ID: 944579689

View in Genome Browser
Species Human (GRCh38)
Location 2:201121174-201121196
Sequence CTGGCAAATAATTATAAAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 223
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 205}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944579687_944579689 -2 Left 944579687 2:201121153-201121175 CCATGGCTGGATTATGTTAATCT 0: 1
1: 0
2: 2
3: 8
4: 194
Right 944579689 2:201121174-201121196 CTGGCAAATAATTATAAAGCTGG 0: 1
1: 0
2: 1
3: 16
4: 205

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944579689 Original CRISPR CTGGCAAATAATTATAAAGC TGG Intronic
900696644 1:4016338-4016360 CTGGCAAACAGTTAAAAAGCTGG + Intergenic
903610011 1:24604276-24604298 TTAACAAATAATTATAAGGCTGG + Intronic
904763680 1:32824396-32824418 CTGGAAAATAATTATAGATTAGG + Intronic
906386502 1:45373568-45373590 TTAACAAATAATTATTAAGCAGG - Intronic
907893440 1:58659176-58659198 GAGGCAAATGATAATAAAGCTGG - Exonic
908777521 1:67655594-67655616 ACAGCAAACAATTATAAAGCTGG + Intergenic
911489768 1:98549445-98549467 GAGGCAAACAATTATATAGCAGG + Intergenic
915725740 1:158016003-158016025 CTGACAAATATTAAGAAAGCAGG + Intronic
916841474 1:168605839-168605861 CAGGCAAAAAATGAGAAAGCTGG - Intergenic
917244001 1:172980782-172980804 CTGGCAAAAAATGAGAAAGCTGG - Intergenic
919963442 1:202495917-202495939 TTGGCAAAGAATTAAAAAACTGG + Intronic
920983390 1:210860177-210860199 CTGTTACATAATTATAAAGGAGG + Intronic
921975312 1:221196447-221196469 CTGGAAAAGAATAATAAAGTAGG - Intergenic
922083595 1:222323774-222323796 ATGGCAAGTAATTTTAAAGCAGG + Intergenic
923449129 1:234099880-234099902 TTAGCAAATACTTCTAAAGCAGG - Intronic
924017451 1:239742963-239742985 CTGACAATAAATTATAAACCTGG - Intronic
924670355 1:246118285-246118307 GTGGGAAATATTTTTAAAGCAGG + Intronic
1065268830 10:24005564-24005586 CAGGAAAATAATTTTAAATCTGG + Intronic
1067537195 10:47121715-47121737 GTGGAAAATAACTATAAAACTGG - Intergenic
1068258587 10:54546324-54546346 AAGTCAAAAAATTATAAAGCAGG + Intronic
1068541992 10:58305110-58305132 TTGGAAAATAATTACAAAGATGG - Intergenic
1068727359 10:60318291-60318313 CTAGGAAATGTTTATAAAGCTGG - Intronic
1069544103 10:69316999-69317021 CTGGATCATAATTATAAACCAGG - Intronic
1069769778 10:70890870-70890892 CTGACAAAAAAATAAAAAGCTGG - Intergenic
1070798218 10:79229586-79229608 CAGGCACATAATTATAATGACGG + Intronic
1072099946 10:92219745-92219767 CTGGCAAATAAGCAGAAAACAGG + Intronic
1074989250 10:118688029-118688051 CTGGAAAATTATTCAAAAGCAGG - Intronic
1075929483 10:126283462-126283484 CTGGCAAAAATTTAAAAAGGCGG + Intronic
1075983141 10:126758604-126758626 CTGTCAAATATAAATAAAGCTGG - Intergenic
1079507398 11:21168934-21168956 CTGACAAATAATTAGGAAGAAGG - Intronic
1079840772 11:25396714-25396736 ATGGCAAATAAATATTCAGCAGG + Intergenic
1080665848 11:34335705-34335727 CAGGCAAAGTTTTATAAAGCAGG + Intronic
1083360185 11:62101533-62101555 CTGGGAAATAAACATACAGCTGG - Intergenic
1085131323 11:74041487-74041509 TTGCCAAATAATTATAATGCAGG - Intronic
1085768449 11:79304461-79304483 CTGATAATTAATGATAAAGCTGG - Intronic
1086224639 11:84493272-84493294 ATGGCAAATTATTTTCAAGCAGG - Intronic
1086651350 11:89294739-89294761 CTGTCAAATAATTAAAAGACTGG + Intronic
1087522281 11:99254857-99254879 CCTGAAAATAATTAAAAAGCAGG + Intronic
1090263979 11:125342650-125342672 TTGACAAATAATAATAAACCTGG + Intronic
1090394616 11:126410586-126410608 CTGGCAAATATTTAAAGGGCAGG - Intronic
1093340866 12:17972469-17972491 CTGGCTCAAAATTATAAATCTGG - Intergenic
1094251479 12:28367148-28367170 TTGACAAATAATTCTAAAACTGG - Intronic
1094329687 12:29277632-29277654 CCGGCAGATAATTTTAAAGCAGG - Intronic
1097580713 12:61453562-61453584 CGGGGAAATAATAATAAAGAAGG + Intergenic
1097675561 12:62598884-62598906 CTGGAACATAATTAAAAACCTGG - Exonic
1097965368 12:65573420-65573442 CTGCCAAATACTTATGAAGAGGG + Intergenic
1103029306 12:117599818-117599840 CTGCCAACTATTTATTAAGCAGG + Intronic
1103599434 12:122044896-122044918 GTGGCAGAGAATTATAAAGTAGG + Intronic
1109982811 13:69932260-69932282 TAGGCAAATTATTATAAAGGGGG + Intronic
1110937976 13:81316999-81317021 CTGGCAGATAATTCTTAACCAGG + Intergenic
1111728684 13:92044851-92044873 CTGGCAAAAAATTAAAACCCTGG + Intronic
1112108159 13:96264804-96264826 CTGGCAAATAATTTTTAAAAAGG - Intronic
1113150332 13:107256379-107256401 CTGGCAAAAAAATATAGATCAGG + Intronic
1115052575 14:29081400-29081422 CTGGCAATTCAATAAAAAGCTGG + Intergenic
1115171493 14:30512842-30512864 CAGGCCAGTAATTATATAGCTGG - Intergenic
1116261648 14:42635924-42635946 CTGGCAAAAACTAATAGAGCAGG + Intergenic
1116490884 14:45501818-45501840 CTAAAAAATAATTATAAATCTGG + Intergenic
1116834828 14:49760152-49760174 ATGACAAAAAATTAAAAAGCTGG - Intergenic
1117942025 14:60978095-60978117 CTGGCATATATTTCTAAAGTGGG - Intronic
1118574466 14:67227713-67227735 CTTGCAAATAATTCAATAGCAGG + Intronic
1118997337 14:70848664-70848686 ATGGCAGATATTTATAAAACCGG + Intergenic
1120195600 14:81479004-81479026 CTGGAAACAAAATATAAAGCTGG + Intronic
1121099701 14:91242163-91242185 CTGGCAAGTAATTACAAGGGAGG + Intronic
1121459504 14:94063739-94063761 CTGGCAAATTTTTTTAAAGATGG - Intronic
1127080050 15:55368809-55368831 TTGTTAAATTATTATAAAGCGGG + Intronic
1128743449 15:70098225-70098247 CTAGCAAATAATTATTTAGCGGG + Intergenic
1130605651 15:85314155-85314177 CTGGCAAAGAATTTTTTAGCTGG + Intergenic
1133550505 16:6849880-6849902 CACACAAATAATTATAAATCAGG - Intronic
1135044250 16:19141769-19141791 CTGGTAGATAATTATAATGAGGG + Intronic
1135250513 16:20897778-20897800 CTGGCAGATAAATTTCAAGCTGG - Intronic
1136392098 16:29971965-29971987 ATGGCAATACATTATAAAGCAGG - Intronic
1136693795 16:32057751-32057773 CTGGCAGAGAATTCTAAACCAGG + Intergenic
1136794284 16:33000986-33001008 CTGGCAGAGAATTCTAAACCAGG + Intergenic
1136875623 16:33853393-33853415 CTGGCAGAGAATTCTAAATCAGG - Intergenic
1138697034 16:58823977-58823999 CTGGCAAAGAAGAACAAAGCTGG - Intergenic
1140629674 16:76836152-76836174 TGGGGAAATAATTATAAGGCAGG + Intergenic
1203096548 16_KI270728v1_random:1262667-1262689 CTGGCAGAGAATTCTAAACCAGG + Intergenic
1144310007 17:14005009-14005031 CTGGCATCTAAATCTAAAGCTGG + Intergenic
1147590143 17:41677569-41677591 CTGGCCAATGGTTATAAATCAGG - Intergenic
1150465752 17:65391324-65391346 CTGGTGAATAATAATTAAGCTGG + Intergenic
1150588039 17:66535980-66536002 CAGGCAAATAATTAATAATCAGG - Intronic
1156260000 18:35437511-35437533 CTGCAAAGCAATTATAAAGCTGG - Intergenic
1157014215 18:43690614-43690636 CTGAAAAACAATTATCAAGCAGG - Intergenic
1162234013 19:9291635-9291657 CAGGCAAATAATTCTTAAACAGG + Intergenic
1163141693 19:15353689-15353711 CTGGGAAATCATTAGAAAGGAGG - Exonic
1166133359 19:40760306-40760328 CTGGCATATAAAAATAAAACTGG - Intronic
1167683833 19:50943152-50943174 CTGGCCAATATTTATGAAGAAGG + Intergenic
1168497510 19:56866039-56866061 CTTCCAAACAATTCTAAAGCAGG + Intergenic
926520371 2:13903820-13903842 CTGGCATATAAGGATATAGCTGG + Intergenic
926901074 2:17753287-17753309 GTGGCGAATAACTGTAAAGCGGG - Intronic
931201780 2:60104641-60104663 CTGGTAAATAATTATCAAATTGG + Intergenic
937463312 2:122108293-122108315 CAGGCAACAGATTATAAAGCAGG - Intergenic
938246064 2:129779004-129779026 CAGGCATATAATTAGCAAGCGGG + Intergenic
939298157 2:140297009-140297031 CAGGAAAATAGTCATAAAGCAGG + Intronic
941778146 2:169415029-169415051 AGGGTAAATAATAATAAAGCTGG - Intergenic
942781143 2:179645373-179645395 CTGTCAAATAACTATCAATCTGG + Intronic
944579689 2:201121174-201121196 CTGGCAAATAATTATAAAGCTGG + Intronic
945423858 2:209674354-209674376 CTGGCAAATAATTATATAACAGG - Intronic
946905503 2:224412331-224412353 CTGGGATATAAATATAAAGTGGG - Intergenic
947411775 2:229848868-229848890 CTGGCAAATAAATATCAGGGTGG + Intronic
947645288 2:231734531-231734553 CTGGTAATTAATTATAAAACAGG + Intronic
948936842 2:241171068-241171090 CTGGCAAAAAATTAGGGAGCAGG + Intronic
1171253180 20:23666006-23666028 CTGAGAAATATTTATACAGCAGG + Intergenic
1171259668 20:23721333-23721355 CTGAGAAATATTTATACAGCAGG + Intergenic
1173595350 20:44255599-44255621 CCAGCAAATAAGTGTAAAGCTGG + Intronic
1174846108 20:53944713-53944735 CTGGCAAATAACAGTAAAGATGG - Exonic
1175298469 20:57926025-57926047 TAGGCAAATAATTCTTAAGCAGG - Intergenic
1175613642 20:60373655-60373677 CTGGCACATAGTTATAAAGTGGG + Intergenic
1176920723 21:14684401-14684423 CTGGTAAGTAATTACAGAGCTGG - Intergenic
951407289 3:22316372-22316394 CAGGCAATTAATAATAAAGTAGG + Intronic
952200597 3:31123184-31123206 CTGGAGAACAATTATAAACCTGG + Intergenic
952309627 3:32176553-32176575 CTGGGAAATACTTTTAAAGGAGG + Intergenic
952364102 3:32659767-32659789 CTGGCAAAGTATTATAAAGTAGG - Intergenic
952437986 3:33291786-33291808 ATGGAAAATAAATATAAAGATGG + Intronic
958079841 3:88732822-88732844 CTAGCATATAATAATCAAGCAGG + Intergenic
960475114 3:118114758-118114780 ATGTCAAATAATTAAAAAACAGG - Intergenic
961369590 3:126421406-126421428 TTGGCAAATATTTCTTAAGCAGG - Intronic
961611114 3:128140422-128140444 CTTGCCAATAATTAGAAAGGTGG - Intronic
963698871 3:148598961-148598983 TAGGAAAAAAATTATAAAGCAGG + Intergenic
965668715 3:171123769-171123791 CTGGCAAATCATTGGAAAGGAGG - Intronic
965763088 3:172101593-172101615 CTGTAAAATAAGTATAAAGCAGG - Intronic
965789661 3:172373823-172373845 ATGGGAAATAATTATAGAACTGG + Intronic
966449479 3:180041571-180041593 TTGGGGAATAATTAAAAAGCAGG - Intergenic
966485515 3:180465038-180465060 CTGGCTAAAAATAATTAAGCTGG - Intergenic
966515068 3:180810614-180810636 CTAGCAAATACTGATAAAACTGG - Intronic
967199693 3:187061427-187061449 CTGAAAAATAAGAATAAAGCTGG + Intronic
967519400 3:190411438-190411460 CTGACAAGTAATTAGAAAACTGG - Exonic
967763071 3:193246896-193246918 CTTCCAAAAAATTATAAAACAGG - Intronic
969183503 4:5459293-5459315 CTGGCACATACTTAGAAAGGTGG - Intronic
970503919 4:16707574-16707596 CTGGCAAATAAAAATGAAGCCGG - Intronic
971454035 4:26827182-26827204 GTGGCAAATGCTTATAAAGATGG + Intergenic
972144444 4:36004253-36004275 CTGGTAAATAAATAAAAAGAAGG + Intronic
972170999 4:36345127-36345149 CTGTTAACTAATTTTAAAGCAGG - Intronic
972674435 4:41245870-41245892 CCCGAAAATAATTATAAAACTGG + Intergenic
974710711 4:65590534-65590556 CATGCCAATTATTATAAAGCAGG - Intronic
975940272 4:79635585-79635607 CTTGAATATAATTATTAAGCAGG - Intergenic
977800807 4:101228757-101228779 CTGGCAATTAATTAAGAAGAGGG - Intronic
979756551 4:124347549-124347571 TTGGCAACTACTTACAAAGCTGG + Intergenic
980720141 4:136684949-136684971 CTGAAAAATAAATATACAGCAGG - Intergenic
982171939 4:152670659-152670681 CTGGAATAAAATTATAAAACTGG + Intronic
983887089 4:172992265-172992287 TTGGAAAATATTTCTAAAGCAGG + Intronic
984079036 4:175219804-175219826 CTTGCATATAATTTTAAATCGGG + Intergenic
984210522 4:176841548-176841570 TTGGCAAATTATTATACACCAGG + Intergenic
987603714 5:20106101-20106123 CTGGCAGAAGATCATAAAGCAGG + Intronic
989024164 5:37046692-37046714 CTGGAAAAACATTATAAAACAGG - Intronic
989093068 5:37754819-37754841 CTGGCAAATAATTAAATGGGTGG - Intergenic
992480556 5:77147397-77147419 CTGGCAAGGAAATTTAAAGCAGG + Intergenic
992626816 5:78643700-78643722 CTGGCATGTAAATTTAAAGCAGG - Intronic
995171933 5:109124535-109124557 ATGACAAACAATTATAAAGCTGG - Intronic
996702673 5:126465803-126465825 CTGGCATATGTTTAGAAAGCTGG + Intronic
997820095 5:137057479-137057501 GTGGCAATTACATATAAAGCAGG - Intronic
998243722 5:140475846-140475868 CAGTAAAAAAATTATAAAGCTGG + Intronic
999036151 5:148352574-148352596 CTTGCAAATAATTAAAATGAAGG - Intergenic
999426667 5:151493447-151493469 CTGGCTAAAAATTTTAAATCAGG + Intergenic
999503347 5:152169081-152169103 GTGGCAAATAATCATGAAGGTGG + Intergenic
1001033444 5:168279621-168279643 CTGGTAAATAATGATAAAAAAGG - Intergenic
1001046076 5:168372787-168372809 CAGGCAAATGATTATAATACAGG - Intronic
1002085963 5:176775754-176775776 CTGACACATTATTATAAAACAGG - Intergenic
1002126024 5:177044771-177044793 CTGACTAATAATTATAACTCAGG + Intronic
1003416064 6:5909389-5909411 CTGTCAAGTAATATTAAAGCAGG - Intergenic
1004146892 6:13076328-13076350 CTGGGAAATAATTATCAATTGGG - Intronic
1004445920 6:15698326-15698348 CTGCCTAATAATTATAGAGATGG - Intergenic
1005713653 6:28526189-28526211 CTGGCAAAGAAGAAGAAAGCAGG - Intronic
1006756887 6:36423803-36423825 CTGCCAAACAATTAGAAACCAGG - Intronic
1007121961 6:39389727-39389749 CTAGAAAATAATTACAAATCTGG + Intronic
1007768449 6:44175477-44175499 CTCAAAAATAATAATAAAGCCGG + Intronic
1008295291 6:49768417-49768439 CTGTCAAATAATCTCAAAGCAGG - Intergenic
1008599728 6:53080030-53080052 CTGGCACATATTTATAAAACTGG - Intronic
1009612118 6:65959171-65959193 CTGGGAATAAATTATAAAGAAGG - Intergenic
1010311750 6:74394523-74394545 GTGGCAAATCAAAATAAAGCTGG - Intergenic
1010385647 6:75276635-75276657 CTGGTAAATAAGAGTAAAGCAGG - Intronic
1010493189 6:76499264-76499286 CTGGAAGATAATTAGAAGGCTGG - Intergenic
1011182810 6:84640388-84640410 CTAACAAATAATCATAAATCAGG + Intergenic
1012356034 6:98315730-98315752 CTGGCAAATCATTATAGTACTGG - Intergenic
1012362147 6:98395441-98395463 TTGGCATATAATTATGAAACTGG - Intergenic
1014463311 6:121725338-121725360 CAGGCAAGCAATTATAAAGATGG - Intergenic
1015072549 6:129113137-129113159 TTGGAAAACAATTATAAAACAGG - Intronic
1015886888 6:137926705-137926727 CTGGCAAATGATTAATAAGTTGG + Intergenic
1020464849 7:8465742-8465764 CTAGGGAATAATTAGAAAGCAGG - Intronic
1021821548 7:24503136-24503158 TTGGTTAATAATTATAAAACAGG - Intergenic
1024160860 7:46674082-46674104 TTGTCAGATAATTAAAAAGCTGG + Intronic
1026534518 7:71228945-71228967 CTGGCCAATACTTATATTGCAGG + Intronic
1027334197 7:77131051-77131073 CTGGCCAATTTTTATAAAGACGG + Intronic
1027890826 7:83971871-83971893 CTGGGAAGTAATTATTAACCAGG + Intronic
1028890176 7:95978494-95978516 CTGGCAAATAAATGAAGAGCGGG + Intronic
1028894384 7:96024213-96024235 GTGGAAAATAATTATAAAGTTGG - Intronic
1030272287 7:107683491-107683513 CTGGAAAAAAATTACAATGCTGG + Exonic
1030454045 7:109749996-109750018 CTGGGAAATAATTAGAACTCTGG - Intergenic
1033407673 7:141086195-141086217 CTGGCTAATTTTTATACAGCAGG + Intronic
1034933030 7:155178669-155178691 CAGGCAAATATTTCTTAAGCAGG + Intergenic
1037222147 8:16536774-16536796 CTAGCAAACAATTCTAATGCCGG + Intronic
1038966242 8:32575648-32575670 CTAGAAAATAAGTATAAAGTAGG + Intronic
1040765466 8:50904562-50904584 GTGGAAAATAAATATAAAGATGG + Intergenic
1041271432 8:56113154-56113176 CTGGCAAATGACTACCAAGCAGG - Exonic
1043762846 8:84090837-84090859 CTGCCATATAATTATAAGTCAGG + Intergenic
1044436320 8:92167991-92168013 CATGGAAATAATTATAATGCTGG + Intergenic
1044469039 8:92543736-92543758 ATGGCAAAAACTTATAAATCTGG - Intergenic
1044481926 8:92700588-92700610 CTGGCACAGAATTGTAAAGAAGG + Intergenic
1045964457 8:108008291-108008313 CTGGTTAATGATTATCAAGCAGG - Intronic
1046317260 8:112520846-112520868 CTCTCAAAAAATTATAAAGAAGG - Intronic
1046329881 8:112700549-112700571 CTGGCCAATAATAAAAAAGAGGG - Intronic
1046462048 8:114552157-114552179 TTGGGAAACAATTACAAAGCTGG - Intergenic
1046699803 8:117387511-117387533 CTTGCCCATAATTATAAAGCTGG - Intergenic
1047108268 8:121759279-121759301 ATGTCAAATAAGAATAAAGCAGG + Intergenic
1048660464 8:136594536-136594558 ATGTCAAATAATAATAAAGTAGG + Intergenic
1050084083 9:1946188-1946210 CTGGCGAACAATAATAAAGATGG - Intergenic
1050963165 9:11764163-11764185 CTGACAAATAATTAATAACCAGG + Intergenic
1051200589 9:14617469-14617491 CTGGGAAATAATTAAACAGAAGG - Exonic
1051568436 9:18527167-18527189 ATGGCAAAGAATTTTAAAGCAGG - Intronic
1051678161 9:19579622-19579644 CTGTAAGATAATAATAAAGCAGG + Intronic
1051812430 9:21065365-21065387 CAGGCACATCATTAGAAAGCTGG + Intergenic
1053407741 9:37892160-37892182 CAGGCAAATAATTAGACAACAGG + Intronic
1057368464 9:94447068-94447090 CTGGCATATAATTAGTAAACAGG + Intronic
1058542687 9:106028429-106028451 CTGGCACATAATAATAATTCAGG - Intergenic
1059219461 9:112599873-112599895 CTGGCATATAATAAAAAAGTGGG + Intronic
1186707075 X:12152734-12152756 CTAGCAAATTAAGATAAAGCTGG + Intronic
1189781314 X:44516923-44516945 CTGTCAAATAATACTAGAGCTGG - Intergenic
1194820603 X:98502088-98502110 CAGGCTAAAAATTAAAAAGCAGG - Intergenic
1196041722 X:111211826-111211848 GTGACAAAAAATTTTAAAGCAGG + Intronic
1198243222 X:134804937-134804959 ATGGCACATAATTAGATAGCAGG - Intronic
1199253699 X:145694342-145694364 GAGGGAAATAATTTTAAAGCTGG + Intergenic
1202299085 Y:23391794-23391816 TTGGCAAAGAATTAAAAAACTGG + Intergenic
1202571724 Y:26278804-26278826 TTGGCAAAGAATTAAAAAACTGG - Intergenic