ID: 944579466

View in Genome Browser
Species Human (GRCh38)
Location 2:201118942-201118964
Sequence CTGGTGTCGCCCTGGGCTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 314
Summary {0: 1, 1: 0, 2: 2, 3: 25, 4: 286}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944579458_944579466 -10 Left 944579458 2:201118929-201118951 CCCCGCCCCTGGGCTGGTGTCGC 0: 1
1: 0
2: 2
3: 15
4: 127
Right 944579466 2:201118942-201118964 CTGGTGTCGCCCTGGGCTCCTGG 0: 1
1: 0
2: 2
3: 25
4: 286
944579453_944579466 0 Left 944579453 2:201118919-201118941 CCTGCCCGATCCCCGCCCCTGGG 0: 1
1: 0
2: 4
3: 29
4: 463
Right 944579466 2:201118942-201118964 CTGGTGTCGCCCTGGGCTCCTGG 0: 1
1: 0
2: 2
3: 25
4: 286
944579451_944579466 8 Left 944579451 2:201118911-201118933 CCGAGAATCCTGCCCGATCCCCG 0: 1
1: 0
2: 0
3: 2
4: 83
Right 944579466 2:201118942-201118964 CTGGTGTCGCCCTGGGCTCCTGG 0: 1
1: 0
2: 2
3: 25
4: 286
944579450_944579466 23 Left 944579450 2:201118896-201118918 CCGGGCGTGAGTAGACCGAGAAT 0: 1
1: 0
2: 1
3: 1
4: 20
Right 944579466 2:201118942-201118964 CTGGTGTCGCCCTGGGCTCCTGG 0: 1
1: 0
2: 2
3: 25
4: 286
944579455_944579466 -4 Left 944579455 2:201118923-201118945 CCCGATCCCCGCCCCTGGGCTGG 0: 1
1: 0
2: 2
3: 29
4: 350
Right 944579466 2:201118942-201118964 CTGGTGTCGCCCTGGGCTCCTGG 0: 1
1: 0
2: 2
3: 25
4: 286
944579449_944579466 24 Left 944579449 2:201118895-201118917 CCCGGGCGTGAGTAGACCGAGAA 0: 1
1: 0
2: 0
3: 3
4: 34
Right 944579466 2:201118942-201118964 CTGGTGTCGCCCTGGGCTCCTGG 0: 1
1: 0
2: 2
3: 25
4: 286
944579457_944579466 -5 Left 944579457 2:201118924-201118946 CCGATCCCCGCCCCTGGGCTGGT 0: 1
1: 0
2: 0
3: 21
4: 285
Right 944579466 2:201118942-201118964 CTGGTGTCGCCCTGGGCTCCTGG 0: 1
1: 0
2: 2
3: 25
4: 286

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944579466 Original CRISPR CTGGTGTCGCCCTGGGCTCC TGG Intronic
900128958 1:1079578-1079600 CTGAGGTCACTCTGGGCTCCCGG + Intergenic
900163420 1:1235306-1235328 CTGGTTTGGCCCTGGTCTCCGGG - Intergenic
900311517 1:2035695-2035717 ATGGTGACGCCCTGGTCTGCAGG - Intergenic
900372046 1:2336500-2336522 GTGGTGTCCCCCTGGGGTGCAGG + Exonic
900409561 1:2506584-2506606 CAGGTGCCGCCCCGGGCCCCAGG - Intergenic
900880301 1:5376863-5376885 ATGGTGGGGCCCTGAGCTCCAGG - Intergenic
900996102 1:6124464-6124486 CTGGTGGCTGCCTGGGCTCCTGG - Intronic
901404786 1:9038786-9038808 CTGGTGCAGCTCCGGGCTCCTGG + Intronic
902979610 1:20113531-20113553 CTGGTGTTGCTTTGGGCACCAGG + Exonic
903161302 1:21491058-21491080 CTGCTCTGGCCCAGGGCTCCAGG - Intergenic
903336252 1:22626705-22626727 CTGGCCATGCCCTGGGCTCCAGG + Intergenic
903448554 1:23437522-23437544 GTGGGGGCTCCCTGGGCTCCGGG - Intronic
903602913 1:24555586-24555608 GGGATATCGCCCTGGGCTCCTGG + Intergenic
904380442 1:30107164-30107186 CTTGTGTGGCCCTGGGCTACAGG - Intergenic
904592481 1:31622722-31622744 CTGGGGTGGTTCTGGGCTCCTGG - Intronic
905356434 1:37388164-37388186 CTGCTGTGGGCATGGGCTCCAGG - Intergenic
912544628 1:110441795-110441817 CTGGCTTCTCCCTGGCCTCCTGG + Intergenic
916214868 1:162385827-162385849 CCAGAGCCGCCCTGGGCTCCAGG - Intronic
918044737 1:180935136-180935158 CAGGGGTCGTCCTGGGGTCCCGG - Exonic
919775096 1:201189292-201189314 ATGGTGGGGCCCTGAGCTCCAGG - Intergenic
919795913 1:201321414-201321436 ATGATGAAGCCCTGGGCTCCAGG + Intronic
922789959 1:228305999-228306021 CTGGCCTCGCCCTGGGATCTGGG + Intronic
924772053 1:247087597-247087619 GTGGTGTGTCCCTGGGTTCCAGG - Intergenic
1062939612 10:1411360-1411382 CTGGTCCCGCCCTGGGCTGGTGG - Intronic
1062972934 10:1662287-1662309 CTGGGGCCAGCCTGGGCTCCTGG - Intronic
1063973464 10:11397280-11397302 CAGCTGTCCCCCAGGGCTCCTGG + Intergenic
1064250125 10:13700482-13700504 CTGAGGTCACCCTGGGCCCCTGG - Intronic
1068303521 10:55176090-55176112 CTAGAATCACCCTGGGCTCCTGG - Intronic
1070796360 10:79219219-79219241 CTGGGGAGGCACTGGGCTCCTGG - Intronic
1070805908 10:79270623-79270645 CTGGTGTCCCCGTGGCTTCCTGG + Intronic
1071564345 10:86663852-86663874 CTGGCCTCTCCCTGGGCTACTGG - Intronic
1072622506 10:97089420-97089442 CTGCTGGGGCCCTCGGCTCCAGG + Intronic
1073043231 10:100621475-100621497 CTGGGGGCGCCCTCGGCTCTGGG + Intergenic
1073459920 10:103660549-103660571 CTGCTGTCACCATGGGGTCCAGG - Intronic
1074974835 10:118571614-118571636 CTGTTGTTGCTCTGGGCTCGAGG + Intergenic
1075628195 10:123980133-123980155 TTGATGTTTCCCTGGGCTCCTGG - Intergenic
1075683666 10:124349562-124349584 GTGGTGTCCCCCGTGGCTCCTGG - Intergenic
1076232718 10:128835120-128835142 CTGGTGCTGCCCTGGGCTGAAGG - Intergenic
1076887992 10:133271323-133271345 CTGGGGCCGGGCTGGGCTCCAGG + Intronic
1077137994 11:1011068-1011090 CTGGCGTCGTCCTGGGCCCTTGG + Exonic
1077141362 11:1026288-1026310 CTTCAGACGCCCTGGGCTCCTGG - Intronic
1077199997 11:1302011-1302033 CTGGTGATGACCTGGGCTCCAGG - Intronic
1077228333 11:1447948-1447970 CTGGTGGCGGGCTGGGCTGCAGG + Intronic
1077266865 11:1655247-1655269 CTGGAGGCCCCCTGTGCTCCAGG - Intergenic
1077348322 11:2075311-2075333 ATGGTGTGGCTCTGTGCTCCTGG - Intergenic
1077354486 11:2108885-2108907 CTGGTGTCCCCCAGGGCCTCAGG - Intergenic
1078532875 11:12150536-12150558 CTGCAGTCGTCCTGGGCTCCAGG + Intronic
1079163327 11:18013608-18013630 CCGGTGTCGCCCTCTGCACCTGG + Intergenic
1081937537 11:46915890-46915912 CTGCTGTCTCCCTGAGCCCCTGG + Intronic
1082010628 11:47447784-47447806 CTGCTGTCCCCCTGGGGTGCAGG + Intronic
1082564754 11:54663042-54663064 CTGGTGGTGCCCTGGGCTGGAGG + Intergenic
1082811324 11:57480791-57480813 CTGGTCTATCCCTGGCCTCCTGG - Intergenic
1084203249 11:67576315-67576337 CTGCTGACGCCCTGCACTCCAGG - Intergenic
1084252191 11:67908509-67908531 CAGGTGTGCCACTGGGCTCCTGG - Intergenic
1085044825 11:73346741-73346763 CTCCTGCCGCCCAGGGCTCCGGG - Intronic
1085126227 11:74004464-74004486 CTGGTGAGGCCCTGGGCTCCAGG - Exonic
1087094262 11:94305151-94305173 CTGGGGGAGCCATGGGCTCCTGG + Intergenic
1089347080 11:117797331-117797353 CTGGGGTCCGTCTGGGCTCCGGG - Intronic
1096621954 12:52870711-52870733 CTGGTGCCGCCCTGGGAGCTGGG - Intergenic
1102979024 12:117227020-117227042 CTGGTGGCTTGCTGGGCTCCTGG + Intronic
1103870574 12:124088369-124088391 CAGGTGCAGGCCTGGGCTCCCGG - Exonic
1104865379 12:131950291-131950313 CTCGTGGCCCCCCGGGCTCCTGG + Intronic
1104878831 12:132055176-132055198 CTGGCGTCGCCAGTGGCTCCTGG + Exonic
1105454221 13:20525703-20525725 CCGGCGTCTCCCCGGGCTCCAGG + Intronic
1105865020 13:24451537-24451559 CTGGACTCGCCCTGAGCTCCAGG - Intronic
1105890720 13:24680715-24680737 CTGGTGGCGCCGCGGGCTGCGGG - Exonic
1106582132 13:31027626-31027648 CTAGTGCAGCCCTGGGCTCTGGG + Intergenic
1106620157 13:31364898-31364920 TTGGTGCCTCCCTGTGCTCCTGG + Intergenic
1107664473 13:42674728-42674750 CTGGTGCGGCCCTAGGCCCCGGG + Intergenic
1108314200 13:49221427-49221449 CTGGGGTCCCCCAGAGCTCCTGG - Intronic
1108951919 13:56105139-56105161 CTGGTCCCACCCTGGGCACCTGG + Intergenic
1112354604 13:98663185-98663207 CAGGTCTCGCGCTGGGCTGCAGG - Intergenic
1113628782 13:111865981-111866003 CTAGTGTTCCCCTTGGCTCCCGG + Intergenic
1114031975 14:18586301-18586323 CTGGTGACTCCCTGGGGTCAAGG + Intergenic
1114076749 14:19165330-19165352 CTGGTGACCCCCTGGGGTCAAGG + Intergenic
1114076973 14:19166431-19166453 CTGGTATCCACCTGGGGTCCAGG - Intergenic
1114085187 14:19233137-19233159 CTGGTATCCACCTGGGGTCCAGG + Intergenic
1114085414 14:19234238-19234260 CTGGTGACCCCCTGGGGTCAAGG - Intergenic
1114558839 14:23577335-23577357 CTGTACTCGCCCTGGGCGCCGGG + Exonic
1115970695 14:38941656-38941678 CTGGAGGTGCCCTGTGCTCCAGG + Intergenic
1118162904 14:63309026-63309048 CTGCTGTGGCACTGGGCTTCTGG - Intergenic
1122152315 14:99731741-99731763 CTGGCCTCGCCCTGGGCCCATGG - Intergenic
1122254833 14:100469060-100469082 CTGGCCTCTCCCTGGGCTCCTGG - Intronic
1122300170 14:100726992-100727014 CTGGCGCCGCACTGGGCTTCTGG - Exonic
1122818334 14:104326404-104326426 CTGGGGTCCCTCTGGGGTCCAGG + Intergenic
1123699075 15:22901463-22901485 CAGTTGCCGCCTTGGGCTCCAGG + Intronic
1128114031 15:65094392-65094414 CTGGTGTGGCCCTGCACACCGGG + Intronic
1128830999 15:70768626-70768648 CTGGTGTTTATCTGGGCTCCAGG - Intergenic
1130888710 15:88115365-88115387 CTGTTGTTGGCCTGGGCTCTAGG - Intronic
1131024828 15:89131435-89131457 CTGGTGTGGCCTTGGGATCTAGG + Intronic
1132036668 15:98491014-98491036 CTGGTGCTGTCCTGGGCCCCAGG + Intronic
1132209345 15:100008514-100008536 CAGGTGTCCTCCTGGGCCCCCGG - Intronic
1132702765 16:1229115-1229137 CTGGGCTCCCTCTGGGCTCCAGG - Intronic
1132705561 16:1241753-1241775 CTGGGCTCCCTCTGGGCTCCAGG + Intronic
1132895904 16:2229292-2229314 CTGCAGGCGCCCTGTGCTCCAGG + Intronic
1133271409 16:4612552-4612574 CTGGTGTGGCCTGGGGCTCCTGG - Intronic
1134095769 16:11417505-11417527 CCAGTGTGGCTCTGGGCTCCAGG - Intronic
1134538791 16:15047704-15047726 ATGGTGTCTCCCTGGTGTCCTGG - Intronic
1136711237 16:32238860-32238882 CTGGAGTCCACATGGGCTCCAGG + Intergenic
1136756670 16:32690547-32690569 CTGGAGTCCACATGGGCTCCAGG - Intergenic
1136811440 16:33179828-33179850 CTGGAGTCCACATGGGCTCCAGG + Intergenic
1136817916 16:33289908-33289930 CTGGAGTCCACATGGGCTCCAGG + Intronic
1136824480 16:33346437-33346459 CTGGAGTCCACATGGGCTCCAGG + Intergenic
1136829546 16:33445208-33445230 CTGGAGTCCACATGGGCTCCAGG + Intergenic
1137612015 16:49824612-49824634 CTGGTGGTGCCCAGGTCTCCTGG - Intronic
1138221572 16:55256149-55256171 CTGGTCTGACCCTGGGCTCAAGG - Intergenic
1138390757 16:56668439-56668461 CTGGGGTTGCCCTCGACTCCAGG - Intronic
1139557112 16:67719271-67719293 GTGGCGGCGCCCTGGACTCCCGG - Exonic
1139852961 16:69961829-69961851 CTGGCCCCGCTCTGGGCTCCAGG - Intronic
1139881932 16:70184737-70184759 CTGGCCCCGCTCTGGGCTCCAGG - Intronic
1140370579 16:74410769-74410791 CTGGCCCCGCTCTGGGCTCCAGG + Intronic
1141647908 16:85377329-85377351 CTGTTCTCCCCCTTGGCTCCTGG + Intergenic
1142154891 16:88528425-88528447 CTGTGGTGGCCCTGGGCTCTGGG - Intronic
1142261358 16:89043945-89043967 CTGGTGTGGCCCTAGGCCCCAGG + Intergenic
1202990018 16_KI270728v1_random:2797-2819 CTGGAGTCCACATGGGCTCCAGG + Intergenic
1203058819 16_KI270728v1_random:950899-950921 CTGGAGTCCACATGGGCTCCAGG - Intergenic
1142611668 17:1111823-1111845 CTGGTGTCTTGCTGGGCTCTAGG + Intronic
1143259050 17:5584642-5584664 CTGGTCTGGGCCTGTGCTCCTGG - Intronic
1144101909 17:11948947-11948969 CAGCTGTTGCCCTGGGCTCACGG - Intronic
1144782134 17:17813666-17813688 CTGCTGGTGCCCTGGGCTGCTGG + Exonic
1144787948 17:17842232-17842254 CAGTTGCCTCCCTGGGCTCCAGG - Intergenic
1146587143 17:34092108-34092130 CTGGTGTAGACCTGGTGTCCGGG - Intronic
1147120230 17:38331270-38331292 CTGGTGTCCCCTCGGGTTCCTGG + Exonic
1150225984 17:63524621-63524643 CTGCTGTGTCCCTGGTCTCCTGG + Intronic
1150279081 17:63918499-63918521 CTGGTTTCTCCCCAGGCTCCCGG - Exonic
1150286265 17:63955951-63955973 CTGGTGCTGCCCTGGGCAACAGG - Intronic
1151558779 17:74860115-74860137 CTGGGTTCGCCCAGGGCCCCCGG - Intronic
1151714362 17:75823845-75823867 CAGGGGTAGCCCTGGGGTCCTGG - Intronic
1152597669 17:81245867-81245889 CTGGCCTCTGCCTGGGCTCCTGG + Exonic
1152662536 17:81549425-81549447 GTGGTGTTTCCCTGGACTCCAGG + Intronic
1152813722 17:82394706-82394728 CTGGTGTGGCCCTAGGTCCCTGG - Intronic
1152980191 18:268969-268991 CTGGTGTCCCCTTGGCCTCACGG - Intergenic
1153159715 18:2190128-2190150 CTGGTGTCTGTCTGGTCTCCAGG + Intergenic
1154321119 18:13353740-13353762 CTGGTGTAGCCTTGGGCTGGAGG - Intronic
1157496285 18:48159853-48159875 CTGGAGGCCCCCTGGGCTCTGGG - Intronic
1157583807 18:48788511-48788533 GTGGTGTGGCCCTGGGATACAGG - Intronic
1157686600 18:49647623-49647645 CTGCTGGCGCCCTGGGGGCCGGG + Intergenic
1157745102 18:50128486-50128508 CTGCTGGCCTCCTGGGCTCCAGG - Intronic
1158920789 18:62188231-62188253 CTGGTGTTGCACTTGGCTCCTGG + Intronic
1159941687 18:74413282-74413304 CAGGTGTCCCCCAGGGCTACAGG - Intergenic
1160385754 18:78495292-78495314 CTGGTGTGGCCCTCAGCTCCTGG - Intergenic
1160734629 19:656927-656949 ATGGAGCGGCCCTGGGCTCCCGG - Intronic
1160963907 19:1737186-1737208 CTGGTGTTTCCCGCGGCTCCAGG + Intergenic
1161155905 19:2731849-2731871 CTGGGGCAGCCCTGGGCTCCTGG - Intronic
1161327121 19:3669321-3669343 CTGGTCTGGCCCTGGCTTCCAGG + Intronic
1161420623 19:4174449-4174471 GTGGTCCCTCCCTGGGCTCCAGG - Exonic
1161453283 19:4358272-4358294 CTGGTGGCGCCTTGGGGGCCTGG + Intronic
1161478479 19:4498976-4498998 CTGCTGGGGGCCTGGGCTCCCGG - Intronic
1161916323 19:7231064-7231086 CTGGTGTGGCTCCTGGCTCCTGG - Intronic
1161984602 19:7646646-7646668 ATGGTGCTGCCCTGGGATCCTGG - Intronic
1163410047 19:17148506-17148528 CTGGTGGCTCCCTTGGCTCATGG + Intronic
1166083707 19:40461259-40461281 CTGGGTCCTCCCTGGGCTCCTGG + Intronic
1166275466 19:41750500-41750522 CTGGTGTCACCCACTGCTCCAGG + Intronic
1166396252 19:42443483-42443505 CTGGTGTCACCCACTGCTCCAGG - Intergenic
1167138684 19:47634248-47634270 ATGGCCTCGCTCTGGGCTCCAGG - Intronic
1167234284 19:48304181-48304203 CTGGGGTCGGCCTGGGGTCCTGG + Intronic
1167342199 19:48922514-48922536 CTGGTGTCATGTTGGGCTCCTGG + Exonic
1167562395 19:50233667-50233689 CAGGTCTCTCCCTAGGCTCCTGG + Intronic
1168241492 19:55091296-55091318 CGGGTGGCCCCCTCGGCTCCTGG + Exonic
1168490125 19:56802199-56802221 CCAGTGTCAGCCTGGGCTCCTGG - Intronic
1168605871 19:57759549-57759571 CTGGCCTCTCCCAGGGCTCCAGG + Intergenic
925924257 2:8659174-8659196 CTGGGGCAGCCCTGGTCTCCAGG - Intergenic
925925390 2:8666445-8666467 CTGGAGTCAACCTGGGATCCTGG - Intergenic
926593106 2:14760371-14760393 CTGGGGTCGCCTCAGGCTCCCGG - Intergenic
926739851 2:16102248-16102270 CTCCTGTCTCCCTGGGCTCACGG + Intergenic
927709105 2:25314219-25314241 CAGGTGTGGCCCTGGGCTGAGGG - Intronic
932702243 2:73999963-73999985 CTGGTGTAGCCGAGGGCTGCTGG + Intronic
933714558 2:85350557-85350579 CTGCTGTCACCCTGGCCTCTGGG - Intronic
936977740 2:118236352-118236374 CTGGAGCAGCCCTGTGCTCCAGG + Intergenic
937195834 2:120155922-120155944 CTGCTGTCACCCTGGGCCTCTGG + Intronic
938308140 2:130268302-130268324 CCGGTGTCACCCTGAGTTCCTGG - Intergenic
938447191 2:131388534-131388556 CCGGTGTCACCCTGAGTTCCTGG + Intergenic
938491346 2:131762835-131762857 CTGGTGACCCCCTGGGGTCAAGG + Intronic
938491580 2:131763941-131763963 CTGGTATCCACCTGGGGTCCAGG - Intronic
938495987 2:131798401-131798423 CTGGTATCCACCTGGGGTCCAGG + Intronic
938496216 2:131799491-131799513 CTGGTGACCCCCTGGGGTCAAGG - Intronic
940237039 2:151522897-151522919 ATGGTGTGGCCCTGGGCCCAAGG - Intronic
944579466 2:201118942-201118964 CTGGTGTCGCCCTGGGCTCCTGG + Intronic
944914653 2:204345891-204345913 ATCGTGTCTCCCTAGGCTCCTGG - Intergenic
946612499 2:221474489-221474511 CTGGTCTAGCCATGGGATCCTGG - Intronic
947186798 2:227462890-227462912 CTGGTCTCGAGCTGGGCTCTAGG - Intergenic
947744017 2:232498319-232498341 CTGGTCTCGCCATGGCCCCCTGG - Intergenic
947769437 2:232659406-232659428 CAGGTGGCTCCCTGAGCTCCTGG + Intronic
1170881284 20:20298586-20298608 CTGGTGTGGCCATGGGGGCCAGG - Intronic
1173726920 20:45304771-45304793 CAGGTGTCACACTGGGCCCCTGG - Exonic
1174376218 20:50128339-50128361 CAGGTGCTGCCCTGGGCTTCAGG + Intronic
1174516859 20:51099182-51099204 CTTGTGTCTCCCTGGGCCTCTGG + Intergenic
1175610598 20:60347958-60347980 CAGGTGCTGTCCTGGGCTCCAGG + Intergenic
1176005415 20:62859984-62860006 CAGGTGTCGGCCTTGGCGCCCGG + Intronic
1176181560 20:63751985-63752007 GTGGAGGCGCCCCGGGCTCCGGG - Intronic
1176382236 21:6119251-6119273 CCGGTGTCCTCCTGGGCCCCCGG - Intronic
1176708470 21:10131690-10131712 CTGGTGACCCCCTGGGGTCAAGG + Intergenic
1178705241 21:34867799-34867821 CAGGTGTGGCCTTGGTCTCCAGG - Intronic
1179437453 21:41371805-41371827 CTGGTGACAGCCGGGGCTCCTGG - Intronic
1179710802 21:43211917-43211939 CTGGTGCTACCCTGGGCTGCTGG + Intergenic
1179741236 21:43418988-43419010 CCGGTGTCCTCCTGGGCCCCCGG + Intronic
1179944810 21:44666007-44666029 GTGGTCTCTCCCAGGGCTCCTGG - Intronic
1179946456 21:44681395-44681417 GTGGTCTCTCCCAGGGCTCCTGG - Intronic
1179968378 21:44819332-44819354 CTGCTGAGGCCCTGGGCTCCAGG - Intergenic
1180075256 21:45458667-45458689 CTGGAGCCTCCCGGGGCTCCAGG - Intronic
1180292785 22:10860056-10860078 CTGGTATCCACCTGGGATCCAGG - Intergenic
1180456089 22:15513358-15513380 CTGGTGACTCCCTGGGGTCAAGG + Intergenic
1180495591 22:15889478-15889500 CTGGTATCCACCTGGGGTCCAGG - Intergenic
1181009832 22:20033583-20033605 CTTGGGCAGCCCTGGGCTCCAGG + Intronic
1182064018 22:27417688-27417710 CTGGAGGCCCGCTGGGCTCCAGG + Intergenic
1182361612 22:29749705-29749727 CTGGTCTCTCCCTGGACACCTGG - Intronic
1183184992 22:36286613-36286635 CTGGAGTCCTACTGGGCTCCAGG - Intronic
1183441489 22:37825413-37825435 CGGGTCCCTCCCTGGGCTCCGGG - Exonic
1184390881 22:44202403-44202425 CTGGGGTGCCCCTGGGCTGCAGG + Intronic
1184431008 22:44441597-44441619 CTGGCCTGGCCCTGGGCTCGTGG - Intergenic
1184656954 22:45946698-45946720 CTGGCTTTGCCCTGGGCCCCTGG - Intronic
1184927241 22:47651468-47651490 CTGTTCTTGCCCTGGCCTCCTGG - Intergenic
1185080037 22:48704599-48704621 CTGGAGTCGCCCTGGGAAGCCGG + Intronic
950202751 3:11056626-11056648 CTGGCTGCGCCCTGGGCTCTGGG - Intergenic
950871937 3:16237230-16237252 CTGGTATAGCCCTGGCCTCAAGG - Intergenic
952881093 3:37986788-37986810 GTGGTCCCGCCCTGGGCTGCAGG - Intergenic
957066249 3:75524896-75524918 CAGGTGTGCCACTGGGCTCCTGG - Intergenic
958791611 3:98657539-98657561 CTGCTGGCGGCCTGGGCTGCTGG + Intergenic
958953215 3:100438791-100438813 CTGAGCTCACCCTGGGCTCCTGG - Intronic
961052052 3:123755273-123755295 CTGGTGGCTCACTGGGCTCTGGG + Intronic
961374086 3:126450899-126450921 CTGGTGTCGCCCTGGCTTGCTGG - Intronic
963213856 3:142723927-142723949 GTGGGGACGCACTGGGCTCCTGG - Intergenic
966735370 3:183182722-183182744 CAGGTATCCCCCAGGGCTCCTGG + Intronic
966762223 3:183428458-183428480 CGGGTGGCGCCCGGGGCTCTCGG + Intronic
966866764 3:184262474-184262496 CGGGGGGCGCCCTGGGCTGCGGG + Intronic
966904720 3:184513842-184513864 CCGGAGTCCCCCTGGGCTGCTGG + Intronic
966982587 3:185152478-185152500 CTGGGGCCGCCGTGGGCTCCGGG - Intronic
967556257 3:190862739-190862761 CCGGTGACGCCCAGAGCTCCCGG + Intronic
968641547 4:1717450-1717472 CGGGTGTCTGCCTGGGCTCCTGG - Intronic
968814548 4:2815190-2815212 CTGGCCTGGCACTGGGCTCCTGG + Intronic
969715635 4:8866929-8866951 CTGGCCCAGCCCTGGGCTCCAGG + Intronic
972162645 4:36244723-36244745 CCCCTGTCGCTCTGGGCTCCAGG - Intergenic
974678180 4:65123865-65123887 CAGGTGTTGCCCTCAGCTCCTGG + Intergenic
975883644 4:78939528-78939550 CTGGCGGCGGCCCGGGCTCCCGG + Intergenic
979010007 4:115355420-115355442 GGGGAGTTGCCCTGGGCTCCAGG + Intergenic
986251785 5:6066226-6066248 CATGTGTGCCCCTGGGCTCCTGG - Intergenic
989451978 5:41597352-41597374 CTGGTATCCCCCTGGGTTCACGG - Intergenic
991099876 5:62780724-62780746 CTGGTGTCACCCCGGGCTCTGGG - Intergenic
993386504 5:87268393-87268415 CTGGTGGCCCCTGGGGCTCCCGG + Exonic
994211437 5:97091006-97091028 CTGGTTTAGTCCTGGGTTCCAGG + Intronic
997211185 5:132077910-132077932 CTGGTCTCTCCCTGGGCTCAGGG - Intergenic
997302069 5:132813601-132813623 ATGGTGGGGCCCTGGGTTCCTGG - Exonic
997825827 5:137106189-137106211 CTGGTGAGGAACTGGGCTCCTGG - Intronic
1001766062 5:174248096-174248118 ATGCTGCCGCTCTGGGCTCCAGG - Intergenic
1002099562 5:176850679-176850701 CTGCTGTCGCCCTGGGCTGGTGG + Intronic
1005935806 6:30520146-30520168 CTGGGCTAGCCCTGGGCTACTGG + Intergenic
1006257942 6:32845823-32845845 CAGGTGTCTCCCTGGGCTGAGGG - Intronic
1007088735 6:39168747-39168769 CTGTTGGCGCCCAGGGCTCTGGG - Intergenic
1007121845 6:39388750-39388772 CTGGTTTTGGCCTGGGTTCCTGG + Intronic
1007400455 6:41599756-41599778 CTGGCCTTCCCCTGGGCTCCCGG - Exonic
1007765150 6:44155533-44155555 CTTGTGCTGCCCTGGGCACCTGG + Intergenic
1012450582 6:99349586-99349608 CTGCTGCCGCCCAGGGCTCTGGG - Exonic
1013033771 6:106360921-106360943 CCGGGGTCGCCCTGGGCTGGCGG - Intergenic
1013482776 6:110566475-110566497 CAGGGGTCTCCTTGGGCTCCAGG + Intergenic
1015214409 6:130733439-130733461 CTGCTGTGGCCCTGGACTACAGG + Intergenic
1016729849 6:147417548-147417570 CTGGTGCCACCCTGGGATCTGGG + Intergenic
1018050591 6:160005423-160005445 CCGGTGTCGCCCTTGGCCACTGG + Intronic
1018909609 6:168094428-168094450 CTGGTGTCACCATGGACTCTGGG - Intergenic
1019433107 7:1008442-1008464 TTGGGGTAGCCCTGGGCACCTGG + Intronic
1019971244 7:4542707-4542729 CTGGTAGCGCCCTGGCCTTCTGG - Intergenic
1025145140 7:56495424-56495446 CTGGTGTTTCCCTGGGTTCTTGG + Intergenic
1025710220 7:63901219-63901241 CCGGTGGCTCCCTGGGCTGCAGG - Intergenic
1029194703 7:98797192-98797214 TGGGTGTCGCCCTGGGTGCCTGG + Intergenic
1029363642 7:100103723-100103745 CTGGTTTTGCTCTGGGATCCGGG + Intronic
1029697636 7:102224626-102224648 CAGGTGTCCCTCTGTGCTCCAGG - Intronic
1031986145 7:128166074-128166096 CTGGTCTCGCCCTGAGCTGCAGG - Intergenic
1032521761 7:132550837-132550859 CTGGTCTCTCCCTGACCTCCTGG + Intronic
1034139284 7:148801457-148801479 CTGGTGACGACCAGGGATCCTGG - Intergenic
1035034756 7:155887385-155887407 GGGGTGTCGGCCTGGGCCCCTGG + Intergenic
1035132467 7:156668651-156668673 CTGCTGTGGCACTGGACTCCGGG - Intronic
1038546982 8:28433392-28433414 CTGCTGTTCCCCTGGGCTCCGGG + Intronic
1039901836 8:41758247-41758269 CTGGTGTCACTGTGGGCACCAGG - Intronic
1041572333 8:59351690-59351712 CAGGTGTAGCACTGGGTTCCAGG - Intergenic
1042145371 8:65722764-65722786 CTGGTGTGGTGCTAGGCTCCAGG + Intronic
1042705141 8:71658958-71658980 CTGGTGTGCCCCTGGGCCCAGGG - Intergenic
1043954246 8:86342767-86342789 CTGCTGGCGGCCTGGGCTGCCGG + Exonic
1044249024 8:89984637-89984659 CTGCGGTCGGCATGGGCTCCGGG + Exonic
1047492415 8:125385930-125385952 CTGGTGTCGCCATGCTCTCCAGG - Intergenic
1048829878 8:138465640-138465662 CTGTTGTAGGGCTGGGCTCCTGG - Intronic
1048977635 8:139681877-139681899 CTGGTGTCTCCCTGAGCTCCAGG - Intronic
1049214012 8:141399430-141399452 CTGGGGGTGCCCGGGGCTCCCGG + Intronic
1049249309 8:141579696-141579718 CATGTGGGGCCCTGGGCTCCTGG + Intergenic
1049424402 8:142531671-142531693 CTGGTGTTGCTCTGGGCTCTGGG + Intronic
1049569716 8:143363611-143363633 CTGGTTCCTCCCTGAGCTCCTGG + Intergenic
1049684496 8:143933895-143933917 GGGCTGTCCCCCTGGGCTCCTGG - Intronic
1049806860 8:144545019-144545041 CTCGTGTCTGCCAGGGCTCCGGG + Intronic
1053645437 9:40117203-40117225 CTGGTGACCCCCTGGGGTCAAGG + Intergenic
1053645662 9:40118286-40118308 CTGGTATCCACCTGGGGTCCAGG - Intergenic
1053760047 9:41345223-41345245 CTGGTATCCACCTGGGGTCCAGG + Intergenic
1053760277 9:41346324-41346346 CTGGTGACCCCCTGGGGTCAAGG - Intergenic
1054326457 9:63715104-63715126 CTGGTGACCCCCTGGGGTCAAGG + Intergenic
1054326677 9:63716187-63716209 CTGGTATCCACCTGGGGTCCAGG - Intergenic
1054538909 9:66257686-66257708 CTGGTATCCACCTGGGGTCCAGG + Intergenic
1054539136 9:66258769-66258791 CTGGTGACCCCCTGGGGTCAAGG - Intergenic
1055021532 9:71675473-71675495 CTGCTTTCTGCCTGGGCTCCAGG - Intergenic
1057292043 9:93812995-93813017 TGGGTTTCTCCCTGGGCTCCTGG - Intergenic
1057388108 9:94622052-94622074 TTGGTGACACCCTGGGCCCCTGG + Intronic
1057435861 9:95040150-95040172 CTGGTGTGGCTCTGGCCTCAGGG - Intronic
1057743661 9:97734266-97734288 CTGATGTCCTCCTTGGCTCCTGG - Intergenic
1058153321 9:101486109-101486131 CTAGTGTCGCACTGCGCTCGCGG - Intronic
1059331847 9:113540572-113540594 CTGGTGCTGGGCTGGGCTCCAGG + Intronic
1061003490 9:127915740-127915762 CGTGTGTCTCTCTGGGCTCCAGG + Intronic
1061480516 9:130895729-130895751 CTGGTGGATCGCTGGGCTCCGGG + Intergenic
1062049985 9:134442304-134442326 CTGGTGGCCCCCTGGACTCTGGG + Intergenic
1062218388 9:135401423-135401445 CTGCTGCCGCCCTGGGCTGCCGG - Intergenic
1062418620 9:136467211-136467233 CTGGTGTCGTGCTGGTTTCCAGG - Intronic
1202793231 9_KI270719v1_random:100659-100681 CTGGTGACCCCCTGGGGTCAAGG + Intergenic
1185643998 X:1604099-1604121 CAGGTGTTGCTCTGGGCACCTGG + Intergenic
1188492973 X:30755711-30755733 CTGATCTCGCCCTGGGCCTCTGG + Intergenic
1192158161 X:68762044-68762066 CTGTTGGAGCCCTGGGCTCTTGG + Intergenic
1192215006 X:69151945-69151967 CTGGCCTCCCCCTGGACTCCTGG - Intergenic
1195615112 X:106905899-106905921 CTGAAGGCTCCCTGGGCTCCAGG - Intronic
1198957397 X:142147958-142147980 CTGGTTTCAGCCTGGGCTCTTGG + Intergenic
1200138576 X:153886351-153886373 CTGGGGTCCCGCTGAGCTCCCGG - Intronic