45373318-45373340 ATGGCTCTCACAAGATCTGATGG - Intergenic
1024085049 7:45885569-45885591 AGAGCTCTCTCTTGATTTGGGGG + Intergenic
1026210476 7:68299689-68299711 TGGGCTCTAAATGGATTGGATGG - Intergenic
1026597798 7:71748957-71748979 AGTGCTCTCATTGAAGTTGAGGG + Intergenic
1030409503 7:109157705-109157727 AGGGCTCTCTTTGGATTTATCGG - Intergenic
1031096743 7:117429132-117429154 AAGGCACTCACTGAATTTGCAGG - Intergenic
1031170512 7:118286721-118286743 AGTGGTCTCACTGGACTTCACGG + Intergenic
1031875268 7:127132602-127132624 AGGAATCTCACTTTATTTGAAGG + Intronic
1032894620 7:136236754-136236776 TGAGTTCTCACTAGATTTGATGG - Intergenic
1034259739 7:149747408-149747430 AGGGCCCTCAATGGATCGGATGG + Intergenic
1041312017 8:56526673-56526695 AGGGTTCTCATAAGATTTGATGG - Intergenic
1042370002 8:67980715-67980737 TGAGCTCTCACTAGATCTGATGG + Intronic
1043700100 8:83276032-83276054 AGAGCTCTCACTAGATCTGATGG - Intergenic
1044181805 8:89205457-89205479 ATGGGTCTCACAAGATTTGATGG - Intergenic
1045939928 8:107727651-107727673 ATGGGTCCCACAGGATTTGATGG - Intergenic
1045947665 8:107814757-107814779 TGGGCCCTCAATGGATTGGATGG - Intergenic
1048201388 8:132377154-132377176 TGGGCCCTCAGTGGATTGGATGG - Intronic
1048575476 8:135686602-135686624 AGGGCTCCCAGTGAATTGGATGG + Intergenic
1050302546 9:4274328-4274350 AGGTCTCTCTCTGGACTTGTTGG + Intronic
1051015728 9:12473909-12473931 ATGGCTCTCACAAGATTTGATGG + Intergenic
1052463369 9:28796128-28796150 AGAGCTGTCACTGTATTTGAGGG + Intergenic
1058782695 9:108354112-108354134 TGAGTTCTCACAGGATTTGATGG + Intergenic
1062301073 9:135870254-135870276 TGGGCTCTCACAAGATGTGATGG + Intronic
1062687458 9:137822064-137822086 AGGGCTCACAGGGGATTTGGGGG - Intronic
1188948004 X:36332235-36332257 AGGGCTCCAACTACATTTGATGG - Intronic
1189945172 X:46170655-46170677 ATGGGTCTCACAGGATCTGATGG - Intergenic
1192236109 X:69297185-69297207 AGGGCTCTGCCTGGATTGGGAGG + Intergenic
1193370846 X:80695011-80695033 AGGTCCCTCCCTGGATGTGAAGG - Intronic
1193709379 X:84860789-84860811 ATGGCTCTCAGTGGAATAGATGG - Intergenic
1196558937 X:117123151-117123173 AAGTCCCTCACTGGAGTTGATGG - Intergenic
1198305531 X:135379157-135379179 TGGGCTCTCAGTGGAGTGGATGG - Intergenic
1201744425 Y:17355209-17355231 AGAGCTCTCACAAGATCTGACGG + Intergenic