ID: 944580070

View in Genome Browser
Species Human (GRCh38)
Location 2:201124704-201124726
Sequence AGGGGGAACAGAATGGCTAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 357
Summary {0: 1, 1: 1, 2: 12, 3: 41, 4: 302}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944580070 Original CRISPR AGGGGGAACAGAATGGCTAG GGG Intronic
902122230 1:14176179-14176201 AAGGGGAAGAGAAAGGGTAGGGG - Intergenic
902783030 1:18716741-18716763 AGGGGGAAGAGAATGGGTAGAGG - Intronic
902905984 1:19557798-19557820 AAGGGGAACAGAAGGGGAAGGGG - Intergenic
903313983 1:22486316-22486338 AGATGGTACAGGATGGCTAGAGG + Intronic
903345810 1:22683634-22683656 AGGGAGAACAGCATGGCAGGGGG - Intergenic
904441222 1:30533254-30533276 AGGGGGAACAGATTGGCTCATGG - Intergenic
904922530 1:34020222-34020244 AAGGGGAACAGAATGTATGGAGG + Intronic
904927866 1:34062633-34062655 AGGGAGGACAGGATGGCCAGGGG + Intronic
904978934 1:34480147-34480169 AGGGGGAACAAAAGGACAAGGGG + Intergenic
905035136 1:34913140-34913162 AGGGGGAACAGAAAGGAAGGAGG + Intronic
905346330 1:37313467-37313489 AGATGGAACAGACAGGCTAGTGG - Intergenic
905507305 1:38490130-38490152 AGGGAGATCAGAGTGACTAGAGG + Intergenic
905674562 1:39816566-39816588 TGGGGGCACAGGATGGCTGGAGG + Intergenic
907259049 1:53202854-53202876 AGTGGGAACAGCATGGATAAAGG - Intronic
907336985 1:53706253-53706275 AGGGGAATCAGAATGGCATGGGG - Intronic
908047517 1:60186253-60186275 TGGTGGAACAGGATAGCTAGAGG - Intergenic
908945293 1:69488203-69488225 AGGTAGGACAGGATGGCTAGAGG - Intergenic
909286835 1:73830252-73830274 AGATGGAACTGAATGACTAGAGG + Intergenic
909590550 1:77343846-77343868 AAAGGGCACAGAATTGCTAGTGG - Intronic
909597652 1:77423951-77423973 GGGTGGGACAGGATGGCTAGAGG - Intronic
911038827 1:93576330-93576352 AGGGGGAAAAGAAAGACTGGTGG + Intronic
911203064 1:95066082-95066104 AGGGGGAGCAGCATGACCAGAGG - Intronic
911868453 1:103059255-103059277 AGGTGGAACAGGATGGCTGAAGG - Intronic
913136594 1:115896450-115896472 CGGGGGAAAAGAATAGCTACGGG - Intergenic
913509389 1:119548224-119548246 AGGGGGCACAGCATGGGCAGTGG + Intergenic
914203555 1:145506852-145506874 AGGTGAGACAGGATGGCTAGAGG + Intergenic
914482677 1:148080006-148080028 AGGTGAGACAGGATGGCTAGAGG + Intergenic
915117161 1:153608310-153608332 AAGGGGAACAGAGTGGGTGGGGG + Intronic
915366404 1:155319326-155319348 AGGTGGATCAGAATGACTTGGGG + Intronic
915705076 1:157836076-157836098 AGGTGGAACAGAAAGGCCAGTGG - Exonic
916181628 1:162088953-162088975 AGGGGAAGGAGAATGGCGAGAGG - Intronic
917277982 1:173351222-173351244 AGAGGGAACAGAATGGGTGAAGG - Intergenic
918109597 1:181443775-181443797 AGGGGGAAGAGAATGGATCCTGG - Intronic
918148320 1:181777268-181777290 AGGGGGACCAGAATGGATAGAGG - Intronic
919739949 1:200975355-200975377 AGGGAGAACAGGAGGGCTTGGGG + Intronic
919882871 1:201912365-201912387 AGGGGGAGGAGAAGGGCTTGGGG - Intronic
921428464 1:215033644-215033666 AGATGGGACAGGATGGCTAGAGG + Intronic
921533429 1:216313428-216313450 AGGTGCAACAGAATGGCTAGAGG + Intronic
922181703 1:223241054-223241076 AGGTGGTACAGGATGGCTAGAGG + Intronic
922453081 1:225752276-225752298 AGGGGGAAGAAAATGGGGAGGGG - Intergenic
922956383 1:229604734-229604756 AGGGAATACAGAATGGGTAGTGG + Intronic
1063164752 10:3451155-3451177 TGGGGCCACATAATGGCTAGTGG - Intergenic
1063853628 10:10222038-10222060 AGGTGGAAGAGAATGGCTAGAGG - Intergenic
1064432726 10:15285181-15285203 AGGGGGAACAGCATGTGTGGAGG + Intronic
1064682458 10:17824829-17824851 TGGGGAAACAGAAAGGGTAGGGG - Intronic
1064796075 10:19012634-19012656 TGGTGGAACAGGATGGCTACAGG + Intergenic
1065453760 10:25884704-25884726 AGGGAATACAGAATGGGTAGTGG + Intergenic
1066051202 10:31637459-31637481 AGGGAAAACAGAATGGGTAGTGG - Intergenic
1067683374 10:48453796-48453818 CGGGGGGACAGGATGGCAAGAGG + Intronic
1069647191 10:70009289-70009311 AGGTGGGACAGGATGGCTACAGG - Intergenic
1069966235 10:72119498-72119520 AGGTGGAACAGGATGGTTAGAGG - Intronic
1070865164 10:79704189-79704211 AGGTGGAACAAGATGGCTGGGGG + Intronic
1070878955 10:79842320-79842342 AGGTGGAACAAGATGGCTGGGGG + Intronic
1071820901 10:89279696-89279718 AGGGGTAACAGAATTGACAGTGG + Intronic
1072030937 10:91521853-91521875 AAGGGGAACAGGATGGGGAGGGG - Intergenic
1072681500 10:97510636-97510658 AGGGGGAACTGTAAGGCTGGGGG - Intronic
1072877660 10:99190665-99190687 AGGGCGAACACAATTGCTGGAGG - Intronic
1073508470 10:104024463-104024485 ACTGGGAACAAAGTGGCTAGTGG - Intronic
1073782644 10:106856434-106856456 AGGTGGAACATAATAGCTAGAGG + Intronic
1074831241 10:117250907-117250929 AGTGGGCACAGTATGGCTGGTGG + Intronic
1075232358 10:120691266-120691288 AGCAGGAACACAATGGCCAGTGG + Intergenic
1075768272 10:124912215-124912237 AGGAGGAAGGGAATGGCTGGTGG - Intergenic
1076087199 10:127644130-127644152 GGGAGGAACAGAAGGGCAAGAGG - Intergenic
1078094288 11:8287088-8287110 AGTGGGAACAGAAAGCCTGGTGG - Intergenic
1078500692 11:11872121-11872143 GGGGGCAGCAGAAAGGCTAGGGG + Intronic
1081555791 11:44159832-44159854 AGGTGGGACAGGATGGCTACAGG + Intronic
1084282789 11:68109531-68109553 AGGTGGGACAGAATGGCCAGAGG - Intronic
1084292024 11:68178610-68178632 AGGGGGAAGAAAATGGTTAAGGG + Intronic
1086170096 11:83826276-83826298 AGGAGGTACAGCCTGGCTAGTGG + Intronic
1086199171 11:84179796-84179818 AGGTGAGACAGGATGGCTAGAGG - Intronic
1087247500 11:95856220-95856242 AGGGGAACTGGAATGGCTAGGGG + Intronic
1088750268 11:112836963-112836985 TGTGGGAAGAGAATGGCTGGAGG + Intergenic
1091252777 11:134157680-134157702 AAGAGGAACAGAATAGCTGGAGG + Intronic
1091806224 12:3358118-3358140 AGGGGGAACCGAAAGGCTTCAGG - Intergenic
1091962238 12:4705800-4705822 AGGTGGGACAGGATGACTAGAGG - Intronic
1092465526 12:8728479-8728501 AGGTGGAACATAATGTCCAGAGG + Intronic
1092806291 12:12226079-12226101 AGGTGGGACAGAATGGTTAGAGG - Intronic
1095258840 12:40074913-40074935 AGTTGGAACAGAATGGCTAGAGG + Intronic
1095704067 12:45219035-45219057 AAAGGCAGCAGAATGGCTAGAGG - Intronic
1096677986 12:53235913-53235935 AGGGGGAGCAGACTGGCTGAGGG - Intergenic
1097271704 12:57779236-57779258 AGGGGGATAAGAATTGCTTGAGG - Intronic
1097988696 12:65811399-65811421 AGGTGGAGCAGGATGGCTATAGG - Intergenic
1098029350 12:66238164-66238186 GAGGGGAACAGAATGGGGAGAGG + Intronic
1098430130 12:70410004-70410026 ATGGGAAACAGAATGACTCGAGG - Intronic
1099994939 12:89768443-89768465 AGGGAATACAGAATGGGTAGTGG - Intergenic
1101426709 12:104594217-104594239 TGTGGGGACAGAATGGCCAGAGG - Intronic
1102268082 12:111506197-111506219 AGGGGAAAGAGAAGGGCTGGAGG + Intronic
1102573861 12:113843859-113843881 AGGGAGGACAGCATGGCTGGAGG - Intronic
1102785563 12:115601474-115601496 GGCGGGCACAGAATGGATAGAGG - Intergenic
1103137367 12:118519199-118519221 AGGGGGAACAGTATGGGTAAAGG - Intergenic
1103260427 12:119583681-119583703 AGGAGGAATAGAATGACCAGAGG - Intergenic
1103558840 12:121781605-121781627 AGGGGGATCACACTGGCTATCGG - Exonic
1104009248 12:124917497-124917519 AGGGGGAACTGAATCCTTAGGGG - Intergenic
1104600079 12:130147261-130147283 AGGGAGCACTGAGTGGCTAGTGG - Intergenic
1105602981 13:21903387-21903409 AGGGGGAACAGTATGTGCAGAGG - Intergenic
1105806638 13:23955315-23955337 GGGGGGAAGAGGATGGCAAGTGG + Intergenic
1105930282 13:25046240-25046262 ATGGGGAAAAAAATGGCAAGGGG - Intergenic
1106085706 13:26539968-26539990 AGGCGGAACAGAGTGTCTGGGGG + Intergenic
1106681043 13:32007938-32007960 AGGAGGAAGAGTATGGCTATTGG + Intergenic
1108569312 13:51733592-51733614 ACTGGGAACAGAATGGATGGAGG + Intronic
1110629911 13:77697197-77697219 AGGGGGAACAGAAAGGCTTTGGG - Intergenic
1112351034 13:98633455-98633477 AGGGGTAACAGAATAGATATTGG - Intergenic
1113135909 13:107089528-107089550 CAGGGGAAAGGAATGGCTAGAGG + Intergenic
1113377388 13:109777903-109777925 AGGGGGAAAACAATGGCTCTTGG + Intronic
1115065410 14:29254148-29254170 AGGTGGAAGAGAATGGCTAGAGG + Intergenic
1115288219 14:31741372-31741394 AGGTGGGACAGAATGACTAGAGG + Intronic
1116523408 14:45876147-45876169 AGGGGGAAAAGAACAGGTAGGGG - Intergenic
1116835173 14:49763316-49763338 AGGTGGAACAGAATGGCTAGAGG + Intergenic
1116919309 14:50556011-50556033 AGGGGGAAGAGAATAGTTTGTGG + Intronic
1117260028 14:54022758-54022780 AGGTGGGACAGGATGGCTAAAGG + Intergenic
1117608054 14:57452187-57452209 AGGTGGGACAGGATGGCTATAGG + Intergenic
1119184722 14:72631960-72631982 AAGGGGAACAGCATGGGTGGAGG + Intronic
1119236333 14:73022810-73022832 TGGGAGTACAGAATGACTAGGGG - Intronic
1121155792 14:91682729-91682751 TGGGGGAAAAAGATGGCTAGTGG - Intronic
1122806222 14:104260071-104260093 AGGTGGGACAGGATGGCTGGAGG - Intergenic
1124168126 15:27347486-27347508 AAGTGGAACAGGAGGGCTAGAGG + Intronic
1124402994 15:29366575-29366597 TGTGGGAAGAGAATGGCTACAGG - Intronic
1124589638 15:31041534-31041556 AGGTGGGACAGGATGGCTAGAGG - Intronic
1125029525 15:35062223-35062245 TGGGGGAGGAGAAAGGCTAGAGG + Intergenic
1125191217 15:36996389-36996411 AGGAGGAACAGTTTGACTAGTGG - Intronic
1125527351 15:40385422-40385444 AGGGTAAACAAAAGGGCTAGTGG + Intronic
1125587640 15:40832318-40832340 AGAGGGCACAGAAGGGCTGGTGG + Intergenic
1128590690 15:68894251-68894273 AGGTGAAATAGGATGGCTAGAGG + Intronic
1128777083 15:70328850-70328872 AGGGGGAAAAGAGTGCCCAGGGG + Intergenic
1130200937 15:81826277-81826299 AGGGAGAACAGAATGAGGAGAGG + Intergenic
1132022752 15:98377203-98377225 AGGTGGGACAGGATGGGTAGAGG - Intergenic
1132484885 16:185659-185681 ACGGGGGACAGGATGGCCAGGGG + Intergenic
1133548129 16:6827835-6827857 AGGGGGAACAGAAGGACCTGAGG - Intronic
1135838919 16:25855897-25855919 AGGTGGGACAGAAAGGATAGAGG + Intronic
1135875993 16:26200492-26200514 ATGGTGAGCAGAATGGCAAGAGG - Intergenic
1136134669 16:28248202-28248224 TGGGGGAACAGAAGAGCAAGTGG - Intergenic
1140410474 16:74737908-74737930 AGTGGGAACAGAGAGGCTGGGGG - Intronic
1144200490 17:12937145-12937167 AGGTGGGACAGAATTGCTAGAGG + Intronic
1144781769 17:17811876-17811898 AGGGGGAACAGGTAGGCTGGAGG + Intronic
1146302255 17:31698513-31698535 AGGTGGAAAAGGGTGGCTAGAGG - Intergenic
1146620735 17:34395167-34395189 AGGGTGAGGAGAATGGCAAGGGG + Intergenic
1146651554 17:34609971-34609993 GGAGGGAACAGAGTGGCAAGTGG - Intronic
1147371581 17:39996478-39996500 AGGGGGCCCAGAATGGGGAGGGG + Intronic
1150178381 17:63087466-63087488 AGGTGGAACAGGATGGCTAGAGG + Intronic
1150264941 17:63826331-63826353 AGGGGGAAAAGGATGGCTCTAGG - Intronic
1151637974 17:75365806-75365828 AAGATGAACAGAATGGCTAGAGG + Intronic
1152095423 17:78269251-78269273 TGTGGGAACAGGTTGGCTAGTGG - Intergenic
1153212021 18:2777451-2777473 AGTGGTCACAGAATGACTAGGGG - Intronic
1156020485 18:32594488-32594510 AGGGGGAAGAGACTGGTTGGAGG + Intergenic
1157213548 18:45763712-45763734 AGGGGCAGAGGAATGGCTAGAGG - Intergenic
1157293799 18:46427579-46427601 ACGGGAAAGAGAATGGCAAGTGG - Intronic
1160218940 18:76958467-76958489 CGGGGGAACAGACTGTCCAGTGG - Intronic
1160394464 18:78561736-78561758 AGGGGGAGCTGCATGGCCAGGGG - Intergenic
1160394470 18:78561754-78561776 AGGGGGAGCTGCATGGCCAGGGG - Intergenic
1160872112 19:1282323-1282345 AGGGGGAAGAGAGTGGGAAGGGG + Intergenic
1161857790 19:6775640-6775662 AAGGGCAACAAAATGGGTAGGGG - Intronic
1161927662 19:7313117-7313139 AGGAGAGACAGAATGGCTGGTGG - Intergenic
1162431419 19:10631177-10631199 AGGGGGAAAAGGATGGGAAGCGG - Intronic
1163462280 19:17446244-17446266 AGGGGAAAGAGAATGGATGGTGG - Intronic
1164594296 19:29523799-29523821 AAGGAGAACAGTGTGGCTAGGGG + Intergenic
1166258733 19:41623631-41623653 AGGTGGGACATGATGGCTAGAGG + Intronic
1166381605 19:42357883-42357905 AGGGCGTCCAGAATGTCTAGGGG - Intronic
1166504822 19:43364601-43364623 AAGGGGCACAGGATGGCTGGAGG + Intergenic
1166505718 19:43370313-43370335 AAGGGGCACAGGATGGCTGGAGG - Intergenic
1166557023 19:43707038-43707060 AGGGGAAAAAGGATGTCTAGGGG - Intergenic
1167788124 19:51652460-51652482 AAGTGGAACACAGTGGCTAGGGG - Intergenic
1168377744 19:55894596-55894618 AGGGTGACCAGAATAGCAAGGGG - Intronic
927082760 2:19646936-19646958 AGAGGGAACAGCTTGGCTTGGGG + Intergenic
930163844 2:48184273-48184295 AGGGGCTACAGAAAGGATAGAGG - Intergenic
930877119 2:56231829-56231851 AGGGGGAACTGAAGAGCTACTGG - Intronic
931916590 2:66963146-66963168 AGGGCTGACAGAATGGCTGGGGG - Intergenic
932274418 2:70441395-70441417 CTGGGGTACAGAATGGCCAGGGG + Intergenic
935433061 2:102998970-102998992 AGGTGGGACAGGATGGCTAGTGG + Intergenic
937137819 2:119570239-119570261 AGGTGAGACAGAATGGCTAGTGG + Intronic
937295028 2:120804878-120804900 AGTGGGAAGAGCATGGCTTGGGG + Intronic
938212236 2:129478349-129478371 AGGGGGACCAGACTGGATAAAGG - Intergenic
938637871 2:133249040-133249062 TGGGGGAAGGGAATGGCTAAAGG - Intronic
938995500 2:136673671-136673693 AGGGGAAACAGAAAGGGTAGAGG - Intergenic
939989466 2:148863891-148863913 AGAGGGAACAGAGTGGCGAATGG - Intergenic
941218442 2:162743200-162743222 AAGTGGAACTGAATGGCCAGAGG + Intronic
941258443 2:163264545-163264567 AGGAGGAAAAGAAAGCCTAGTGG - Intergenic
941387056 2:164866539-164866561 AGGGAATACAGAATGGGTAGTGG + Intergenic
944580070 2:201124704-201124726 AGGGGGAACAGAATGGCTAGGGG + Intronic
945205064 2:207322922-207322944 AGGGGAAAAAGACTGGCTTGGGG + Intergenic
945309471 2:208294651-208294673 AGGTGAGACAGAATGGCTGGAGG + Intronic
945465328 2:210162916-210162938 AGGTAGGATAGAATGGCTAGAGG - Intronic
946074791 2:217064856-217064878 AGAGGGAACAGAGTGGGTGGGGG - Intergenic
947905298 2:233757059-233757081 AAGGGATCCAGAATGGCTAGAGG + Intronic
1168811080 20:705050-705072 GGGGGGGGCACAATGGCTAGAGG - Intergenic
1169229064 20:3874930-3874952 AGGGTGAGCCCAATGGCTAGAGG + Exonic
1169529152 20:6465522-6465544 AGAGGGAACAGCAAGTCTAGAGG - Intergenic
1169919966 20:10724757-10724779 AGGGGAATCAGAATTGCTAAAGG + Intergenic
1170022877 20:11855065-11855087 AGCTGGGACAGGATGGCTAGAGG - Intergenic
1170643059 20:18172977-18172999 AGCTGGGACAGGATGGCTAGAGG + Intronic
1170853603 20:20026960-20026982 AAGGGGAAGAAAATGGTTAGGGG - Intronic
1170954074 20:20962430-20962452 AGGGGGATCAGAGTGGCTTGGGG + Intergenic
1172083868 20:32363169-32363191 AGGGGAAACAGAATCTCTAAAGG - Intronic
1172232753 20:33348135-33348157 TGCCGGACCAGAATGGCTAGGGG - Intergenic
1172783290 20:37450068-37450090 AGGGGGAACAGATGGGCTGTGGG - Intergenic
1173368941 20:42417340-42417362 TGGGGGAAGAGAATGGCAGGAGG - Intronic
1178135239 21:29619476-29619498 AGGGGGAAAAGAGTGGGAAGGGG + Intronic
1178634653 21:34291476-34291498 AGGGAAAACAGAATGGGTAATGG + Intergenic
1178902422 21:36607886-36607908 AGAGGGAAATGAAGGGCTAGAGG + Intergenic
1180830667 22:18904436-18904458 AGGGGGCACGGAAGGGCTTGGGG - Intergenic
1181069014 22:20320860-20320882 AGGGGGCACGGAAGGGCTTGGGG + Intergenic
1181868885 22:25882103-25882125 AGGGGAAACAACAAGGCTAGTGG - Intronic
1182056906 22:27365614-27365636 AGGTGGGACAGAATTCCTAGAGG + Intergenic
1182087409 22:27570809-27570831 AGGAGGAACAGCATGTGTAGCGG - Intergenic
1182135850 22:27902239-27902261 AGAGGGAACAGCATGACTACAGG + Intronic
1182733336 22:32512860-32512882 TGGTGGAACAGAATGGGTACAGG + Exonic
1182759773 22:32712989-32713011 ATGGGGAAGAGAATGGGGAGAGG - Intronic
1183832642 22:40426601-40426623 AGAGGGAACAGCATGGGCAGTGG - Intronic
1185001966 22:48251727-48251749 AGGGAGAACAGAGTAGGTAGGGG - Intergenic
1185351863 22:50343651-50343673 AGGGGGAACTGACTGACTGGGGG - Intronic
1185352642 22:50346126-50346148 AGGGGGAACTGACTGACTTGGGG - Intronic
1203280757 22_KI270734v1_random:129707-129729 AGGGGGCACGGAAGGGCTTGGGG - Intergenic
949453034 3:4208235-4208257 AGGTGGGACAGGATGGCTAGAGG - Intronic
949914707 3:8950453-8950475 AGATGGGACAGGATGGCTAGAGG - Intronic
949935305 3:9111405-9111427 AGAGGGAACAGAATGGGCAAAGG + Intronic
949984031 3:9525015-9525037 AGGTGGGACAGCATGGCTAGAGG + Intronic
952304880 3:32136852-32136874 AGGGGGAAGAGAAAGTGTAGAGG + Intronic
952983183 3:38755060-38755082 GGGGGGAAAAGAATTGCTACAGG + Intronic
953019750 3:39106040-39106062 AGGGGATACAGAATGGTGAGTGG - Intronic
954841993 3:53519796-53519818 AGGGGGAATAGAATGGAAAATGG - Intronic
954927468 3:54248853-54248875 AGGGAATACAGAATGGGTAGTGG + Intronic
955101903 3:55858898-55858920 AGAGGGAGCAGAACGGCTAAGGG - Intronic
955401088 3:58592019-58592041 AGGGTGAACAGAATTGCCTGGGG + Intronic
959478425 3:106840109-106840131 AGATAGAACAGAATGGCTTGTGG - Intergenic
961519459 3:127458437-127458459 AGAGGGAACAGTATGTCTAAAGG - Intergenic
961993559 3:131217451-131217473 AGGGCCAACAGCATAGCTAGAGG - Intronic
963286281 3:143437409-143437431 AGTGGACACAGGATGGCTAGAGG + Intronic
963378974 3:144505318-144505340 AGGGGATACAGAATGGGTAGTGG - Intergenic
964263905 3:154872761-154872783 AAGTGGAACAGTATGGTTAGAGG - Intergenic
965778811 3:172261841-172261863 ATGGGGAAGGGAATGGCAAGGGG - Intronic
965984529 3:174735922-174735944 AGGGTGAACAGAGTGGTGAGGGG + Intronic
967291122 3:187921301-187921323 AGGGGAGACAGAATGACAAGAGG - Intergenic
969625644 4:8304028-8304050 AGGGGACACAGAGTGGCCAGTGG + Intronic
971196125 4:24472588-24472610 AGGGGGAAGGGAATGGCAAAGGG + Intergenic
972933855 4:44106986-44107008 AGGTGGGAGAGGATGGCTAGTGG + Intergenic
976555261 4:86443473-86443495 AGGTGGGACAGGATAGCTAGAGG - Intronic
977284922 4:95091545-95091567 AGGAGGCACAGAATTGCTAGGGG - Intronic
977608458 4:99007316-99007338 AGGAGGCACAGAGTGGCTGGTGG + Intronic
977616395 4:99091394-99091416 AGGTGGTACAGAATGTCTAGAGG - Intergenic
978018275 4:103776120-103776142 TGGGAGAACTGGATGGCTAGAGG + Intergenic
978098367 4:104806896-104806918 AGGGGGAAAAGAAAAGCTGGAGG + Intergenic
978270186 4:106879118-106879140 AAGGGAAACAGAATGGGAAGGGG + Intergenic
979038988 4:115762866-115762888 AGGTGCAACAGGATGGCCAGAGG - Intergenic
981488261 4:145311469-145311491 AGGTGGAACAGGATGGCTAGAGG + Intergenic
982623063 4:157730925-157730947 AGGGAATACAGAATGGGTAGTGG - Intergenic
982932017 4:161420248-161420270 AGGGGATACAGAATGAGTAGTGG + Intronic
983352159 4:166603450-166603472 AGGAAGGACAGAATGGCTAGAGG - Intergenic
984781350 4:183529036-183529058 AAGGGCAAAATAATGGCTAGAGG - Intergenic
985271893 4:188201376-188201398 AGAGGAAAAAGAAAGGCTAGTGG - Intergenic
985576315 5:675035-675057 GGGGGGTACAGTATGGCTGGGGG + Intronic
985622091 5:961083-961105 AGGGGGAGCAGCTTGGCAAGTGG - Intergenic
985625474 5:983077-983099 AGGGGGACCTGGATGGCTGGGGG + Intergenic
987272644 5:16327800-16327822 AGATGGGACAGAATGGATAGAGG - Intergenic
987819297 5:22941272-22941294 AGGTGAAACAGAAAGGCTAGAGG + Intergenic
987915604 5:24209003-24209025 AAGGGGAACAGCAGGCCTAGAGG - Intergenic
988495037 5:31737565-31737587 ATGGGGACCAGAATGGCCATAGG + Intronic
988714485 5:33811565-33811587 CAGAGGACCAGAATGGCTAGAGG + Intronic
990035902 5:51319554-51319576 AGGTGGGACAGAATGCCTAGAGG + Intergenic
991031588 5:62087461-62087483 AGGTGGAAAAGAATGGATATTGG - Intergenic
992033385 5:72746761-72746783 AGGTGGGACAGGATGGCTAGAGG - Intergenic
992282324 5:75193077-75193099 AGGGTGAATAGAGTGGATAGTGG - Intronic
992522197 5:77565708-77565730 AGAGGGAAGAGTATGGCTAGAGG - Intronic
992594300 5:78330104-78330126 AGCGGGAACAGAATGAATAAAGG - Intergenic
994851792 5:105064593-105064615 AGTGAGAAGAGAATTGCTAGAGG - Intergenic
997204144 5:132031744-132031766 AGGAGCAACAGGATGGCTAGGGG + Intergenic
997250021 5:132381416-132381438 AGGGGGCACAGACAGGCTTGAGG - Intronic
998975528 5:147642250-147642272 ACAGGGAACAGAGTAGCTAGCGG + Intronic
1000297360 5:159923541-159923563 AAGGGGAACAGAGTGGGAAGGGG + Intronic
1001996259 5:176161535-176161557 AGGTTGAACAGGGTGGCTAGAGG - Intergenic
1007023090 6:38542405-38542427 ATGTGGAAGAGAATGGATAGAGG - Intronic
1007210190 6:40187430-40187452 TGTGGGTACAGAATGGCTGGGGG + Intergenic
1007647242 6:43392305-43392327 AGGGGCAACAGGAAGGCTGGAGG + Intergenic
1007746985 6:44049164-44049186 AGGGGGAACAGCATGGACAAAGG - Intergenic
1008133268 6:47742151-47742173 AGAAGAAACAGAAGGGCTAGAGG + Intergenic
1009198535 6:60716344-60716366 AGAGGAAACACAATTGCTAGAGG + Intergenic
1009921801 6:70071726-70071748 AGGGAGAACAGAATGGCATTGGG + Intronic
1010291872 6:74147079-74147101 AGGGAATACAGAATGGGTAGTGG - Intergenic
1010300231 6:74251658-74251680 AGTGGGGACAGAATGGCTGCAGG - Intergenic
1010497120 6:76548200-76548222 AAGTGGGACAGGATGGCTAGAGG + Intergenic
1011903539 6:92332119-92332141 AGGGAGAACATCATGGATAGGGG + Intergenic
1013020730 6:106214306-106214328 AGGGGGAACAGAGAGGGGAGTGG + Intronic
1014524532 6:122486267-122486289 AGGGGGAATAAAATGACTGGAGG - Intronic
1015381776 6:132578143-132578165 AGGGAGAGCAGAATAGGTAGTGG - Intergenic
1015573593 6:134647460-134647482 AGGAAGAACAGAATGGATGGTGG + Intergenic
1019934673 7:4246556-4246578 AGGGGGAAACGAATGTCCAGGGG - Intronic
1020587978 7:10095592-10095614 AGATGGGACAGGATGGCTAGAGG + Intergenic
1021382799 7:19988654-19988676 AAGTGAGACAGAATGGCTAGAGG + Intergenic
1021809461 7:24389428-24389450 AGGGGGAAGGGAATGGCGGGAGG - Intergenic
1021846643 7:24769529-24769551 ATGTGGGGCAGAATGGCTAGAGG - Intergenic
1022628432 7:32062111-32062133 AGTGGGAACAGAATGAATGGGGG - Intronic
1023101407 7:36722021-36722043 AGGGGTGAGGGAATGGCTAGAGG - Intronic
1023148717 7:37179197-37179219 AGAGGGAACAGACTGGCGAGGGG + Intronic
1023663092 7:42490852-42490874 AGGAGGAACAGATTGGCTCCAGG - Intergenic
1023932249 7:44713046-44713068 AAGGGGTACAGAATGCCCAGTGG - Intergenic
1024158940 7:46654793-46654815 AGGGAATACAGAATGGATAGTGG - Intergenic
1024430747 7:49285428-49285450 AGGTAAAAAAGAATGGCTAGAGG - Intergenic
1024727549 7:52215285-52215307 AGGTGGGACAGAAGGGCTAGAGG - Intergenic
1028739581 7:94258335-94258357 TGGGTGAACAGAGTGCCTAGAGG - Intergenic
1030040319 7:105443852-105443874 AGGTGAGACAGAAAGGCTAGTGG - Intronic
1030281507 7:107780522-107780544 AGGGGGAACAGGACGGTGAGGGG - Intronic
1032879018 7:136068783-136068805 AGCAGGACCAGAATAGCTAGGGG + Intergenic
1033010132 7:137612910-137612932 AGCAGGCACAGAATGTCTAGGGG - Intronic
1036042097 8:5096731-5096753 AGGGCAAACAGGAAGGCTAGAGG + Intergenic
1036218843 8:6903630-6903652 AGGGGGAAGAGAAAGGACAGGGG + Intergenic
1036218849 8:6903648-6903670 AGGGGGAAGAGAAAGGATGGGGG + Intergenic
1036463501 8:8974752-8974774 AGGGGGAAGAGAAGGGGTTGGGG - Intergenic
1037254250 8:16934532-16934554 AGGTAGAACAAAATGGCTAGCGG - Intergenic
1038279402 8:26150099-26150121 AGGAGGAACAGGATGGCTAGAGG + Intergenic
1038919984 8:32072313-32072335 AAAGGGAACAGAATGACTAAGGG - Intronic
1039986052 8:42448789-42448811 AGGGGGAGCAGAATGGGGACAGG + Intronic
1041274190 8:56141286-56141308 AGGGAATACAGAATGGGTAGCGG - Intergenic
1041683230 8:60614848-60614870 TGGGGGAAAGGAAAGGCTAGTGG + Intronic
1042610552 8:70595217-70595239 AGAGGAAGCAGAAGGGCTAGAGG - Intronic
1043225788 8:77728406-77728428 AGGGGGAACAGACTGGAGGGAGG - Intergenic
1043546746 8:81324058-81324080 AGGGTGACTAGAATGGCTAGGGG - Intergenic
1044559174 8:93595875-93595897 AGAGGGAACAGTATGGGTGGAGG - Intergenic
1046103228 8:109638371-109638393 AGGGGGAGAAAAATGGATAGAGG + Intronic
1046513751 8:115232179-115232201 GGAGGGAACAGAATGGCTGCTGG + Intergenic
1046548146 8:115677435-115677457 TGGTGGAACAGATTGGCTACAGG + Intronic
1046581729 8:116101651-116101673 AGAGGGAAAAGCTTGGCTAGAGG - Intergenic
1047502764 8:125454670-125454692 AGGGGGAAGAGCATGGCCAGAGG + Intergenic
1050375054 9:4962618-4962640 AGGTCACACAGAATGGCTAGAGG + Intergenic
1053304559 9:36974946-36974968 AGAGGGAGCAGAATGTCCAGGGG - Intronic
1055449171 9:76415411-76415433 AGGTGGGACAGGATGGCTAGTGG + Intergenic
1055742840 9:79408442-79408464 AGGTGGAACTGAATCACTAGAGG - Intergenic
1055761584 9:79614455-79614477 AGTGGGAACAGAATGTATAATGG + Intronic
1056428295 9:86501094-86501116 AGGTGGAACAGAATGGCTAATGG + Intergenic
1057197000 9:93120903-93120925 GGGGAGAACAGAATGGGTAGTGG + Intergenic
1057715454 9:97491659-97491681 AGGTGGAGCAGGATGGCTAGAGG + Intronic
1057946976 9:99338431-99338453 AGGGGGCACTGAATGGGTATGGG + Intergenic
1058111524 9:101035475-101035497 AGAGGGAACAGCATGGCGAAAGG - Intronic
1062252044 9:135603188-135603210 AGGGGGAGCACAGTGGTTAGGGG - Intergenic
1062596174 9:137300781-137300803 AGGGGGAACAGAACGGGGTGGGG + Exonic
1185735607 X:2493245-2493267 AGGGGGAAAAGAATCTCAAGAGG + Intronic
1186404583 X:9290753-9290775 AGGGGGCACAGAATGAATTGGGG + Intergenic
1186497621 X:10024495-10024517 AGGGAGAACCGAATGGCTCGGGG - Intronic
1186851646 X:13585853-13585875 TGGGGGAGCAGAATGGAGAGAGG - Intronic
1187293769 X:17979482-17979504 AGAGGTAACTGAATGGCTGGGGG + Intergenic
1187541685 X:20202601-20202623 TGAGGTAACTGAATGGCTAGAGG + Intronic
1187931990 X:24302152-24302174 CAGGGAAACAGAATTGCTAGAGG - Intergenic
1189032218 X:37462415-37462437 AGGGAAAACAGAATGGGTAGTGG - Intronic
1189286094 X:39853568-39853590 AAGGGGAACAAAATGGAAAGGGG + Intergenic
1189898679 X:45683021-45683043 CTGGGGGACAGAATGGCTAGAGG + Intergenic
1190256067 X:48763147-48763169 ACTGGGAAAAGAATGGCAAGTGG + Intronic
1190765967 X:53475872-53475894 AGGGAGTATGGAATGGCTAGTGG + Intergenic
1192896553 X:75448319-75448341 AGGGAGTACAGAATGGATGGTGG + Intronic
1194235606 X:91379868-91379890 AGGGAGTACAAAATGGGTAGTGG + Intergenic
1194369529 X:93055361-93055383 AGGTGGAATAGAATGGCTAGGGG + Intergenic
1194649687 X:96499974-96499996 AGGGAATACAGAATGGGTAGTGG + Intergenic
1196056540 X:111362432-111362454 TGGGGGAACTGAATGGCTTGGGG - Intronic
1197145275 X:123165584-123165606 AGTGGGGACAAGATGGCTAGAGG + Intergenic
1197404568 X:126034256-126034278 AGGTGGAATAGGACGGCTAGAGG + Intergenic
1198574046 X:137990616-137990638 AGAAGGAACAGAAAGGCAAGAGG + Intergenic
1199491541 X:148405653-148405675 AGGGGGAACAGTGAGGTTAGGGG - Intergenic
1200278679 X:154758186-154758208 AGGGGTGACAGGATGGCTGGAGG - Intergenic
1200677720 Y:6171573-6171595 AGGTGGAATAGAATGGCTAGGGG + Intergenic
1201193464 Y:11469499-11469521 AGGGAATACAGAATGGATAGTGG - Intergenic
1202061377 Y:20891827-20891849 AGGTGGAGAAGAATGGCTTGAGG + Intergenic