ID: 944581274

View in Genome Browser
Species Human (GRCh38)
Location 2:201134717-201134739
Sequence TTAGGTCAACAGTACCATGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 91
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 83}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944581274_944581281 30 Left 944581274 2:201134717-201134739 CCTACATGGTACTGTTGACCTAA 0: 1
1: 0
2: 0
3: 7
4: 83
Right 944581281 2:201134770-201134792 TGTTTCTAAAATATGACAATAGG 0: 1
1: 0
2: 1
3: 38
4: 465

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944581274 Original CRISPR TTAGGTCAACAGTACCATGT AGG (reversed) Intronic
901449737 1:9328786-9328808 CTATGTCAACAGTGCCATGTTGG - Intronic
901647988 1:10726922-10726944 TCAGGTAAATAGCACCATGTGGG + Intronic
907202296 1:52737951-52737973 CTAGGTCAAAAGTGCCATTTAGG - Intronic
909245429 1:73275682-73275704 TTAGGTCAACTTTACCTTCTGGG - Intergenic
909710607 1:78645374-78645396 TTAGGTCAACAATACCAAGAGGG + Exonic
912335675 1:108860225-108860247 TTAGGCACACAGTACCATGCAGG + Intronic
924277828 1:242405901-242405923 TTAGGTCAAAAGTATCATATAGG - Intronic
924379575 1:243449864-243449886 TTAGGTCCACACTCCCATCTTGG + Intronic
1070781524 10:79140165-79140187 CGAGGTCCACAGTGCCATGTGGG + Intronic
1075878427 10:125827603-125827625 TTAATTCAACAGAACCATATTGG + Exonic
1077488094 11:2848253-2848275 TGATGTCAACATCACCATGTGGG - Exonic
1079413674 11:20212910-20212932 TAAGGCCAACAGAACCGTGTTGG - Intergenic
1079901837 11:26196856-26196878 GTAAGTCAACAGTATAATGTAGG + Intergenic
1080983817 11:37437738-37437760 TTAGGTCAATAGTAACAAATGGG - Intergenic
1081012065 11:37826030-37826052 TGTGCTCAACAGTACCATGGAGG - Intergenic
1082720984 11:56676025-56676047 TTTTGGCAACAGTACCATGCTGG - Intergenic
1085027733 11:73246930-73246952 TTTGGTCAACAGTAGAATATTGG + Intergenic
1088450715 11:109978443-109978465 ATACGCCAACCGTACCATGTTGG - Intergenic
1099572322 12:84338541-84338563 TTAGTGAAACAGTAGCATGTCGG - Intergenic
1107850523 13:44568109-44568131 TTAGGTAAAGAATACCAGGTGGG - Intronic
1109362039 13:61305550-61305572 ATAGGTAAACAGTGCCATGGTGG - Intergenic
1111715984 13:91879201-91879223 ATAGGTATACAGTACCATGGTGG + Intronic
1112335411 13:98511170-98511192 TTAGGTAAATGCTACCATGTGGG - Intronic
1114200482 14:20515456-20515478 TGAGGCCAGCAGTGCCATGTGGG + Intergenic
1118948437 14:70410947-70410969 ATAGGTAAACAGTGTCATGTGGG - Intronic
1120723042 14:87907860-87907882 TTAGATCAAAAGGACAATGTTGG + Intronic
1121088759 14:91166911-91166933 TTGGGCCAACTGTTCCATGTTGG - Intronic
1124044675 15:26137977-26137999 TTAGGACAACTGTACAATGTTGG - Intergenic
1126920500 15:53517067-53517089 TTAACTCAACAGTACAAGGTTGG + Exonic
1127482699 15:59391931-59391953 TTAGGTCAAAAATACCCTTTCGG + Intronic
1133095731 16:3443843-3443865 TTCGGCCAACAGTGCCCTGTAGG + Intronic
1133312925 16:4862407-4862429 TTAAGTGAATTGTACCATGTTGG + Intronic
1141325057 16:83049181-83049203 TTGGGTTAACAGAACCATTTTGG - Intronic
1143114244 17:4572764-4572786 TTAGGTAAACAGCAACATATAGG - Intergenic
1143866995 17:9931310-9931332 TTATGTCACCACTACCACGTCGG + Intronic
1147021282 17:37535806-37535828 TCAGTTGAACAGTACCAGGTGGG - Intronic
1147736697 17:42643260-42643282 TTAGTACAAAAATACCATGTTGG + Intergenic
1151232016 17:72691851-72691873 TTTGGTCAACAGTGCCAAATAGG + Intronic
1160152635 18:76406705-76406727 TTAGGTCTACAGGAACGTGTTGG - Intronic
926384481 2:12322798-12322820 TTAGTTCAGGATTACCATGTGGG - Intergenic
926674101 2:15605166-15605188 TTAGTTTAACAGTACCATTCTGG + Intronic
936277151 2:111109419-111109441 ACAGGCCATCAGTACCATGTGGG - Intronic
938475830 2:131611995-131612017 ATAGGTAAACTGTATCATGTAGG + Intergenic
939442759 2:142271215-142271237 TTAGGTCAAGAGTTCTCTGTTGG - Intergenic
941094670 2:161224128-161224150 TTAGGTCATCTTTAACATGTAGG - Intronic
944437326 2:199704360-199704382 TTGGGGCAGCAGGACCATGTAGG - Intergenic
944581274 2:201134717-201134739 TTAGGTCAACAGTACCATGTAGG - Intronic
947259904 2:228209346-228209368 TTAGGAAAACAGTACCAAGCAGG + Intergenic
1172710647 20:36920550-36920572 TGAGGTCAACAGTACAAGTTTGG + Intronic
1173833944 20:46112963-46112985 TTAGCTCACCAGTATCACGTGGG - Intergenic
1177396544 21:20543284-20543306 ATAGCTCTACAGTACCATCTTGG + Intergenic
952449056 3:33413707-33413729 TGAGATAAAGAGTACCATGTGGG + Intronic
953469298 3:43153690-43153712 TAAGGCCAACCGTGCCATGTGGG + Intergenic
954051660 3:47984296-47984318 TTAGGTCAAAAATACCAGGGAGG - Intronic
958134787 3:89474795-89474817 TTATGTCAGCAATACCATGTTGG + Intronic
964496076 3:157291841-157291863 TTATATCAACAGTAGCATTTAGG + Intronic
971115074 4:23636342-23636364 TTAGGTCAATAGTAATATATTGG + Intergenic
972614878 4:40688344-40688366 TTAGGTGGGGAGTACCATGTTGG + Intergenic
977071615 4:92396838-92396860 CTAGGTCAACACTACTATATTGG - Intronic
982092099 4:151889109-151889131 TTAGATGAACAGTTTCATGTGGG + Intergenic
983852464 4:172598617-172598639 TTACGTCTACAGTTCCATGATGG + Intronic
984397511 4:179220435-179220457 TTAGCTCCAGAGTTCCATGTAGG + Intergenic
984503412 4:180587252-180587274 ACAGCTCAAAAGTACCATGTGGG - Intergenic
987807013 5:22782042-22782064 TTAATTCAACAATACAATGTGGG - Intronic
988791768 5:34615018-34615040 TTTAGTCAACTGTACCATCTAGG + Intergenic
995039184 5:107568990-107569012 TAAGGTCAACAGAACCAAGGTGG - Intronic
996579357 5:125013673-125013695 TTAGCACAACAAGACCATGTTGG + Intergenic
998763035 5:145453527-145453549 ATAGGTATACAGTACCATGGTGG + Intergenic
1008805775 6:55426030-55426052 TTAAGTCAACCTTACCAAGTAGG - Intergenic
1019947073 7:4338300-4338322 TTAGGACCACAGTATCTTGTGGG - Intergenic
1020947372 7:14629546-14629568 TTAGGGAAACAATACCATTTGGG + Intronic
1024837883 7:53545321-53545343 TTAAGTTAACTGTACTATGTGGG - Intergenic
1029052196 7:97700741-97700763 TTAGGTCAACTGCAGCTTGTTGG - Intergenic
1030558522 7:111056627-111056649 TCAGGTCAACAGTAGGCTGTTGG - Intronic
1031340801 7:120597942-120597964 TTAAGTCAAAAGTACTATCTGGG + Intronic
1042583293 8:70306140-70306162 CTATGGCAACAGTACCATTTCGG + Intronic
1043617288 8:82142482-82142504 TTAATTCAAGAGTTCCATGTTGG - Intergenic
1044162474 8:88936240-88936262 TTGGGTCAACTGTAGCCTGTTGG - Intergenic
1045099976 8:98834387-98834409 TTAGGTCAACAGAACAAAATTGG + Intronic
1045249061 8:100468007-100468029 TAAACTCAACAGGACCATGTGGG - Intergenic
1047435694 8:124833989-124834011 TTATGGCAACAGTAACATGTAGG + Intergenic
1048117078 8:131535536-131535558 TAAGGTCTACAGTACCATCTAGG + Intergenic
1049743323 8:144251278-144251300 AAAGGTCAACAGTACCAGGAAGG - Intronic
1051080454 9:13287968-13287990 TTAGTTCCAGAGTACCATATAGG - Intergenic
1056907413 9:90665704-90665726 TTGGGTCAACTGCACCTTGTTGG - Intergenic
1058172092 9:101694064-101694086 TTATGTCAACTGCACCATGCAGG - Intronic
1062360975 9:136187910-136187932 TCAGGCCAACAGGGCCATGTTGG - Intergenic
1187397557 X:18931497-18931519 TAAGGTCAACTGGACCGTGTTGG - Intronic
1194895980 X:99440432-99440454 TTAGATAAACAGTATGATGTTGG - Intergenic
1197284645 X:124581941-124581963 ATAGGTAAACAGTGCCATGGTGG + Intronic
1200868575 Y:8073144-8073166 TTTGGTGAACAGTACCAGGCAGG + Intergenic