ID: 944586640

View in Genome Browser
Species Human (GRCh38)
Location 2:201178869-201178891
Sequence AATGGGAGGCAGAAGGGGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1087
Summary {0: 1, 1: 0, 2: 5, 3: 94, 4: 987}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944586629_944586640 1 Left 944586629 2:201178845-201178867 CCAAGTCCTGGGGCCTTGAATGG 0: 2
1: 1
2: 8
3: 40
4: 208
Right 944586640 2:201178869-201178891 AATGGGAGGCAGAAGGGGGCAGG 0: 1
1: 0
2: 5
3: 94
4: 987
944586620_944586640 30 Left 944586620 2:201178816-201178838 CCTTCTCCAATCTTGAAGTGGGG 0: 1
1: 0
2: 3
3: 17
4: 143
Right 944586640 2:201178869-201178891 AATGGGAGGCAGAAGGGGGCAGG 0: 1
1: 0
2: 5
3: 94
4: 987
944586631_944586640 -5 Left 944586631 2:201178851-201178873 CCTGGGGCCTTGAATGGCAATGG 0: 1
1: 2
2: 14
3: 40
4: 162
Right 944586640 2:201178869-201178891 AATGGGAGGCAGAAGGGGGCAGG 0: 1
1: 0
2: 5
3: 94
4: 987
944586624_944586640 24 Left 944586624 2:201178822-201178844 CCAATCTTGAAGTGGGGTTGGGG 0: 2
1: 5
2: 3
3: 45
4: 253
Right 944586640 2:201178869-201178891 AATGGGAGGCAGAAGGGGGCAGG 0: 1
1: 0
2: 5
3: 94
4: 987

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944586640 Original CRISPR AATGGGAGGCAGAAGGGGGC AGG Intergenic
900122197 1:1053589-1053611 AGTGGGAGGGAGAAGAGGGATGG - Intronic
900203705 1:1422156-1422178 CCTGGGAGGCTGAAGGGGGCTGG - Intergenic
900987766 1:6083108-6083130 AAAGGGCTGCAGATGGGGGCTGG - Intronic
901011242 1:6203611-6203633 TTTGGGAGGCAGAGGCGGGCAGG + Intronic
901021156 1:6256610-6256632 TTTGGGAGGCTGAAGTGGGCAGG - Intronic
901048607 1:6414475-6414497 ATTGGGGGGCAGCAGGGAGCAGG - Intronic
901522091 1:9792892-9792914 AAACGGAGTGAGAAGGGGGCAGG + Intronic
902344231 1:15804216-15804238 AATGGGAGGCCGAGGCGGGTGGG - Intergenic
902478913 1:16701597-16701619 TCTGGGAGGCAGAGGGGGCCGGG - Intergenic
902811906 1:18892716-18892738 AGTGGGAGGCAGAGTGGGGGTGG - Intronic
903045673 1:20562688-20562710 GATGGAAGGCACAAGGGGACGGG - Intergenic
903269114 1:22176785-22176807 GCTGGGAGGCAGCAGGGTGCAGG + Intergenic
903373872 1:22853782-22853804 AAGGGGAGGCTGAAGCAGGCCGG + Intronic
903836443 1:26206232-26206254 TTTGGGAGGCTGAGGGGGGCAGG + Intergenic
904026077 1:27504601-27504623 AGTGGGAGGCCGGTGGGGGCTGG + Intergenic
905173834 1:36124612-36124634 AATGGCAGAGAGATGGGGGCAGG + Intronic
905505090 1:38472284-38472306 AATGTGAAGCAGAAGTGGACAGG - Intergenic
905535832 1:38721062-38721084 GATGGGAGATAGAAGTGGGCAGG - Intergenic
905603571 1:39275322-39275344 TTTGGGAGGCAGAGGCGGGCGGG - Intronic
905778231 1:40684782-40684804 AATGGGAGACAGGAAGGAGCTGG - Intergenic
905824276 1:41017167-41017189 AGTGGGTGGCTGAAGGGGTCTGG + Intronic
906182416 1:43833699-43833721 AATGAGAGGCAGAAAGGGGAAGG + Intronic
906448598 1:45924109-45924131 TTTGGGAGGCTGAAGTGGGCAGG - Intronic
906745134 1:48216084-48216106 AATGGGAAGCTGGATGGGGCAGG + Intergenic
906953205 1:50350783-50350805 ATGGGGAGTCAGAAGGGGGATGG - Intergenic
906953676 1:50354815-50354837 AATGGGAGACAAAGGGGGCCTGG + Intergenic
907198703 1:52707749-52707771 TTTGGGAGGCCGAAGCGGGCAGG + Intergenic
907206109 1:52773229-52773251 TTTGGGAGGCAGAGGTGGGCAGG + Intronic
907375625 1:54036039-54036061 TTTGGGAGGCAGAGGTGGGCAGG + Intronic
907422451 1:54356538-54356560 TGTGGGAAGCAGAAGGCGGCCGG + Intronic
907828628 1:58042577-58042599 AAAAGGAGGGAGATGGGGGCAGG + Intronic
907974566 1:59418961-59418983 TATGGAAGCCAGAAGGGGCCTGG + Intronic
908098913 1:60770661-60770683 AATATGAGGAAGTAGGGGGCAGG + Intergenic
908182391 1:61618883-61618905 ATGGGCAGGCAGAAGGGGGAGGG + Intergenic
908411303 1:63868387-63868409 AATATGAGGCAGAGGGAGGCTGG + Intronic
908428348 1:64031108-64031130 TTTGGGAGGCAGAGGCGGGCGGG - Intronic
908479380 1:64522547-64522569 TTTGGGAGGCTGAAGCGGGCAGG - Intronic
908625097 1:66031332-66031354 AATGGAAAGAAGAAGGGAGCAGG + Intronic
908810877 1:67981199-67981221 AATGGGAGGCAGGTGGGGGTGGG + Intergenic
909261532 1:73495623-73495645 TTTGGGAGGCCGAAGCGGGCGGG - Intergenic
910367971 1:86486917-86486939 AATAGGAGGTTGAAAGGGGCTGG + Intronic
911310701 1:96289065-96289087 AATGGCAGTCAGAAGGGGGATGG + Intergenic
911420508 1:97635244-97635266 AATGGGAGGAAGGAAGGTGCGGG - Intronic
911480861 1:98438385-98438407 AATGGAGGGAAGAAGGTGGCAGG - Intergenic
911796361 1:102081635-102081657 ATTGGGAGGCTGAGGTGGGCGGG - Intergenic
911904528 1:103549918-103549940 ATTGGGAGGCCGAAGCGGGGGGG + Intronic
912002769 1:104856047-104856069 GATGGGAGCCAAAAGGGGGATGG + Intergenic
912564983 1:110580944-110580966 AATGAGAGGCAGCAGGGCTCTGG + Intergenic
912875565 1:113355199-113355221 CTTGGGAGGCAGAAGTGGGAGGG - Intergenic
913185725 1:116369158-116369180 TTTGGGAGGCAGAGGCGGGCAGG + Intergenic
913442618 1:118914806-118914828 AATGTGAGACTGAATGGGGCAGG + Intronic
913478159 1:119258954-119258976 TTTGGGAGGCTGAGGGGGGCAGG - Intergenic
914323075 1:146584215-146584237 CATGGCAGTCAGGAGGGGGCTGG - Intergenic
914542820 1:148632287-148632309 TTTGGGAGGCAGAAGTGGGAGGG + Intronic
914799330 1:150948959-150948981 TTTGGGAGGCCGAAGTGGGCAGG - Intronic
915271434 1:154756452-154756474 ACTGAGCCGCAGAAGGGGGCAGG - Intronic
915359687 1:155278342-155278364 ATAGGGACGCTGAAGGGGGCGGG + Intronic
915602906 1:156933447-156933469 ACGGGGAAGCAGAAGGGAGCGGG - Intergenic
915837321 1:159188234-159188256 AATGGGAGGCCGGAGAGGGGAGG - Intronic
915953432 1:160205263-160205285 ATGGAGAGGCAGGAGGGGGCGGG - Intergenic
916143732 1:161722317-161722339 AATGGGAGCCTGAAGATGGCGGG + Intronic
916192112 1:162189909-162189931 ATTGGGAGGCAGCAGTGAGCTGG + Intronic
916229277 1:162523707-162523729 AAGGGGAGGAAAAAGGGAGCAGG - Exonic
916422638 1:164651054-164651076 GATGGGAGGTACAAGGAGGCTGG - Intronic
916515788 1:165515291-165515313 TTTGGGAGGCCGAAGTGGGCAGG + Intergenic
916668173 1:166986400-166986422 CATGGGAGACAGAAGTGGGACGG + Intronic
916760856 1:167816301-167816323 TTTGGGAGGCAGAGGTGGGCAGG + Intronic
917308825 1:173656041-173656063 CATGGGAAGCACAAGGGGTCAGG - Intronic
918002679 1:180512476-180512498 AAGGGCAAGAAGAAGGGGGCAGG + Intergenic
918345895 1:183606763-183606785 AAAGGTAGGCAGCGGGGGGCAGG + Intergenic
919199891 1:194342756-194342778 ATCGGGAGACAGAAGGGGGATGG - Intergenic
919375348 1:196786738-196786760 CTTGGGAGGCACAAGGGGTCAGG - Intronic
919742987 1:200991727-200991749 TGTGGGAGACAGAAGAGGGCTGG + Intronic
919771014 1:201158598-201158620 AATGTGAGCCAGGAGGGAGCCGG + Intronic
919799510 1:201344937-201344959 AATGGGAAGCAGCAGGAGGCAGG - Intergenic
919990978 1:202708765-202708787 AGTGGCAGGTGGAAGGGGGCAGG - Intronic
920156642 1:203957430-203957452 TTTGGGAGGCTGAAGCGGGCAGG - Intergenic
920378629 1:205522940-205522962 ACTGGGAGGAAGAAGGTGACTGG + Intronic
920637250 1:207715802-207715824 ACTGGGAGGCTGAAGTGGGAGGG - Intronic
920756452 1:208738385-208738407 ATGGGGAGCCAGAAGGGGGATGG + Intergenic
920954363 1:210604326-210604348 TTTGGGAGGCCGAAGTGGGCAGG - Intronic
921164189 1:212494316-212494338 AATGGCAGGCAGGAGGTGGCGGG + Intergenic
921176904 1:212603329-212603351 GATGGGAAGCAGAGAGGGGCAGG + Intronic
921334480 1:214072633-214072655 AGAGGGAGGCAGCAGGGGGGAGG - Intergenic
921390944 1:214612914-214612936 AATGGGGGGCAGGAAGGGGAAGG + Intronic
921422066 1:214959677-214959699 AAGTGGAGGCAGAAGGGAGAGGG + Intergenic
921456807 1:215380803-215380825 AAGGGGAGGAAGAAGTGGGAAGG + Intergenic
921559377 1:216639131-216639153 AATGGGAGGCAGGAGTAGGGAGG + Intronic
921726791 1:218533239-218533261 ACTGGGAGGCTGAGGTGGGCGGG - Intergenic
922594302 1:226802302-226802324 TTTGGGAGGCTGAAGTGGGCAGG - Intergenic
923127049 1:231041163-231041185 AGTGGGAGGCAGCAGGAGGCGGG - Intergenic
923552972 1:234978914-234978936 AAGCAGAGGCAGCAGGGGGCAGG + Intergenic
923601693 1:235409241-235409263 ATTGGTAGGCAGAAGGAGGAAGG + Intronic
923616156 1:235539210-235539232 AATGGGAGGGAGTTGGGGGTAGG + Intergenic
923679317 1:236106314-236106336 TATGGGAGGCCGAGGCGGGCGGG - Intergenic
923853228 1:237819574-237819596 TTTGGGAGGCTGAAGGGGGATGG + Intronic
923946994 1:238899176-238899198 AATGGGAGAAAGAAGGAGGCTGG + Intergenic
924237277 1:242009840-242009862 GATGGGAGGCAAAAGTGGGGTGG - Intergenic
924415246 1:243850549-243850571 AGCGGGAGGAAGGAGGGGGCGGG - Intronic
924455011 1:244212372-244212394 AATGGGAGGGAGCAGGGGATGGG + Intergenic
1062791844 10:311669-311691 AATGGGATGGAGAAGAGGGAGGG + Intronic
1062954468 10:1531013-1531035 AATGGGAGGCAGAAATGCTCAGG - Intronic
1063247020 10:4231690-4231712 CAGGGGTGGCAGAAGGGTGCTGG + Intergenic
1063515035 10:6687425-6687447 AGTGGGAGGAAGAAGAGGGTTGG - Intergenic
1064282567 10:13964924-13964946 TTTGGGAGGCAGAGGCGGGCAGG - Intronic
1064864249 10:19861275-19861297 TTTGGGAGGCAGAGGTGGGCGGG - Intronic
1065333577 10:24630733-24630755 TTTGGGAGGCTGAAGTGGGCAGG - Intronic
1065724558 10:28657142-28657164 TTTGGGAGGCAGAAGTGGGTGGG + Intergenic
1065920042 10:30385268-30385290 TTTGGGAGGCTGAAGCGGGCAGG - Intergenic
1066193839 10:33079680-33079702 AGAGGGAGGTGGAAGGGGGCAGG - Intergenic
1066311450 10:34200949-34200971 AAAGGCAGGCAGTGGGGGGCAGG - Intronic
1066382605 10:34913898-34913920 TTTGGGAGGCAGAGGTGGGCAGG + Intergenic
1067370609 10:45678608-45678630 CAGGGGAGGCAGCAGGGTGCGGG + Intergenic
1067389172 10:45847548-45847570 CAGGGGAGGCAGCAGGGTGCGGG - Intronic
1067416898 10:46109410-46109432 CAGGGGAGGCAGCAGGGTGCGGG + Intergenic
1067445085 10:46337001-46337023 CAGGGGAGGCAGCAGGGTGCGGG + Intergenic
1067502300 10:46816293-46816315 CAGGGGAGGCAGCAGGGTGCGGG + Intergenic
1067545112 10:47187414-47187436 AAAGAGAGAAAGAAGGGGGCAGG - Intergenic
1067592287 10:47523727-47523749 CAGGGGAGGCAGCAGGGTGCGGG - Intronic
1067607881 10:47682710-47682732 TTTGGGAGGCCGAAGTGGGCAGG - Intergenic
1067639403 10:48031800-48031822 CAGGGGAGGCAGCAGGGTGCGGG - Intergenic
1067874091 10:49988505-49988527 CAGGGGAGGCAGCAGGGTGCGGG + Intronic
1067923437 10:50482876-50482898 AATGGAAGGCAGAAAAAGGCAGG + Intronic
1069289018 10:66753418-66753440 TTTGGGAGGCTGAAGTGGGCAGG + Intronic
1069327229 10:67245937-67245959 AATGAGAGCCAAAAGGGAGCAGG - Intronic
1069505963 10:68998191-68998213 TTTGGGAGGCTGAAGCGGGCAGG - Intronic
1069726107 10:70580152-70580174 GATGGGAGACAGAAGGAGGAAGG - Intergenic
1070070178 10:73080678-73080700 TTTGGGAGGCAGAAGCGGGCAGG + Intronic
1070327370 10:75397355-75397377 ACTGGGAGGCGGAGGGGCGCTGG - Intergenic
1070330207 10:75410888-75410910 AATGGGAGGCGGGAGGATGCAGG - Intergenic
1071503980 10:86222015-86222037 CATGGGGGGAAGAAGGGGACAGG + Intronic
1071573260 10:86709499-86709521 AAGGGTAGGCAGAAGAGGCCAGG + Intronic
1071598946 10:86946969-86946991 AAGGGGCTGCAGAAGGAGGCTGG + Intronic
1071893797 10:90041989-90042011 GATGGGAGCCAGAATGGGGATGG + Intergenic
1072105143 10:92266609-92266631 AATGGGAAGCGGGAGGGGGAAGG + Intronic
1072122387 10:92415716-92415738 TTTGGGAGGCTGAAGGGGGGGGG - Intergenic
1072234637 10:93442914-93442936 TTTGGGAGGCCGAGGGGGGCGGG + Intronic
1072439157 10:95438597-95438619 GATGGGTGGAAGAAGGGTGCTGG + Intronic
1072526902 10:96279953-96279975 CATGGGAGGCAGAAGGGAGCTGG + Intergenic
1072704615 10:97671894-97671916 TTTGGGAGGCCGAAGTGGGCGGG - Intronic
1073045908 10:100638038-100638060 AATGTGAGGCAGGAGGGAGGTGG + Intergenic
1073184355 10:101606819-101606841 AATGGGTGTGAGAAGGGGGTGGG + Intronic
1073345714 10:102781453-102781475 AATGTGTGGCAGGAGGGGCCTGG + Intronic
1073358297 10:102874781-102874803 AAGGGGTGGCAAAAGGGGGAAGG + Intronic
1073472184 10:103729709-103729731 AATGGCATGCAGGAAGGGGCTGG + Intronic
1073691385 10:105813105-105813127 AATGGAATTCAGGAGGGGGCTGG - Intergenic
1073731246 10:106291080-106291102 TTTGGGAGGCCGAGGGGGGCGGG - Intergenic
1073887353 10:108055117-108055139 TTTGGGAGGCTGAAGTGGGCAGG + Intergenic
1074107439 10:110398933-110398955 TCAGGGAGGCAGAAGTGGGCGGG - Intergenic
1075131487 10:119743566-119743588 AAGGGCAGGCAGAAGTGGGTGGG + Intronic
1075284483 10:121171785-121171807 AAGGGAAGGCAGAAGGGGAAGGG + Intergenic
1075396061 10:122128035-122128057 ACTGCAAGGCAGAAGGTGGCAGG + Intronic
1075570188 10:123536111-123536133 AGAGGGAGGCTGGAGGGGGCAGG + Intergenic
1075685654 10:124363672-124363694 AATGGGAGGGAGGAGGGAGGAGG + Intergenic
1075930813 10:126293761-126293783 AATGGGAGGCCGAGGTGGGTGGG - Intronic
1076009359 10:126974994-126975016 TATGGGAGGCAGGAGGAGGAAGG - Intronic
1076121392 10:127939748-127939770 AAGGAGAGGCAGGAGGAGGCAGG + Intronic
1076362647 10:129900388-129900410 GATGGGGGGTAGGAGGGGGCTGG + Intronic
1076432115 10:130411424-130411446 AATGCCAGGCAAAAGAGGGCAGG + Intergenic
1076785993 10:132750198-132750220 AGTGGGAGACTGAAGGGAGCAGG + Intronic
1076838411 10:133032723-133032745 ATGAGGAGGGAGAAGGGGGCAGG - Intergenic
1077332262 11:1988858-1988880 AATGGGAGGCAGGGCGGGGGCGG + Intergenic
1077736970 11:4801467-4801489 AATGAGAGAGAGAAGGGGGAGGG + Intronic
1078322840 11:10352274-10352296 ATTGTGAGGCCCAAGGGGGCAGG + Intronic
1079002598 11:16770363-16770385 AATGGAAGGCAGAGGGTGGAGGG + Intergenic
1079141006 11:17809654-17809676 AGTGGGACGCAGAAGAGGGCAGG + Intronic
1079310427 11:19360727-19360749 AAGGGGAGGAAGAAGAAGGCTGG + Intronic
1079648196 11:22893680-22893702 GGTGGAAGGCAAAAGGGGGCAGG + Intergenic
1080225703 11:29957593-29957615 AGAGGGAGGGAGAAGGAGGCGGG - Intergenic
1080438550 11:32268940-32268962 AATGGGAAGGGGAAGGGGGAGGG + Intergenic
1080456276 11:32422417-32422439 AATGATAGGCAGAAGGTGGAAGG - Intronic
1080580632 11:33640423-33640445 AATGAGAGGCAGAAGAGGTGTGG - Intronic
1080790857 11:35521349-35521371 AATGAGAGGGAGAAGGTGGAAGG - Intronic
1081385503 11:42467419-42467441 TTTGGGAGGCCGAAGTGGGCAGG + Intergenic
1081654494 11:44848581-44848603 ATTGGGAGTGAGGAGGGGGCGGG + Intronic
1081654595 11:44849127-44849149 TACGGGTGGCAGCAGGGGGCAGG + Intronic
1081703328 11:45165392-45165414 AATGGGAGGGACTGGGGGGCTGG + Intronic
1083106272 11:60361285-60361307 AATCGTAGGCAGACAGGGGCAGG - Intronic
1083276039 11:61597696-61597718 AATGGGGGGCAGAGGGTGGGAGG - Intergenic
1083348090 11:62007904-62007926 ATTGGGAGGCTGAGGTGGGCAGG + Intergenic
1083369477 11:62166842-62166864 AACAGGAGGCAGGAGGGGTCTGG + Intergenic
1083420532 11:62550162-62550184 TTTGGGAGGCTGAAGTGGGCAGG - Intronic
1083479760 11:62936324-62936346 AATGGCAGCCAGTAGAGGGCAGG - Intergenic
1083613601 11:64015809-64015831 GAGGGGGCGCAGAAGGGGGCAGG + Intronic
1083738089 11:64693173-64693195 AACTGGAGGAAGGAGGGGGCGGG + Intronic
1084023939 11:66436225-66436247 TCAGGGAGGCAGAAGGGGCCAGG - Intronic
1084032911 11:66491647-66491669 AGGGGCAGGCAGGAGGGGGCAGG - Intronic
1084333010 11:68440654-68440676 CAGAGGAAGCAGAAGGGGGCTGG - Intronic
1084516589 11:69641043-69641065 AATGGGAGCGGGAGGGGGGCGGG - Intergenic
1084629213 11:70334908-70334930 AATGACAGGCAGAAAGGGACAGG - Intronic
1084633097 11:70369030-70369052 TATGGGAGGCAGAGGTGGGCGGG - Intronic
1084972549 11:72779866-72779888 AAAGTGAGGCAGAAGGGCTCAGG + Intronic
1085283936 11:75348044-75348066 AGTGTGAGGCAGCAGAGGGCTGG - Intronic
1085880881 11:80464643-80464665 ACTTGGAGGCAGAAGAGGGAAGG - Intergenic
1085911821 11:80835868-80835890 AATGGGAGGTAGAAGGCTGTTGG - Intergenic
1086286219 11:85254133-85254155 AATTGTTGGCAGAAGTGGGCAGG - Intronic
1086929824 11:92680864-92680886 AATGGGAGTCAGAAGGATCCAGG - Intronic
1087029269 11:93685949-93685971 TTTGGGAGGCAGAGGTGGGCGGG - Intronic
1087100446 11:94358903-94358925 CCTGGGAGGCACAAGGGGTCAGG + Intergenic
1087110360 11:94460022-94460044 AGAGGGAGGCAGATGGGAGCTGG + Intronic
1087218234 11:95517906-95517928 AATGGGGGACAGAAGGGAACTGG + Intergenic
1087411970 11:97802810-97802832 AATGGGAGAAAGAAGAGGGAAGG + Intergenic
1087700942 11:101435711-101435733 AATGAGAGGATGAAGGAGGCAGG - Intergenic
1088174462 11:107035548-107035570 AATGAGAGCAAGAAGGGGTCTGG + Intergenic
1088270340 11:108027649-108027671 ACTGGGAGGCTGAGGCGGGCGGG - Intronic
1088663229 11:112069244-112069266 TTTGGGAGGCCGAAGGGGGGTGG - Intronic
1089205252 11:116756267-116756289 TTTGGGAGGCTGAAGTGGGCGGG + Intronic
1089396747 11:118141103-118141125 AATGGGGGGAAGGAGGAGGCAGG + Intronic
1089579326 11:119471518-119471540 GATCAGAGGCAGCAGGGGGCCGG + Intergenic
1089660654 11:119983092-119983114 AACAGGAGGGAGGAGGGGGCTGG - Intergenic
1089705161 11:120272443-120272465 AATGGGAGGTAGAAGGAGTAGGG + Intronic
1090327114 11:125898430-125898452 AATGGGAGGCCGAGGCGGGTGGG + Intronic
1202815245 11_KI270721v1_random:44034-44056 AATGGGAGGCAGGGCGGGGGCGG + Intergenic
1091526713 12:1309596-1309618 AAAGGGAGAGAGAAGGGGGAAGG - Intronic
1091558317 12:1592816-1592838 AATGGGAGGATGAACAGGGCGGG + Intronic
1092374227 12:7942039-7942061 TCTGGGAGGCCGAAGCGGGCGGG + Intergenic
1092403902 12:8202632-8202654 TTTGGGAGGCCGAAGCGGGCGGG + Intergenic
1094070187 12:26404197-26404219 AACTGTAGGCAGAAGGGGGAAGG + Intronic
1094805168 12:34083438-34083460 CCTGGGAAGCACAAGGGGGCAGG + Intergenic
1095945583 12:47751522-47751544 TATGGAAGGTAGAAGGGGACAGG + Intronic
1096708005 12:53434846-53434868 TTTGGGAGGCCGAAGGGGGCGGG + Intergenic
1096792807 12:54055387-54055409 AGTGGGAGGGAGAGGAGGGCAGG - Exonic
1096808875 12:54157281-54157303 AAAGGGAGACAGAAGGGGTGGGG - Intergenic
1097992034 12:65845937-65845959 AAGGGCAGGCAGCAGGGGGGAGG - Intronic
1098171945 12:67755963-67755985 AGTGGGAGGGAGAAGGGGAATGG - Intergenic
1099308649 12:80990429-80990451 TTAGGGAGGCCGAAGGGGGCGGG + Intronic
1099540828 12:83905155-83905177 AATTGTAGGCAGAAAAGGGCAGG - Intergenic
1099561023 12:84174079-84174101 GGGTGGAGGCAGAAGGGGGCTGG + Intergenic
1100551631 12:95651430-95651452 AAGGGGAGGGAGATAGGGGCAGG - Intergenic
1100665325 12:96746014-96746036 AGAGAGAGGCAGAAGGAGGCTGG - Intronic
1101035128 12:100698113-100698135 ATTGGGATGAAGATGGGGGCTGG + Intergenic
1101215063 12:102572928-102572950 AGTGTGAGGCAGCATGGGGCAGG + Intergenic
1101356062 12:103978563-103978585 AATGTGAGGCAGAAGAGAGGAGG + Intronic
1101542421 12:105676991-105677013 CAGGGGAGGCAGGAGGGGCCAGG + Intergenic
1101734211 12:107450793-107450815 ACTGAGAGGCAGGAGGGGGAGGG + Intronic
1101986502 12:109451495-109451517 CAAGGGAAGCAGAAGGGGCCCGG + Exonic
1102065475 12:109971564-109971586 TTTGGGAGGCAGAAGGGGGTGGG - Intronic
1102230239 12:111257225-111257247 AAGGGGAGGAAGAAGTGGGAGGG - Intronic
1102344058 12:112147237-112147259 TTTGGGAGGCTGAAGTGGGCAGG - Intronic
1102675670 12:114656798-114656820 AATGGGAGGCATGAGAGGGGAGG + Intergenic
1102682239 12:114698664-114698686 AAAGGGAGGGAGAAGGGGAAAGG - Intergenic
1103192887 12:119017519-119017541 GATGGGAAGCAGCAGGAGGCTGG + Intronic
1103450626 12:121026104-121026126 CCTGGGAGGCAGAGGGGAGCCGG + Intronic
1103734732 12:123052986-123053008 CTTGGGAGGCTGAAGGGGGAGGG - Intronic
1103819906 12:123689296-123689318 ATTGGGAGGCCAAAGTGGGCAGG - Intronic
1104043195 12:125143856-125143878 GGTGGGAGTGAGAAGGGGGCTGG + Intergenic
1104144215 12:126017416-126017438 AAAGGGAGGCAGAAGAGAGAGGG - Intergenic
1104252956 12:127113311-127113333 GCTGGGAGGCAGAAGGAGGCTGG + Intergenic
1104254652 12:127125418-127125440 AATGGGAGGCAGGCTGGGGTGGG + Intergenic
1104867569 12:131967135-131967157 TTTGGGAGGCCGAAGGGGGGCGG + Intronic
1105401754 13:20102354-20102376 AACGGGAGGCAGAAGGGCACGGG + Intergenic
1105534230 13:21248840-21248862 AATGGGAGGTAGGAGCAGGCTGG - Intergenic
1105948353 13:25208668-25208690 AAGGGAAGGAAGAAGGTGGCGGG + Intergenic
1106081201 13:26501410-26501432 ACTGGGAGGGAGAAGGGAGCTGG + Intergenic
1106586138 13:31057913-31057935 ATAGGGAGGGAGAAGAGGGCGGG - Intergenic
1106788385 13:33129841-33129863 CACGGGAGGCATAAGGGGTCTGG - Exonic
1107516946 13:41138494-41138516 TTTGGGAGGCCGAAGCGGGCAGG + Intergenic
1107598124 13:41985141-41985163 GATGGGAGGCATAAGGGTACAGG + Intergenic
1107654131 13:42574420-42574442 AGCGGGAGGCGGCAGGGGGCTGG - Exonic
1107688401 13:42927285-42927307 AAGGGTAGGCAGAATGGGCCAGG - Intronic
1107968920 13:45622642-45622664 ACTGGGAAGCACAAGGGGTCAGG - Intergenic
1108112512 13:47091013-47091035 AATCGCAGGCAGAATGGAGCAGG + Intergenic
1108155049 13:47576227-47576249 AATGGGAGCAAGAGGGGGGCGGG + Intergenic
1108178410 13:47818071-47818093 GATGGGAGGAAGAAGAGGACAGG + Intergenic
1108478319 13:50843036-50843058 AGTGGGAGAAGGAAGGGGGCGGG - Intronic
1108821751 13:54359324-54359346 AATGGGAGGTAGGAGGTGGAAGG - Intergenic
1108977231 13:56462738-56462760 AATAAGAGGCATAAGAGGGCTGG + Intergenic
1109772646 13:66997344-66997366 AAAGGGAGGGAGAAGGTGCCAGG + Intronic
1109924678 13:69120508-69120530 AATGGAAGCCAGAAGTGAGCAGG + Intergenic
1109999540 13:70177151-70177173 TTTGGGAGGCAGAGGTGGGCCGG + Intergenic
1110088645 13:71415756-71415778 AATGGAATCCAGAAGTGGGCTGG - Intergenic
1111104659 13:83629596-83629618 AAAGGGAGTTAGAAAGGGGCTGG + Intergenic
1111413810 13:87912463-87912485 ATGGGGAGCCAGAAGGGGGATGG - Intergenic
1112294107 13:98171358-98171380 AATGGGAGGGGGAAGGGCGTGGG - Intronic
1112497691 13:99917774-99917796 TTTGGGAGGCTGAAGCGGGCAGG + Intergenic
1112719505 13:102227161-102227183 AATGGGAGGCAGAAAGAGATAGG - Intronic
1112929240 13:104714023-104714045 ATGGGGAGCCAGAAGGGGGATGG - Intergenic
1113197525 13:107826019-107826041 TTTGGGAGGCAGAGGTGGGCAGG - Intronic
1113331846 13:109334905-109334927 CATAGGAGACAGAACGGGGCGGG + Intergenic
1113364846 13:109666490-109666512 GATGGGAGACTGGAGGGGGCTGG - Intergenic
1113633683 13:111905418-111905440 GCGGGGACGCAGAAGGGGGCGGG - Intergenic
1113633714 13:111905490-111905512 GCGGGGACGCAGAAGGGGGCGGG - Intergenic
1113674617 13:112198758-112198780 TATGGGAAGCAGTGGGGGGCTGG - Intergenic
1113697218 13:112354922-112354944 GAAGGGAGACAGAAGGGGGAGGG + Intergenic
1113876613 13:113598561-113598583 AATGGGAGTCACAGGAGGGCAGG - Intronic
1113909669 13:113836226-113836248 AGTGGGAGGAGGAAGGGGGGAGG + Intronic
1113936439 13:113997501-113997523 AATGGGAGGCACAAAGGTCCTGG + Intronic
1113967829 13:114164392-114164414 AAGGAGAGGCAGATGGGGGAAGG + Intergenic
1114150319 14:20031272-20031294 AATGGCAGGCAGAAGGAGGGCGG + Intergenic
1114341874 14:21753955-21753977 TCTGGGAAGCAGAAGGGGTCAGG + Intergenic
1114616484 14:24071450-24071472 ATTGGGAGGGAGAAGAGGGAAGG - Intronic
1116090067 14:40293733-40293755 ATTGGGAATCAGAAGGGGGATGG + Intergenic
1117192428 14:53306055-53306077 AATGGGAGGGAGATGAGGGGTGG + Intergenic
1117313942 14:54555826-54555848 AATGGCAGCCAGCAGGGGACAGG + Intergenic
1117942670 14:60985169-60985191 ACTAGCAGGCAGATGGGGGCAGG - Intronic
1118174378 14:63423337-63423359 TTTGGGAGGCTGAAGTGGGCAGG - Intronic
1118584440 14:67339500-67339522 AATGGGAGGTAGGTGAGGGCAGG - Intronic
1119002328 14:70893899-70893921 TATGGGAGGCCGAGGTGGGCGGG - Intergenic
1119280690 14:73404999-73405021 TTTGGGAGGCAGAGGCGGGCAGG - Intronic
1119360316 14:74043773-74043795 TTTGGGAGGCCGAAGCGGGCAGG - Intronic
1119475072 14:74922532-74922554 GATGGGGGGTAGAAGAGGGCAGG + Intronic
1119609482 14:76049692-76049714 ACTGGGAGAAAGAAGGGGGTTGG - Intronic
1119732732 14:76961466-76961488 TTTGGGAGGCTGAAGTGGGCAGG - Intergenic
1119749448 14:77067083-77067105 CATGGGAAGCAGAAGAGGGCTGG - Intergenic
1119757873 14:77131550-77131572 AATGGGAGGGAGAGGGAGGAGGG - Exonic
1119913314 14:78371372-78371394 AAGGGGAGGTGGAAGGGGGATGG - Intronic
1120280463 14:82431747-82431769 ATGGGAAGGCAGAAGGGGGATGG + Intergenic
1120625966 14:86827030-86827052 AGAGGAAGGCAGAAGAGGGCAGG + Intergenic
1121015500 14:90546495-90546517 GCTGGGAGGCAGGAGGGGGCTGG - Intronic
1121159788 14:91726844-91726866 AAAGGGAGGGAGAAGTGGGAGGG - Intronic
1122227336 14:100287365-100287387 AAGGGCAGAGAGAAGGGGGCAGG - Intergenic
1122272119 14:100573059-100573081 GATGGGAGGCAGGGTGGGGCAGG + Intronic
1123049627 14:105534734-105534756 AGAGGGAGGCAGACGGGGGCAGG + Intergenic
1123996363 15:25720617-25720639 AGAGGGAGGCCGAAGGAGGCTGG + Intronic
1124045803 15:26148815-26148837 CATGGGAAGCAGAAGAGGGAAGG - Intergenic
1124639932 15:31391266-31391288 TGTGGGGGGCTGAAGGGGGCTGG + Intronic
1124647021 15:31444456-31444478 TTTGGGAGGCCGAAGAGGGCGGG + Intergenic
1124788800 15:32707262-32707284 CTTGGGAGGCTGAAGTGGGCGGG + Intergenic
1124840239 15:33234708-33234730 ACTGTGAGGCAGAAGTGGACAGG + Intergenic
1124942236 15:34228928-34228950 TTTGGGAGGCAGAGGTGGGCAGG - Intronic
1124943308 15:34238784-34238806 AATGTGAAGCTGAAGGGGGTAGG + Intronic
1125021552 15:34991488-34991510 CATGGGAGACAGTAGGAGGCAGG + Intergenic
1125147705 15:36491430-36491452 AGAGGGAGAGAGAAGGGGGCAGG + Intergenic
1125480617 15:40077153-40077175 GAGGGGTGGCGGAAGGGGGCGGG + Intergenic
1125697496 15:41651654-41651676 AATGGGGAGGAGAAGGGGGAAGG - Intronic
1125751992 15:42035527-42035549 AAAGGCAGGCAGGATGGGGCAGG + Intronic
1126165891 15:45653572-45653594 CTTGGGAGGGAGAATGGGGCTGG - Intronic
1126720053 15:51568988-51569010 CATGGGAAGCACAAGGGGTCAGG + Intronic
1126799791 15:52288579-52288601 AATGTGAGGGAGGAGGGGACAGG - Intronic
1127069751 15:55277398-55277420 TTTGGGAGGCAGAGGCGGGCAGG + Intronic
1127117008 15:55738840-55738862 AATGGTAGGCAGAGGAGGGGAGG + Intronic
1127346427 15:58105318-58105340 TTTGGGAGGCTGAAGGGGGGTGG - Intronic
1127531494 15:59847554-59847576 TTTGGGAGGCAGATGAGGGCAGG + Intergenic
1127734380 15:61828066-61828088 AATGGGAGGCCGGATGTGGCTGG - Intergenic
1127797708 15:62452792-62452814 AAGGACAGGCAGAAGGGAGCAGG - Intronic
1128137263 15:65273035-65273057 TTTGGGAGGCTGAGGGGGGCGGG + Intronic
1128269022 15:66293046-66293068 GATGGGAGGGTGAGGGGGGCAGG - Intergenic
1128412607 15:67414433-67414455 AAGGGGAGGCAGAGGAGGGCAGG + Intronic
1128878028 15:71218012-71218034 TTTGGGAGGCCGAAGCGGGCAGG - Intronic
1128940517 15:71784336-71784358 TTTGGGAGGCTGACGGGGGCGGG - Intergenic
1129084011 15:73069059-73069081 CTTGGGAGGCTGAAGGGGGGAGG - Intronic
1129188813 15:73926206-73926228 TCTGGCAGGCAGAACGGGGCTGG - Intronic
1129194463 15:73955804-73955826 AATGGGAGGTAGAAGGAGGCTGG + Intergenic
1129379551 15:75156480-75156502 ACTGGGAGGAAGCAGGGAGCTGG + Intergenic
1129674235 15:77623666-77623688 AAGGGGAGGCAGGTGGGGGCGGG - Intronic
1130073751 15:80671052-80671074 ATGGGGAGCCAGAAGGGGGATGG - Intergenic
1130430439 15:83842031-83842053 ATGGGGAGGCAGAAGGGGGATGG - Intronic
1130430447 15:83842050-83842072 ATGGGAAGGCAGAAGGGGGATGG - Intronic
1130430479 15:83842219-83842241 ATGAGGAGGCAGAAGGGGGATGG + Intronic
1130521021 15:84660592-84660614 AATGGGAGGCACAGGGGAGAAGG + Intergenic
1131014142 15:89043472-89043494 AAGGAGAGGAAGAAGGGGGAGGG + Intergenic
1131145043 15:90005358-90005380 CAGGTGAGGCAGGAGGGGGCTGG + Intronic
1131232245 15:90667714-90667736 TTTGGGAGGCTGAAGGGGGTGGG + Intergenic
1131260265 15:90884292-90884314 AACGGAAGGGAGGAGGGGGCCGG - Intronic
1132161682 15:99548686-99548708 AAAGGGAGGGAGAGTGGGGCTGG + Intergenic
1132185338 15:99798349-99798371 AAGGGGAGGAAGAAGGAGGGAGG + Intergenic
1132190098 15:99847170-99847192 TTTGGGAGGCCGAAGGGGGGCGG + Intergenic
1132298036 15:100758398-100758420 TTTGGGAGGCTGAAGCGGGCAGG - Intergenic
1132461368 16:56759-56781 AATGGCAGGCAGAGGGCAGCTGG + Intronic
1132700112 16:1218695-1218717 ACAGGGAGGAAGATGGGGGCAGG + Intronic
1132926369 16:2431433-2431455 TTTGGGAGGCCGAAGGGGGGTGG + Intronic
1132931175 16:2459963-2459985 CCTGGGAGGCAGGAGTGGGCGGG + Intergenic
1133214526 16:4283547-4283569 AAGGGTAGGAAGAAGGGGCCAGG - Intergenic
1133497679 16:6335234-6335256 AATGGGAGGCAAAAGTGAGTAGG + Intronic
1133903981 16:10004037-10004059 AAAGGGAATCAAAAGGGGGCTGG + Intronic
1134115690 16:11546353-11546375 TTTGGGAGGCCGAAGTGGGCAGG + Intergenic
1134124866 16:11609764-11609786 AGTGTGAGGGAGAAGTGGGCAGG - Intronic
1134168310 16:11948082-11948104 AAAGGGAGGCAGAGTGGGGGTGG + Intronic
1134583930 16:15395318-15395340 TATGGGAGGCCGAGGCGGGCAGG + Intergenic
1134770605 16:16806050-16806072 AAGGGGAAGGAGAAGGGGGAAGG - Intergenic
1134817567 16:17218671-17218693 ATTTGGAGGGAGATGGGGGCCGG - Intronic
1135948866 16:26893153-26893175 AATGACAAGCAGGAGGGGGCTGG - Intergenic
1137486991 16:48899758-48899780 CCTGGGAGGCAGAAGAGAGCAGG - Intergenic
1137544656 16:49393186-49393208 AATGGGAGGGAGATGTGGGTTGG - Intronic
1137765120 16:50972087-50972109 AAGGGGAGGCAGATGGGAGCTGG + Intergenic
1137908446 16:52350916-52350938 AAGGGAAGGCAGAATGGGGAGGG - Intergenic
1138309608 16:56012034-56012056 AATGGGAGGCAGATGGGACCTGG - Intergenic
1138505970 16:57478433-57478455 AATGGGAGAGAGAAGGGAGAAGG + Intronic
1138513969 16:57525872-57525894 CGTGGGAGGCGGGAGGGGGCAGG - Intronic
1138526211 16:57608847-57608869 AATGAGAGCAGGAAGGGGGCAGG - Intergenic
1138626980 16:58260229-58260251 CATGAGAGGGAGAAGGGGTCAGG + Intronic
1138706935 16:58924788-58924810 TTGGGGAGGCAGAAGTGGGCTGG - Intergenic
1139284455 16:65798071-65798093 ATGGGGAGCCAGAAGGGGGATGG - Intergenic
1139524358 16:67504820-67504842 ACTGAGAGAGAGAAGGGGGCTGG - Intergenic
1139814894 16:69661192-69661214 AATGGGAGACAGAAGGAAACAGG - Intronic
1139952139 16:70677647-70677669 AGTGGGTGTCAGAAGGGGTCTGG + Intronic
1140010484 16:71126635-71126657 CATGGCAGTCAGGAGGGGGCTGG + Intronic
1140018683 16:71215257-71215279 AAAGGGAGGAAGGAGGGGGAAGG + Intronic
1140111444 16:72008724-72008746 AATGGAAGGGAGACAGGGGCGGG + Exonic
1140196797 16:72861770-72861792 TTTGGGAGGCAGAGGCGGGCGGG + Intronic
1140284839 16:73592349-73592371 TATGGGAGAGAGAAGGGGGTGGG + Intergenic
1140340160 16:74150560-74150582 AAAGGGAGGTAGATGTGGGCAGG - Intergenic
1140732456 16:77869126-77869148 AATGAGTAGCAGAAGGGGGAAGG + Intronic
1141174149 16:81708202-81708224 TATGGGACACAGAAGGTGGCAGG + Intronic
1141651246 16:85394201-85394223 GGTGGGAGGCAGCCGGGGGCCGG + Intergenic
1141666536 16:85468562-85468584 TTTGGGAGGCTGAGGGGGGCTGG - Intergenic
1141982741 16:87560457-87560479 ATGGGGAGTGAGAAGGGGGCAGG + Intergenic
1142034554 16:87855269-87855291 ATGGGGAGGCACAAGGGGGTGGG - Intronic
1142109500 16:88323683-88323705 ACTGAGTGGCAGAAGTGGGCAGG + Intergenic
1142207804 16:88792256-88792278 CATGGCAGGCGGCAGGGGGCCGG - Intergenic
1142718449 17:1760933-1760955 TTTGGGAGGCTGAGGGGGGCGGG + Intergenic
1142957174 17:3529981-3530003 AAGGGCAGGGAGAAGAGGGCTGG - Intronic
1142968618 17:3596424-3596446 AAAGGGAGGCAGTAGGCTGCGGG + Intronic
1142998329 17:3774519-3774541 TTTGGGAGGCCGAAGTGGGCAGG + Intronic
1143659928 17:8318513-8318535 AATGGTAGGGAGCAGGGGGCTGG + Intronic
1143663045 17:8339064-8339086 AAAGGGAGGCAGAAGCTGGAGGG + Intergenic
1143714756 17:8758826-8758848 AATGGGAAGGAGAAGCGGGGAGG - Intergenic
1143988410 17:10935514-10935536 ACTGGGAGGCTGGAGGGGTCAGG + Intergenic
1144320844 17:14117926-14117948 ATGGGGAGCCAGAAGGGGGATGG + Intronic
1144363642 17:14520912-14520934 AATGGAGGGCAGAAGGTGGGAGG - Intergenic
1144553873 17:16264867-16264889 TTTGGGAGGCAGAGGAGGGCGGG - Intronic
1144557080 17:16291621-16291643 TTTGGGAGGCAGAGGAGGGCGGG + Intronic
1144969146 17:19096212-19096234 AGTGGGAGGCAGAAGCGGCGGGG + Intronic
1144978770 17:19155854-19155876 AGTGGGAGGCAGAAGCGGCGGGG - Intronic
1144989452 17:19222378-19222400 AGTGGGAGGCAGAAGCGGCGGGG + Intronic
1145217938 17:21066256-21066278 AATGCCTGGCAGAAGGGGGCTGG - Intergenic
1145891642 17:28420504-28420526 CCTGGGAGGCAGCAGAGGGCAGG - Intergenic
1146176309 17:30668205-30668227 AGAGGGAGGGAGGAGGGGGCTGG + Intergenic
1146299417 17:31676607-31676629 AATGGGAGGAAGGAGGGAGGAGG + Intergenic
1146456133 17:33011198-33011220 TTTGGGAGGCTGAAGTGGGCAGG + Intergenic
1146471479 17:33128435-33128457 ACTGGGAAGCAGAATGGGGATGG + Intronic
1146645520 17:34574566-34574588 AATAGAAGGGAGAAGGGGGAAGG + Exonic
1146722535 17:35133244-35133266 AAAGGGAGGCAGAGGAAGGCAGG + Intronic
1146905184 17:36613520-36613542 AAGGGGAGGCAGAGGGGTTCTGG - Intergenic
1146946757 17:36878525-36878547 AATGGTAGCCAAAAGGGTGCTGG - Intergenic
1147298515 17:39504634-39504656 TTTGGGAGGCTGAAGTGGGCAGG + Intronic
1147476163 17:40713470-40713492 AATGGGAGGGAGAAGGGGCAGGG - Intergenic
1147678046 17:42220694-42220716 AAAGGGAGGCCGAAGGGAGGCGG + Intronic
1147688000 17:42298878-42298900 AAAGGGAGGCCGAAGGGAGGCGG - Intronic
1148049119 17:44760476-44760498 TCTGGGAGGCAGGAGGGGCCTGG - Intronic
1148353165 17:46956075-46956097 AGTGGGAGGAAGAAGGTAGCCGG + Intronic
1148773035 17:50077878-50077900 AAAGGGAGGCAGAGGTGGGGTGG + Intronic
1148925568 17:51081883-51081905 AATGGGAAGGAGAAGAGGGTAGG - Intronic
1149303983 17:55331143-55331165 AACAGGAAGCAGAAGTGGGCAGG - Intergenic
1149323932 17:55510486-55510508 CATGGGAGGCTGAAGTGGGAAGG + Intergenic
1149548657 17:57523288-57523310 TTTGGGAGGCAGAGGTGGGCAGG - Intronic
1149591795 17:57835420-57835442 AATGGGATGGAGGAGTGGGCAGG - Exonic
1149710324 17:58735944-58735966 TTTGGGAGGCAGAGGTGGGCGGG - Intergenic
1150880886 17:69026425-69026447 AATGGGAAGCTGAAGTGTGCAGG - Exonic
1150888211 17:69112231-69112253 AATGGGAGACTGAAGTGTGCAGG - Exonic
1150999025 17:70352137-70352159 ATGGGGAGCCAGAAGGGGGATGG - Intergenic
1151016282 17:70557435-70557457 TTTGGGAGGCTGAAGTGGGCAGG - Intergenic
1151610273 17:75169294-75169316 TTTGGGAGGCTGAAGTGGGCGGG + Intergenic
1152160532 17:78665787-78665809 AATGGGTGTTAGAAGAGGGCTGG + Intergenic
1152379804 17:79936561-79936583 AATCGCAGGCAGCAGGGGCCAGG + Exonic
1152494611 17:80662217-80662239 GATAGGAGGCAGAAGGCGGCTGG - Intronic
1152759867 17:82102160-82102182 AATGGGTCCCAGGAGGGGGCAGG + Intronic
1152759880 17:82102196-82102218 AATGGGTCCCAGGAGGGGGCAGG + Intronic
1153220384 18:2855587-2855609 AAGGGGAGGCAGGTGGGGCCAGG + Intronic
1153351367 18:4084042-4084064 GATGGGAGCCAGAAGCGGGATGG + Intronic
1153773756 18:8435286-8435308 GATGGGAGCCAGAAGGGAGATGG - Intergenic
1154210832 18:12377329-12377351 AATGGGAGGAGCATGGGGGCGGG + Intergenic
1155010894 18:21776739-21776761 TTTGGGAGGCTGAAGTGGGCAGG + Intronic
1155096031 18:22557448-22557470 AATTGGGGGCAGGAGGGGGATGG + Intergenic
1155576572 18:27254426-27254448 AAAGGGAGGCAGGAGTGTGCAGG + Intergenic
1155621666 18:27786596-27786618 AATGGGATCCAGAAGGGTGGAGG + Intergenic
1156160317 18:34350997-34351019 AATGGGAGGTTGAGGGTGGCTGG + Intergenic
1157002369 18:43542317-43542339 GATGGGAGCCAGAAAGGGGATGG + Intergenic
1157577624 18:48754260-48754282 AATGGGAGACAGATGGGAGGTGG + Intronic
1157688747 18:49664064-49664086 AATGGGAGGAAGCAGTGGGGCGG - Intergenic
1158423107 18:57313436-57313458 AAGGGGAGGGGGAAGGGGGAAGG + Intergenic
1158564017 18:58538939-58538961 GATGGGAGGCAGAGGGGAGCTGG - Intronic
1159417604 18:68173259-68173281 ATGGGGAGCCAGAAGGGGGATGG + Intergenic
1159610037 18:70514558-70514580 AATGGAAGCCAGATTGGGGCAGG - Intergenic
1159666066 18:71162035-71162057 AATTCTAGGCAGAAGAGGGCAGG + Intergenic
1160430031 18:78804659-78804681 AGAGGGAGGCTGCAGGGGGCTGG + Intergenic
1160495152 18:79369154-79369176 ATTGGGAGGCCGAGGCGGGCGGG + Intronic
1160498592 18:79389930-79389952 AGGGGGAGGCAGAGGGAGGCAGG + Intergenic
1160664452 19:317959-317981 ATTGGGAGGCCGAAGTGGGCAGG + Intronic
1160897151 19:1408181-1408203 AATGGGAGCCAGAGGGGTTCAGG + Intronic
1160993390 19:1870751-1870773 TTTGGGAGGCAGAGGCGGGCAGG + Intergenic
1161030755 19:2056763-2056785 GAGGGGAGGAAGAAGGGGGGAGG - Intergenic
1161187277 19:2929667-2929689 TTTGGGAGGCCGAAGTGGGCGGG + Intergenic
1161539360 19:4840493-4840515 TTTGGGAGGCTGAAGTGGGCAGG - Intronic
1161638568 19:5405204-5405226 GATGGGAGGCAGAGGCGGACTGG - Intergenic
1161793649 19:6374706-6374728 TGTGGGAGGCAGCAGGGGGCTGG + Intronic
1162022467 19:7874106-7874128 CAGGGGAGGCCGATGGGGGCTGG - Intronic
1162248878 19:9425897-9425919 ACTGAGAGGCAGAAGGGGTAAGG + Intronic
1162291791 19:9785886-9785908 GGAGGGAGGCAGACGGGGGCGGG - Intronic
1162359577 19:10210460-10210482 CCTGGCAGGCAGAAGGAGGCTGG - Intronic
1162873217 19:13601292-13601314 TTTGGGAGGCAGAGGCGGGCCGG - Intronic
1162982515 19:14248690-14248712 AGAGGGAGGGAGGAGGGGGCTGG - Intergenic
1162993608 19:14319408-14319430 AATGGGGGCAGGAAGGGGGCAGG + Intergenic
1163079453 19:14926755-14926777 TTTGGGAGGCAGAGGTGGGCGGG - Intergenic
1163235388 19:16026797-16026819 ACTGGAAGGAAGAAGGGAGCAGG - Intergenic
1163370898 19:16900713-16900735 AAGGGGAGGAAAAAAGGGGCTGG + Intronic
1163376923 19:16938744-16938766 GATGGGAGGAAGAGGGTGGCTGG - Intronic
1163531845 19:17854606-17854628 TTTGGGAGGCTGAAGCGGGCAGG - Intergenic
1163592252 19:18200690-18200712 TATGGGAGGCTGAGGTGGGCAGG + Intronic
1163656294 19:18547131-18547153 AATGGGAGGCTGAGGTGGGAGGG + Intergenic
1163791368 19:19308275-19308297 TTTGGGAGGCCGAAGGGGACAGG - Intronic
1164604028 19:29583128-29583150 AATGGGATGAAGGAGGGGGCCGG - Intergenic
1164684529 19:30158134-30158156 AATGGGGGGCAGCAGGGGTAAGG + Intergenic
1164719977 19:30424898-30424920 GGTGGGAAGCAGAAGGTGGCAGG - Intronic
1165087986 19:33364615-33364637 AAGGGGCTGGAGAAGGGGGCAGG - Intergenic
1165942576 19:39422629-39422651 TTTGGGAGGCTGAAGTGGGCGGG - Intronic
1166105624 19:40596883-40596905 AATGGGAGGGATACGGGAGCGGG - Intronic
1166308269 19:41947602-41947624 TTTGGGAGGCCGAGGGGGGCAGG + Intergenic
1166719293 19:44988227-44988249 GAGGGGAGGAGGAAGGGGGCAGG - Intronic
1166803983 19:45474003-45474025 GAGGGGAGGAAGAAGGGGGATGG - Exonic
1167216697 19:48170195-48170217 GATGGGAGGCGGAGGGCGGCGGG - Intronic
1167250765 19:48397305-48397327 AATGAGAGGGAAAAGGGGTCAGG - Intronic
1167427507 19:49437008-49437030 AATGTGAAGAAGGAGGGGGCTGG - Intronic
1167483724 19:49748024-49748046 AATGGGAGTAAGAAGAGGGTGGG - Intronic
1167505648 19:49869798-49869820 AATGGGAGACGCAAGGAGGCCGG + Exonic
1167579069 19:50331484-50331506 AAGGGGAAGAAGAAGGGGGAGGG - Intronic
1167622544 19:50567772-50567794 AATGGGAGGCAGAAGCCGGTGGG - Intronic
1167636083 19:50656566-50656588 AAGGGGAGGCTGAGGGGGGCAGG + Intronic
1167849937 19:52193796-52193818 TTTGGGAGGCAGAGGCGGGCAGG - Intronic
1167913964 19:52725372-52725394 CAGGGGAGGCCGACGGGGGCTGG + Intronic
1167986799 19:53325247-53325269 CATGGATGGCAGAAGGGGGATGG - Intergenic
1168150730 19:54446598-54446620 TTTGGGAGGCAGAGGCGGGCGGG + Intergenic
1168276788 19:55283384-55283406 AATGGGTGGCCTTAGGGGGCTGG + Intronic
1168291956 19:55361445-55361467 AGAGGGAGGCAGGAGGGGCCCGG + Intronic
1202712954 1_KI270714v1_random:27504-27526 TCTGGGAGGCAGAGGGGGCCGGG - Intergenic
924982297 2:235328-235350 AATGAGAGGCAGCATGGGTCAGG + Intronic
925434772 2:3827294-3827316 AAGGGGAGGCAGCAGGGGCAGGG + Intronic
925589225 2:5493498-5493520 CAAGTGAGGGAGAAGGGGGCCGG - Intergenic
925591748 2:5516811-5516833 AATGGGAGTCTGAAGTGGGAGGG + Intergenic
925755508 2:7128299-7128321 AAGGGGAGGGGGAAGGGGGGAGG - Intergenic
926045139 2:9704580-9704602 AATGGCAGGATGTAGGGGGCAGG - Intergenic
926126709 2:10276742-10276764 AAGGGGAGGCACAGGGTGGCGGG - Intergenic
927511020 2:23643630-23643652 ACTGGAAGGCAGAAGGGGACAGG + Intronic
927705637 2:25294879-25294901 AATGGGAGGGAGGAGGAGGAGGG - Intronic
928017827 2:27674945-27674967 TTTGGGAGGCTGAAGGGGGATGG - Intronic
928158232 2:28895383-28895405 AAGGGGGGGCAGGAGGGGGAAGG - Intronic
929006093 2:37394261-37394283 AATGGGAGGGAGCAGAGGGGTGG - Intergenic
929811582 2:45193368-45193390 AAAGGAAGGCAGAAGGAAGCAGG + Intergenic
929847436 2:45544449-45544471 AATCAGAGGCAGTAGGTGGCAGG + Intronic
929906926 2:46054660-46054682 AATTCGGGGCAGAAGAGGGCAGG + Intronic
929998948 2:46847985-46848007 AGTGGCAGGCAGAAGGGAGCAGG - Intronic
930179389 2:48337546-48337568 TTTGGGAGGCAGAGGTGGGCGGG - Intronic
930556787 2:52906260-52906282 AAGGGGAAGTAGAAGGAGGCTGG - Intergenic
930569273 2:53064553-53064575 TTTGGGAGGCAGAGGTGGGCGGG + Intergenic
930717799 2:54609076-54609098 AAGGGGAGGCAGAAGAGGCAGGG + Intronic
931538588 2:63304463-63304485 CATGGGAAGCACAAGGGGTCGGG + Intronic
931590220 2:63874843-63874865 AGTGGAAGGCAGAGGGGAGCTGG - Intronic
931957258 2:67441145-67441167 AATGGGAGACAGAACAGTGCAGG - Intergenic
932187704 2:69713122-69713144 AATAGGAGGCAGCAGGGTGGTGG - Intronic
932254735 2:70274804-70274826 TTTGGGAGGCAGAGGTGGGCAGG - Intronic
932728250 2:74198543-74198565 AATGGGTGGCGGAGGGAGGCGGG + Exonic
932731777 2:74226857-74226879 ACAGGAAGGCAGAAGGTGGCAGG + Intronic
934557419 2:95294811-95294833 AAGGGGAGGAGAAAGGGGGCTGG - Intergenic
934577299 2:95411041-95411063 AATGGTAGGTATAAGGGGGCAGG - Intronic
934639594 2:96019715-96019737 AATGGTAGGTACAAGGGGGCAGG - Intergenic
934794053 2:97085662-97085684 AATGGTAGGTACCAGGGGGCAGG + Intronic
934983809 2:98869677-98869699 AAGGCGAGGCAGGAGGGGCCGGG - Intronic
935133904 2:100281805-100281827 GAAAAGAGGCAGAAGGGGGCAGG + Exonic
935138819 2:100333142-100333164 ATGGGGAGCCAGAAGGGGGATGG - Intergenic
935363621 2:102267943-102267965 AATGCCAGGCAGAGTGGGGCTGG - Intergenic
935727044 2:106032506-106032528 TTTGGGAGGCAGAGGGGGGGTGG + Intergenic
936384837 2:112020165-112020187 GCTGGGAGGCGGGAGGGGGCAGG - Intronic
936907717 2:117556363-117556385 GAGGGGATGCAGATGGGGGCAGG - Intergenic
937277764 2:120696415-120696437 AATGGGAGGAAGCAAGGGGGTGG - Intergenic
937508898 2:122570722-122570744 ATGGGGAGCCAGAAGGGGGATGG + Intergenic
938219640 2:129554480-129554502 AATGGGAGGAAGAAGAGGCAGGG - Intergenic
938322068 2:130372345-130372367 AGTGGGACGCAGACGGGGACGGG + Exonic
938380924 2:130836321-130836343 AGTGGGAGGCAAGAGGGAGCTGG + Intergenic
938467391 2:131532647-131532669 CAGGGCAGGCAGATGGGGGCGGG + Exonic
938897401 2:135765817-135765839 CTTGGGTGCCAGAAGGGGGCAGG - Intronic
939822718 2:146977131-146977153 TTTGGGAGGCCAAAGGGGGCGGG - Intergenic
939864401 2:147456652-147456674 AATTGGAGTCAGAATGTGGCTGG - Intergenic
940134932 2:150425255-150425277 AACCGGAGGCAGGAGGGGCCAGG + Intergenic
940359019 2:152777265-152777287 TTTGGGAGGCTGAGGGGGGCAGG - Intergenic
940781023 2:157933726-157933748 AAGGGAAGGCAGAATGGGGCTGG + Intronic
940896085 2:159082689-159082711 ACTAGGAGACAGAAGGGGGCAGG + Intronic
941096064 2:161239688-161239710 ACTGTGGGGCAGATGGGGGCAGG + Intergenic
941175711 2:162195332-162195354 AAAGGGAGGAAGAATAGGGCAGG + Intronic
941545555 2:166846232-166846254 AATGGGAGGTAGAAGGTAGAAGG + Intergenic
941788506 2:169524638-169524660 TTTGGGAGGCCGAGGGGGGCAGG - Intronic
942690990 2:178584940-178584962 AAATGGAGGCTGAGGGGGGCCGG + Exonic
943208145 2:184927703-184927725 AATGGGAGGCATAAATGGGAAGG - Intronic
944070687 2:195665079-195665101 TTTGGGAGGCTGAGGGGGGCTGG + Intronic
944129108 2:196326682-196326704 TTTGGGAGGCAGAGGTGGGCAGG - Intronic
944586640 2:201178869-201178891 AATGGGAGGCAGAAGGGGGCAGG + Intergenic
944845483 2:203663955-203663977 TTGGGGAGGCTGAAGGGGGCAGG - Intergenic
945024616 2:205608012-205608034 AATGGGAGGGGAAAGGGGTCAGG + Intronic
945037910 2:205720024-205720046 AAAAGGAGGCAGAAGCTGGCTGG - Intronic
945176268 2:207046801-207046823 AATGGGAGGCACCAAAGGGCAGG + Intergenic
945444030 2:209914566-209914588 GCTGGGAGGGGGAAGGGGGCTGG - Intronic
945481491 2:210350820-210350842 CATGGGAAGCACAAGGGGTCAGG + Intergenic
946016309 2:216606822-216606844 AAGGGGGGCCAGGAGGGGGCCGG - Intergenic
946330292 2:219005266-219005288 TTTGGGAGGCAGCAGTGGGCGGG - Intronic
946458047 2:219845118-219845140 AATAGGAGGAAGAAAGAGGCTGG - Intergenic
946602755 2:221370211-221370233 ATTGGGAGGCTGAAGTGGGAGGG + Intergenic
946737759 2:222771749-222771771 TCTGGGAGGCAGAGGCGGGCTGG - Intergenic
946762362 2:223007219-223007241 AAAAGGAGGCAGAAGGGTGCTGG - Intergenic
947162251 2:227226341-227226363 AAGGGGAGGCACATGGGGGTAGG + Intronic
947178512 2:227391364-227391386 TTTGGGAGGCCGAAGGGGGCGGG + Intergenic
947647618 2:231755481-231755503 TTTGGGAGGCAGAGGTGGGCGGG + Intronic
948586107 2:239020764-239020786 AGAGGGAGGCAGGAGGGGGACGG - Intergenic
948687672 2:239679220-239679242 AATGGGAGTGAGGAGGAGGCCGG - Intergenic
948870275 2:240794359-240794381 CATGGGAGACAGCAGGGTGCGGG - Intronic
948889422 2:240899782-240899804 AAGGGGAGGCCGCAGGGGCCGGG - Intergenic
948911729 2:241008344-241008366 AATAGGAGGCAGGAGGAGACTGG - Intronic
949049243 2:241888417-241888439 GATGGGAGGAAGCAGGCGGCGGG - Intergenic
949049278 2:241888531-241888553 AATGGGAGGAAGCAGGTGGGGGG - Intergenic
949049327 2:241888682-241888704 AATGGGAGGAAGCAGGTGGGGGG - Intergenic
1168949050 20:1783968-1783990 ACTTGGAGGCAGCAGTGGGCTGG + Intergenic
1169099514 20:2934344-2934366 TTTGGGAGGCCGAAGTGGGCAGG - Intronic
1169178619 20:3542548-3542570 AAGGGGAGGTGGAAGGGGGAAGG - Intronic
1169192116 20:3664729-3664751 TTTGGGAGGCAGAGGTGGGCGGG - Intergenic
1169196713 20:3687099-3687121 GCTGGGAGGCAGTTGGGGGCGGG - Exonic
1169201112 20:3710675-3710697 AATGGGAGGAACAGGGGAGCTGG - Intergenic
1169291746 20:4359003-4359025 AGTGGGAGCCAGAAGGGGAGAGG + Intergenic
1169440128 20:5626927-5626949 AAGGGGAGCCAGAAGGGGGATGG - Intergenic
1169622866 20:7527472-7527494 AACCTGAGGCACAAGGGGGCAGG - Intergenic
1169829311 20:9806229-9806251 TTTGGGAGGCAGAGGCGGGCAGG - Intronic
1169841669 20:9944540-9944562 AATGGGAGCAAGAGGGGGGCAGG + Intergenic
1170823238 20:19771865-19771887 AAGAGGAGGCAGGAGGAGGCAGG - Intergenic
1171204107 20:23265996-23266018 TTTGGGAGGCTGAGGGGGGCGGG - Intergenic
1171502396 20:25603864-25603886 AATGGGAGGCAGGTTGGGGCTGG + Intergenic
1172088430 20:32408173-32408195 TTTGGGAGGCTGAAGCGGGCAGG - Intronic
1172190831 20:33060996-33061018 AGTGGGAGGCAGCTGTGGGCTGG - Intronic
1172292131 20:33784114-33784136 AAGAGGAGGGAGAAGGGTGCTGG - Intronic
1172451807 20:35031112-35031134 AATGGAAGGCAGAAGGCAGTAGG - Intronic
1172457112 20:35086034-35086056 GCTGGGAGGGGGAAGGGGGCAGG - Intronic
1172665170 20:36594097-36594119 AATGGGATACAGAATGGAGCTGG - Intronic
1172841483 20:37904855-37904877 ATGGTGAGGCAGAAGGGGGCGGG - Intronic
1173002048 20:39111647-39111669 AAGGGGAGGAGGAAGGGGGAGGG + Intergenic
1173102898 20:40104196-40104218 AATGGAAGGAAGAAGGAGGTGGG - Intergenic
1173144553 20:40513519-40513541 ATGGGGAGGCAGAGTGGGGCTGG - Intergenic
1173520783 20:43698828-43698850 AAAGGGAGGGGGGAGGGGGCTGG - Intronic
1173805577 20:45922773-45922795 AAGGTGAGGTAGAAGGGGCCTGG - Intergenic
1173815593 20:45985736-45985758 AATGGAAGGCAGGAGGAGGCAGG + Intergenic
1173899286 20:46575516-46575538 AGTGGGAGGCAGGTGTGGGCGGG - Intronic
1174062336 20:47841677-47841699 TTTGGGAGGCAGAGGTGGGCAGG - Intergenic
1174184975 20:48699962-48699984 AATGGATGGTAGAAGGAGGCAGG - Intronic
1174253525 20:49236953-49236975 TTTGGGAGGCAGAAGGTGGGTGG - Intronic
1174828340 20:53789852-53789874 AATGGGAAGAAGAAAGAGGCAGG - Intergenic
1175296705 20:57913612-57913634 AATGAGAGACAGGAGGGGACAGG + Intergenic
1175298803 20:57928500-57928522 AAAGGGAGGAGGAAGGGGGAAGG - Intergenic
1175605906 20:60312011-60312033 AAGGGGAGGCAGCAGGAGGCAGG + Intergenic
1175674054 20:60931761-60931783 AATGGGGACGAGAAGGGGGCAGG - Intergenic
1175691354 20:61068084-61068106 AAAGGGAGGCTGTAGAGGGCAGG - Intergenic
1175816903 20:61887894-61887916 GATGGGTGGCCGAGGGGGGCCGG + Intronic
1175998074 20:62820211-62820233 CATGGCAGGGAGAAGGGGGATGG + Intronic
1176139418 20:63538409-63538431 ACTGGCAGCCACAAGGGGGCAGG + Intergenic
1176214416 20:63941502-63941524 AAGAGGAAGCAGAAGTGGGCCGG + Intronic
1176239173 20:64067995-64068017 AAGGGGAGGCAGAGGAGGGAGGG - Intronic
1176385508 21:6137080-6137102 AGGAGGAGGCAGAAGTGGGCAGG - Intergenic
1177232227 21:18337134-18337156 TTTGGGAGGCTGAGGGGGGCAGG - Intronic
1177751403 21:25288737-25288759 AGAGGTGGGCAGAAGGGGGCAGG + Intergenic
1177866081 21:26514450-26514472 AGTGGAAGGCAGAAGGGAGCTGG - Intronic
1177930621 21:27278580-27278602 TTTGGGAGGCTGAAGTGGGCGGG - Intergenic
1178422361 21:32452707-32452729 ATGGGGAGCCAGAAGGGGGATGG + Intronic
1179095916 21:38314340-38314362 ATGGGGAGTCAGAAGGGGGATGG - Intergenic
1179603323 21:42495879-42495901 AATGGGAGGCAGGATGGGGGTGG + Intronic
1179737965 21:43401172-43401194 AGGAGGAGGCAGAAGTGGGCAGG + Intergenic
1179891063 21:44335339-44335361 ACTGGGGGGCAGAAGAGGCCAGG + Intronic
1180256978 21:46636152-46636174 AAGGGGGGTGAGAAGGGGGCAGG - Exonic
1180356305 22:11844154-11844176 TTTGGGAGGCAGAGGCGGGCAGG + Intergenic
1180381953 22:12148173-12148195 TTTGGGAGGCAGAGGCGGGCAGG - Intergenic
1180669690 22:17543374-17543396 TTTGGGAGGCCGACGGGGGCAGG - Intronic
1180720395 22:17903611-17903633 AATGGGACTCAGAAGGGTGGTGG - Intronic
1180994796 22:19960041-19960063 AGTGGGAGGCAGCAGAGGGGAGG - Intronic
1181085792 22:20438755-20438777 ACTGGGAGGCAGCAGGGTGCGGG + Intronic
1181471526 22:23143181-23143203 TTTGGGAGGCTGAAGGGGGAGGG + Intronic
1182689465 22:32148147-32148169 TTTGGGAGGCAGAGGCGGGCAGG - Intergenic
1183511690 22:38239164-38239186 AGGGGCAGGCAGATGGGGGCAGG - Intronic
1183743884 22:39682465-39682487 AAAGGGAGGTAGGATGGGGCAGG - Intronic
1183985136 22:41565633-41565655 AAAAGGATGCAGAATGGGGCAGG - Intronic
1184408587 22:44313786-44313808 GGTGGGAGGCAGAGGAGGGCTGG - Intergenic
1184412420 22:44332677-44332699 AATGGGGGGCAGACTGGAGCTGG - Intergenic
1184519109 22:44981988-44982010 AACGGGAGGCAGCCGAGGGCTGG - Intronic
1184605046 22:45567947-45567969 AGTGGGAGGGAGGAAGGGGCTGG + Intronic
1184678202 22:46054582-46054604 GGTGGGAGGCAGAAGGGGCCTGG + Intronic
1184704624 22:46202145-46202167 CAGAGGAGGCAGGAGGGGGCTGG - Intronic
1184733020 22:46381378-46381400 AATGGCAGGAAGAAGGAGGGCGG + Intronic
1184737793 22:46409442-46409464 GACAGGAGGCAGACGGGGGCGGG + Intronic
1184950670 22:47840529-47840551 CTGGGGAGGCAGAAAGGGGCAGG - Intergenic
1184951516 22:47846014-47846036 AAAGGGAGGCAGAAGAGTTCAGG - Intergenic
949281505 3:2352605-2352627 AAGGGGAGGCAGCAGAGGCCCGG - Intronic
949330847 3:2920296-2920318 GAGGGGAGGTAGAAGGAGGCTGG + Intronic
949617521 3:5770319-5770341 GATGGGAGCCAGAAGGGGGATGG + Intergenic
949658021 3:6243612-6243634 ATTGGGAGGCTGAGGCGGGCGGG - Intergenic
949830770 3:8211793-8211815 AAACGGAGGCAGAAGGGGCAAGG + Intergenic
949935334 3:9111562-9111584 ATTGTGAGCCAGATGGGGGCAGG - Intronic
950008471 3:9705718-9705740 AAGGTGAGGCTGAATGGGGCTGG + Exonic
951720202 3:25689707-25689729 CCTGGGAGGCAGCAGGGGCCAGG + Intergenic
951795925 3:26538228-26538250 AAAGGGAAGGAGAAGGGGGAGGG + Intergenic
951829915 3:26915024-26915046 AATGTGATGGAGAAGGTGGCAGG + Intergenic
952002986 3:28808611-28808633 ATAGGGAGCCAGAAGGGGGTTGG + Intergenic
952233842 3:31458660-31458682 TTTGGGAGGCAGAGGAGGGCGGG + Intergenic
952541780 3:34374415-34374437 AGTGTGGGGCAGAAGTGGGCTGG + Intergenic
953106404 3:39884929-39884951 ATAGGGAGGGAGAAGGGGGGTGG - Intronic
953254628 3:41277998-41278020 CCTGGGAGGCACAAGGGGTCGGG + Intronic
953574689 3:44103577-44103599 AATGGGAGGGAGAGGGGGGTAGG + Intergenic
953818943 3:46187741-46187763 AATGGGAAGCAGCAGAGGCCTGG + Intronic
953985475 3:47439164-47439186 TTTGGGAGGCTGAAGTGGGCAGG + Intronic
954261574 3:49442910-49442932 TTTGGGAGGCCGAAGGGGGCGGG - Intergenic
954293105 3:49660136-49660158 AATGTGAGGCAGAGGGTGGCAGG + Intronic
954333072 3:49901110-49901132 ATTGGGAAGGAGAAGGGGCCAGG + Intronic
954491648 3:50912664-50912686 AAAGGGAGGGAAAAGGGGGAAGG - Intronic
954540691 3:51391479-51391501 AACGGGAGGCGGAGGCGGGCGGG + Exonic
954558596 3:51537697-51537719 TTTGGGAGGCAGAGGTGGGCAGG + Intergenic
955820590 3:62891868-62891890 TTTGGGAGGCCAAAGGGGGCGGG - Intergenic
955849693 3:63206368-63206390 TTTGGGAGGCCGAAGTGGGCAGG + Intergenic
955945215 3:64187387-64187409 AAGGGAGGGAAGAAGGGGGCAGG - Intronic
955968462 3:64413120-64413142 AATGGGAGGCTGGAAGAGGCAGG - Intronic
956137874 3:66116885-66116907 AATGGGAGGGTGGAGGGGACAGG + Intergenic
956181141 3:66519145-66519167 ATGGGGAGCCAGAAGGGGGATGG + Intergenic
956205363 3:66749512-66749534 AGTGGTAGGCAGAAAGGGGTAGG + Intergenic
956214210 3:66831833-66831855 AAGGGTGGGCAGAAGGGGGAAGG - Intergenic
956390830 3:68771106-68771128 ATGGGGAGTCAGAAGGGGGATGG - Intronic
956420494 3:69081738-69081760 CATGTGATGCAGAAGGAGGCTGG - Intergenic
956621608 3:71226596-71226618 AATGAGATGCAGAAGGGGGTAGG - Intronic
957029275 3:75221396-75221418 GACGGGAGCCAGAAGGGGGATGG + Intergenic
957467076 3:80608075-80608097 AGTGGGAGGGAGGAGGGGGAAGG + Intergenic
957982708 3:87531080-87531102 AGTGAGAGGCTGAATGGGGCTGG + Intergenic
958001956 3:87761837-87761859 ATGGGGAGCCAGAAGGGGGATGG + Intergenic
959278148 3:104304192-104304214 CCTGGGAGGCAGAAGGGGTTGGG + Intergenic
959411251 3:106025275-106025297 AACGGGTGGCAGAATGGAGCCGG + Intergenic
959536468 3:107491802-107491824 AATGAGAGGTAGAATGGTGCAGG - Intergenic
959595985 3:108128899-108128921 AAGGAGAGGCAGAAGGAAGCAGG + Intergenic
959710501 3:109381167-109381189 TTTGGGAGGCAGAGGGGGGCAGG - Intergenic
960081735 3:113548735-113548757 AATGGCAGGGAGAAGTGGCCAGG - Intronic
960501609 3:118445051-118445073 ATGGGGAGCCAGAAGGGGGATGG + Intergenic
961166885 3:124769715-124769737 TCTGAGAGGGAGAAGGGGGCTGG - Intronic
961299880 3:125915882-125915904 ACTGGGAGGCGGATCGGGGCTGG - Intergenic
961516426 3:127440237-127440259 ACTCAGAGGCTGAAGGGGGCTGG + Intergenic
961688131 3:128649772-128649794 AATGAGAAGCAGCAGGGGGAAGG + Intronic
961880221 3:130056495-130056517 ATGGGGAGCCAGAAGGGGGATGG - Intergenic
962106930 3:132399962-132399984 AATGGGTGGCAGAAGGTTTCAGG - Intergenic
962272980 3:133991726-133991748 GAGGGGAGGCTGCAGGGGGCCGG + Intronic
962308576 3:134310210-134310232 AAAGGGAGGAGGAAGGGGGTGGG + Intergenic
962357647 3:134708719-134708741 ATTTGGGGGCAAAAGGGGGCAGG - Intronic
962410793 3:135140257-135140279 GATGGGAGGGAGGAGGGTGCAGG + Intronic
962982566 3:140503945-140503967 AAGGGGAGGCTGAAGATGGCAGG - Intronic
963104352 3:141633254-141633276 GATAGGAGGCAGGAGGGAGCTGG + Intergenic
963229136 3:142892138-142892160 TTTGGGAGGCAGAGGTGGGCAGG + Intergenic
963248179 3:143082161-143082183 TATAGGAGGCTGAGGGGGGCAGG - Intergenic
963604160 3:147399906-147399928 TGTGGGAGGCCGAAGTGGGCAGG - Intronic
963928011 3:150972008-150972030 AATGGGAGGGAGTGGGGAGCAGG + Intronic
964669466 3:159209345-159209367 AAGGGGAGCCGGAAGGGGGATGG - Intronic
964769664 3:160211125-160211147 AGAGGGAGGCAGCAGGGAGCTGG - Intergenic
964976535 3:162627616-162627638 TTTGGGAGGCGGAGGGGGGCTGG + Intergenic
965185275 3:165454898-165454920 ACTGGGAGCCAGAAGGGGGATGG + Intergenic
965521720 3:169674765-169674787 ATTGGGAGGCAGAGGCAGGCAGG - Intergenic
966072123 3:175891605-175891627 TTTGGGAGGCAGAGGCGGGCGGG + Intergenic
966095757 3:176200804-176200826 AATGAGGGGCAGCAGGTGGCAGG + Intergenic
966095806 3:176201605-176201627 AATGAGGGGCAGCAGGTGGCAGG - Intergenic
966488303 3:180497136-180497158 AATGGGTGGCACAAGAGGCCTGG + Intergenic
966694747 3:182778257-182778279 AATGGAAGGCAGAAGGGACTTGG - Intergenic
966878874 3:184338607-184338629 AAAGGGAGCCAGAAGCTGGCTGG - Intronic
968084850 3:195869687-195869709 AACGGGAGGCCGCAGGCGGCAGG + Intronic
968261104 3:197324794-197324816 ATTGGGAGGCAGAAGGGGCCAGG + Intergenic
968261111 3:197324817-197324839 ATTGGAAGGCAGAAGGGGCCAGG + Intergenic
968261119 3:197324840-197324862 ATTGGGAGGCAGAAGGGGCCAGG + Intergenic
968563645 4:1297926-1297948 AATGGGAAGCAGAGAAGGGCAGG - Intronic
968676850 4:1886939-1886961 CATGGGAGGTAAGAGGGGGCGGG - Intronic
968693737 4:2009873-2009895 TCTGGGAGGCAGAGGCGGGCGGG - Exonic
968741726 4:2334737-2334759 AAGGGGAGGGGGAAGGGGGAGGG - Intronic
968785534 4:2619609-2619631 TTTGGGAGGCAGAGGCGGGCGGG - Intronic
968992610 4:3924850-3924872 ATGGGGAGCCAGAAGGGGGATGG - Intergenic
969330515 4:6471589-6471611 AGTGGGAGGGAGAAGGCGGCTGG - Intronic
969822741 4:9732772-9732794 ATGGGGAGCCAGAAGGGGGATGG + Intergenic
969944008 4:10764294-10764316 GATGGGAGGCAGCAGGTAGCAGG + Intergenic
970500443 4:16671651-16671673 ATTCGGAGTCAGAAGGGGCCAGG + Intronic
970653544 4:18204420-18204442 AATTGGAGGGAGTAGGGGGAAGG - Intergenic
971267102 4:25105499-25105521 AGGGGGAGGCTGAAGGAGGCAGG - Intergenic
971295497 4:25386153-25386175 TTTGGGAGGCCGAAGCGGGCGGG - Intronic
971340575 4:25765234-25765256 TTTGGGAGGCCGACGGGGGCGGG - Intronic
972082135 4:35166135-35166157 ACAGGGTGGCAGTAGGGGGCTGG - Intergenic
972286189 4:37650801-37650823 TTTGGGAGGCTGAAGGGGGTGGG + Intronic
972386370 4:38570319-38570341 AGTGGGAGGAAGAAAGGGGTTGG - Intergenic
972390251 4:38607010-38607032 ATGGGGAGTCAGAAGGGGGATGG + Intergenic
973134492 4:46689493-46689515 GATGCGAGCCAGAAGGGGGATGG - Intergenic
973894167 4:55395886-55395908 AATGGGAGGCCGTCGCGGGCAGG + Intergenic
974269731 4:59634416-59634438 AATTGGAGGCAGAAGGTGAAAGG + Intergenic
974417562 4:61629474-61629496 TATGGGAGGCCGAGGTGGGCGGG + Intronic
974536712 4:63184178-63184200 TTTGGGAGGCTGAAGGGGGGTGG + Intergenic
974891912 4:67893381-67893403 TATGGGAGGCAGTAGGGGAAGGG + Intergenic
975360243 4:73460988-73461010 AAAGGGAGGGAGATGGGGGAGGG - Intergenic
975394318 4:73857213-73857235 CATGGGAGGAAGATGTGGGCTGG - Intergenic
975460856 4:74651272-74651294 GATGGGAGGGAGGAGGGGGAGGG + Intergenic
975697136 4:77024442-77024464 AATGCCAGCCAGAAAGGGGCTGG - Intronic
976759596 4:88533964-88533986 AATGGGAGGTAGAAAGAGGGAGG - Intronic
977672845 4:99716015-99716037 AATTTTGGGCAGAAGGGGGCAGG + Intergenic
977744137 4:100525122-100525144 TTTGGGAGGCAGAAGGTGGGAGG - Intronic
977934746 4:102788653-102788675 TTTGGGAGGCCGAGGGGGGCGGG + Intergenic
978125908 4:105135039-105135061 TTTGGGAGGCTGAAGGGGGCTGG + Intergenic
978529330 4:109698409-109698431 TTTGGGAGTCAGAAGGGGGATGG - Intronic
978740738 4:112135215-112135237 AATGGGTTGCAGAAGCAGGCGGG + Intergenic
978988448 4:115046218-115046240 ATAGGGAGGCAGAATGGGGCAGG - Intronic
979259025 4:118632066-118632088 GCTGGGAGGCCGAAGGTGGCTGG - Intergenic
979771057 4:124525400-124525422 CATGGGAGCTAGAAGGGGGATGG - Intergenic
979851180 4:125573117-125573139 AAGGGGAGGAAAAAGGGGGAAGG - Intergenic
980266158 4:130518937-130518959 AATGGAAGGAAGGAGGGGGTGGG + Intergenic
980603134 4:135052251-135052273 TTTGGGAGGCAGAAGGGGGACGG - Intergenic
980760981 4:137234009-137234031 TTTGGGAGGCTGAGGGGGGCAGG - Intergenic
981086487 4:140689508-140689530 AATGGAAGGGAAAAGGGGGAAGG - Intronic
982091928 4:151887663-151887685 AATGGGAAGCAGAACTAGGCTGG - Intergenic
982771381 4:159400418-159400440 AATGGAAGGCGGAGGGAGGCAGG + Intergenic
982918935 4:161249961-161249983 AAGCTGAGGCAGCAGGGGGCTGG + Intergenic
983649051 4:170020617-170020639 AATGGGAGGAGGGAGGGGGGAGG - Intronic
983890755 4:173027223-173027245 ATTGGGAGGTAGAGGTGGGCGGG - Intronic
984205272 4:176780135-176780157 TTTGGGAGGCAGAGGCGGGCAGG + Intronic
984323961 4:178228002-178228024 TTTGGGAGGCTGAAGCGGGCAGG + Intergenic
985048960 4:185970692-185970714 AATTCTAGGCAGAAGAGGGCAGG - Intergenic
985113202 4:186567118-186567140 AAGGGGAGGAAGATGGGAGCCGG - Intergenic
985117448 4:186605581-186605603 AATGGGAGGGAGGAGTGGGGAGG + Intronic
985245804 4:187978694-187978716 AATGTGAGTCAGAAGGTGACAGG - Intergenic
985313586 4:188630936-188630958 AATGAGATGCAGAAGGGCACTGG + Intergenic
985688007 5:1292262-1292284 ACTGGGAGCCAAAAGGGGGCTGG + Intronic
985898072 5:2762239-2762261 GAGGGGAGGCAGCAGGAGGCTGG + Intergenic
985993751 5:3584819-3584841 AATGAAAGGAAGAAGGGGGGAGG + Intergenic
986183932 5:5418915-5418937 GATCGGAGGAAGAAGGCGGCAGG - Intergenic
986271669 5:6236479-6236501 AATGGGAGGAAGAAGTCTGCAGG + Intergenic
986827461 5:11537037-11537059 AATTGGAGGCAGCAGGTGGGGGG + Intronic
986856657 5:11876246-11876268 GGTGGGAGGCAGGAGAGGGCAGG + Intronic
987005705 5:13707253-13707275 ATGGGGAGCCAGAAGGGGGATGG - Intronic
987212137 5:15693838-15693860 ATGGGGAGCCAGAAGGGGGATGG - Intronic
988567603 5:32331842-32331864 ACTGGGAGCCAGAAAGGGGGCGG + Intergenic
988801151 5:34698055-34698077 AAAGGGAGGGAGAAAGGGGAGGG - Intronic
988846546 5:35133431-35133453 AATGGGAGTCAGAAATGGGTGGG - Intronic
989363868 5:40634351-40634373 CCTGGGAGGCACAAGGGGTCAGG + Intergenic
989456363 5:41648767-41648789 AATGGGATGCAGAAGGCAGAAGG - Intergenic
990370528 5:55113971-55113993 AATGGGAGGAAGAAGAGGAGGGG + Exonic
990916832 5:60915737-60915759 AGTGGGAGGCAGAAGGAGACGGG - Intronic
992093648 5:73340611-73340633 TGGGGGAGGCAGAAGGGGGATGG - Intergenic
992191544 5:74296798-74296820 AAGGGGAGGAAGCAGGGGTCGGG - Intergenic
992312143 5:75511652-75511674 AATGGGAGGACGAAGGGGAGGGG - Intronic
992672752 5:79076138-79076160 ATGGGGAGCCAGAAGGGGGATGG + Intronic
992795422 5:80251485-80251507 TTTGGGAGGCAGAGGCGGGCGGG + Intronic
993426136 5:87766205-87766227 AATGAGAGCCAGAAAGGGGTGGG + Intergenic
993905004 5:93612618-93612640 AAGGGGAGAGGGAAGGGGGCGGG + Intergenic
994116638 5:96068423-96068445 AATGTGAGGCAGTAGGGCACAGG - Intergenic
994333593 5:98537861-98537883 AATGAGAGGCAAAAGGTTGCAGG + Intergenic
994346042 5:98687467-98687489 AAAGGGAAGCAGAAGGAGGAAGG + Intergenic
994371693 5:98975072-98975094 TTTGGGAGGCTGAGGGGGGCAGG + Intergenic
994670099 5:102754470-102754492 AAAGGGATGCAGATGGAGGCGGG + Intronic
994846369 5:104993422-104993444 TATGGGAGGTAGACTGGGGCTGG + Intergenic
995042602 5:107605853-107605875 ACTGGGAGGAAGCAGGGGGAGGG + Intronic
995533644 5:113114787-113114809 AAGGGGAGCTAGAAGGGGGATGG - Intronic
995889802 5:116938039-116938061 AATGAGAGGCAGTAGTGTGCTGG - Intergenic
996542131 5:124641355-124641377 AACGGGAGGCAGAAAGGGAAAGG - Exonic
996576266 5:124979377-124979399 GATGGGAGGAGGAAGGGGGATGG + Intergenic
996796126 5:127350452-127350474 AATGGAGGGCAGGAAGGGGCAGG - Intronic
997721408 5:136080813-136080835 GAGGGGAGGCAGGAGGGTGCGGG + Intergenic
998031812 5:138876930-138876952 AAAGGGAGACAGAAGGCAGCAGG + Intronic
998509328 5:142698195-142698217 AATATGAGGCAGAAGGGAGCGGG + Intergenic
998958347 5:147459866-147459888 TTTGGGAGGCAGAGGTGGGCGGG + Intronic
999160576 5:149493296-149493318 TTTGGGAGGCCGAAGTGGGCAGG - Intronic
999313729 5:150570450-150570472 ACTGGGGGGCAGATGGGGGCTGG - Intergenic
999738126 5:154527964-154527986 AATGGGGAGCTGAAGGAGGCAGG + Intergenic
1000068938 5:157721122-157721144 CATGGGAAGCAGAAGGGGTCAGG + Intergenic
1000574782 5:162964626-162964648 ACTGGGAAGCACAAGGGGTCAGG - Intergenic
1000658892 5:163915412-163915434 ATGGGGAGCCAGAAGGGGGATGG + Intergenic
1001165671 5:169364017-169364039 TTTGGGAGGCCGAAGAGGGCAGG + Intergenic
1001191539 5:169637175-169637197 AACGGGAGGGAGGAGGGAGCGGG + Intergenic
1001381789 5:171310494-171310516 TGGGGGAGGCAGAGGGGGGCGGG - Intronic
1001619564 5:173071945-173071967 CTTGGGAGGCAGAAGTGGGAGGG + Intronic
1001663400 5:173413196-173413218 AATGGGAAGCAGCACAGGGCAGG + Intergenic
1001737797 5:174021047-174021069 AAGGGGAAGCAGAAGGGGAAAGG + Intergenic
1002255424 5:177954757-177954779 AAAGGGAGGGAGGAGGGGGGAGG + Intergenic
1002436416 5:179234555-179234577 AGTTGCAGGCAGCAGGGGGCGGG - Intronic
1002526619 5:179819053-179819075 GATGGGTGGCAGCAGGGGCCGGG + Intronic
1002717060 5:181234342-181234364 ACTGGGAGGTAGAGGTGGGCGGG + Exonic
1003232197 6:4264553-4264575 AATGGGAAGCAGGACGGGTCTGG - Intergenic
1003485796 6:6578049-6578071 TTTGGGAGGCAGAAGTGGGAGGG + Intergenic
1003765793 6:9234958-9234980 ATTGGGAGGCAAAAGAGGGAGGG + Intergenic
1004875257 6:19944847-19944869 AAAGTGGGGCAGACGGGGGCGGG - Intergenic
1005078615 6:21933994-21934016 TCTGGGAGGCCGAAGTGGGCAGG - Intergenic
1005475438 6:26203403-26203425 AATGGGAGGGAGAAAGAGGAAGG + Intergenic
1005744291 6:28821960-28821982 GTAGGGAGGCAGAAGCGGGCAGG + Intergenic
1005885915 6:30097590-30097612 AATGGGAAGCAGGTGGGGGCAGG + Intergenic
1006299506 6:33186117-33186139 AAGGGGAGGTAGTAGGGGGAAGG - Intronic
1006576230 6:35048473-35048495 AGAGGGAGGCAGAAGGGGATGGG - Intronic
1006757956 6:36433490-36433512 AATGGTAGGCAGATGGGGAAGGG + Intronic
1006848969 6:37083679-37083701 AATGGGAGGAAGGTGGGGGTAGG - Intergenic
1007794751 6:44338526-44338548 AATGGTAGGCAGAAGAAGCCTGG - Intronic
1007806745 6:44455984-44456006 GGTGGGAGGCTGAAGTGGGCAGG + Intergenic
1008459435 6:51751017-51751039 TTTGGGAGGCTGAAGTGGGCAGG - Intronic
1008762014 6:54862632-54862654 TTTGGGAGGCTGAAGTGGGCAGG + Intronic
1008996929 6:57669697-57669719 ATTGGGAGGCAGAAGAAGGAGGG + Intergenic
1010398366 6:75418993-75419015 AATGGGAGGCTGCAGGGGGTGGG - Intronic
1010807130 6:80250485-80250507 AATGGGAGGGAAAAGGGAGAGGG + Intronic
1011286283 6:85727474-85727496 TTTGGGAGGCTGAAGTGGGCAGG - Intergenic
1011305601 6:85922977-85922999 AAGGAGATGAAGAAGGGGGCGGG - Intergenic
1012258741 6:97063418-97063440 AATTGCAGGCAGAAGGGGTTGGG + Intronic
1012319046 6:97819806-97819828 AAGGGGAGGCAGAACAGGGAAGG - Intergenic
1012488660 6:99752469-99752491 TTTGGGAGGCTGAAGTGGGCGGG + Intergenic
1012522707 6:100139630-100139652 TTTGGGAGGCTGAGGGGGGCTGG - Intergenic
1013622290 6:111901526-111901548 AATGGGAGGTAGAAAGGACCAGG - Intergenic
1013696880 6:112713489-112713511 AATTGCAGGCAGAAAGGTGCAGG - Intergenic
1014684315 6:124477345-124477367 ATTGGGAGGGAGAAGGGAGATGG + Intronic
1014688230 6:124530469-124530491 AATGGGAGGCAGGAGAGGTAGGG + Intronic
1014778127 6:125533788-125533810 TTGGGGAGGCAGAAAGGGGCAGG + Intergenic
1015971671 6:138748836-138748858 TTTGGGAGGCAGAGGCGGGCAGG - Intergenic
1016833689 6:148456218-148456240 AAAGTGAGGCAGCAGGGGGCTGG - Intronic
1016984769 6:149887010-149887032 AGTGGGAGGCAGAGTGGGCCTGG - Intronic
1017067969 6:150547723-150547745 AAAGGGAGGGAGGAGGGGGCTGG + Intergenic
1017355037 6:153494656-153494678 TTTGGGAGGCTGAAGTGGGCAGG - Intergenic
1017764115 6:157593100-157593122 AATGGGAGGCGCGAGGGGGCCGG - Exonic
1017936618 6:159011108-159011130 AATGGGAGGGAGCTGGGAGCTGG + Intergenic
1017980135 6:159394173-159394195 ATGGGGAGCCAGAAGGGGGATGG - Intergenic
1017998965 6:159561260-159561282 AATTCTAGGCAGAAGGGGGCGGG - Intergenic
1018245253 6:161816351-161816373 AAGGGGAGGCAGAGTGGGGTGGG + Intronic
1018620405 6:165725121-165725143 AATGGGAGCCAGAAGAGGGCTGG - Intronic
1019144841 6:169969959-169969981 AGTGAGAGGTAGAAGGAGGCTGG + Intergenic
1019308107 7:345943-345965 AGGGGGAGGCAGAGGGGCGCAGG + Intergenic
1019546586 7:1580238-1580260 CATGGGAGACAGAAGGAGACAGG - Intergenic
1019571633 7:1715538-1715560 TCTGGGAGGCAGAAGTGGGCAGG - Intronic
1019637178 7:2082160-2082182 GAAGGGAGGCAGGAGGGGGAGGG + Intronic
1019664440 7:2244457-2244479 TCTGGGAGGCAGTGGGGGGCGGG - Intronic
1019679795 7:2340612-2340634 TTTGGGAGGCTGAAGAGGGCGGG + Intronic
1019705801 7:2496677-2496699 GATGGGAGACAGAAGAGGCCTGG - Intergenic
1019792360 7:3024336-3024358 AATGGGATTCAGAAGTGGGGAGG + Intronic
1020315256 7:6901206-6901228 ATGGGGAGCCAGAAGGGGGATGG - Intergenic
1020641383 7:10758306-10758328 ATTGGGAGGCCGAGGTGGGCAGG - Intergenic
1020939246 7:14509931-14509953 ATTGGGAGGCCGAGGCGGGCTGG + Intronic
1021113910 7:16727426-16727448 AATGTGAGGTATTAGGGGGCAGG + Intergenic
1021682396 7:23147330-23147352 TTTGGGAGGCAGAGGTGGGCGGG - Intronic
1021891805 7:25193827-25193849 ACCTGGAGGCAGAAGGGGTCAGG - Intergenic
1022140677 7:27491150-27491172 AATGGGAGGCTGCAGGGAGCAGG - Intergenic
1022503458 7:30896669-30896691 GAGGGGAGGCAAAAGGAGGCAGG - Intergenic
1022703009 7:32778868-32778890 AATGAGAGGCAGCAAGGGGCAGG - Intergenic
1022992760 7:35724910-35724932 ATGGGGAGCCAGAAGGGGGATGG - Intergenic
1023230683 7:38024992-38025014 AAGGGAAGGCTAAAGGGGGCTGG + Intronic
1023472257 7:40536347-40536369 ACAGGCAGGGAGAAGGGGGCAGG + Intronic
1023986541 7:45100419-45100441 AATGGGACCTAGAAGGAGGCAGG + Exonic
1024461655 7:49665945-49665967 ACTGGGAAGCACAAGGGGTCAGG + Intergenic
1024534534 7:50419030-50419052 AATGGGAGGCTGAGGGGCCCAGG - Intergenic
1024649077 7:51389470-51389492 ACTGGGAGGCAGGAGGAGGTGGG + Intergenic
1024892323 7:54218323-54218345 CCTGGGAGGCACAAGGGGTCAGG + Intergenic
1025232106 7:57209468-57209490 TTTGGGAGGCAGAGGTGGGCAGG + Intergenic
1025619748 7:63157742-63157764 TTTGGGAGGCTGAAGTGGGCAGG + Intergenic
1026054664 7:66973912-66973934 TTTGGGAGGCTGAAGGGGGCAGG + Intergenic
1026156899 7:67834199-67834221 ATTGGGAGGCCGAGGTGGGCGGG + Intergenic
1026272018 7:68844936-68844958 ATGGGGAGCCAGAAGGGGGATGG + Intergenic
1026477160 7:70746708-70746730 AAGGAGAGGGAGAGGGGGGCAGG + Intronic
1026741560 7:72981865-72981887 AAGGGGAGGGAGAAGGGGCAGGG + Intergenic
1026776664 7:73235083-73235105 AGTGGGGGGCAGTAGGGGGCCGG - Intergenic
1026801394 7:73402249-73402271 AAGGGGAGGGAGAAGGGGCAGGG + Intergenic
1026825014 7:73576273-73576295 TTTGGGAGGCCGAAGCGGGCAGG - Intronic
1027017516 7:74788453-74788475 AGTGGGGGGCAGTAGGGGGCCGG - Intronic
1027070507 7:75157479-75157501 AGTGGGGGGCAGTAGGGGGCCGG + Intergenic
1027102175 7:75383213-75383235 AAGGGGAGGGAGAAGGGGCAGGG - Intergenic
1027397147 7:77767780-77767802 AGGGGGAGGGAGAAGGGGGAGGG - Intronic
1027626438 7:80550851-80550873 AATGGGAAGGAGAATGGAGCAGG - Intronic
1028114457 7:86981865-86981887 ACTGGGAAGCACAAGGGGTCAGG + Intronic
1029412873 7:100426927-100426949 AAGGGGAGGGAGGAGGGGGAGGG - Intronic
1029426001 7:100494232-100494254 GATGGGAGGAAGAGGGGGGTGGG + Exonic
1029608665 7:101615023-101615045 AATTGCAGGCAGGAGTGGGCGGG - Intronic
1029611601 7:101629567-101629589 ATGGGGAGCCAGAAGGGGGATGG + Intergenic
1029654741 7:101916864-101916886 AAGGGAAGGAAGAAGGGGCCAGG - Intronic
1030221054 7:107099446-107099468 ACTGGGAAGCACAAGGGGTCAGG - Intronic
1030609516 7:111673610-111673632 AATGGAAGACAAAAGGGGGCAGG + Intergenic
1030675248 7:112378176-112378198 TTTGGGAGGCCGAAGCGGGCGGG - Intergenic
1030966810 7:116003194-116003216 AGTGTGAGGCTGAAGGGTGCTGG - Intronic
1031886735 7:127252269-127252291 AATGGGAGACTGAAGGGTGACGG - Intronic
1031990756 7:128197453-128197475 GAGGGGAGGCAGAAGAGGGTGGG + Intergenic
1032016567 7:128383893-128383915 AATGAGAGGGAGGAGGGGCCAGG + Intergenic
1032260900 7:130336202-130336224 ACTGGGAGGCTGAGGCGGGCAGG + Intergenic
1032499612 7:132390700-132390722 GTTGGTGGGCAGAAGGGGGCTGG - Intronic
1032804249 7:135339544-135339566 AATGGGAGGAAGAGAGGGGTAGG - Intergenic
1033354374 7:140587583-140587605 AAGGGGAGGGAGAATGGGGCTGG - Intronic
1033431137 7:141290730-141290752 AAGGAGAGGCCGAAAGGGGCAGG - Intronic
1033568626 7:142604928-142604950 AAGGGGAGAGAGAAAGGGGCTGG - Intergenic
1033804392 7:144937599-144937621 AAGGGGAAGCAGAAAGGGGAAGG - Intergenic
1033817039 7:145085488-145085510 AAGGGCAGGAAGAAGAGGGCAGG + Intergenic
1034156277 7:148958620-148958642 TTTGGGAGGCTGAAGAGGGCAGG + Intergenic
1034415040 7:150959826-150959848 ACGGGGAGGCAGAAGTGGACGGG - Intronic
1034504971 7:151481497-151481519 AATTGGATGCATACGGGGGCTGG - Intronic
1034591271 7:152141465-152141487 TTTGGGAGGCAGAGGTGGGCGGG + Intronic
1034745057 7:153516826-153516848 TTTGGGAGGCCGAGGGGGGCGGG - Intergenic
1035137168 7:156715192-156715214 TTTGGGAGGCCGAAGCGGGCAGG - Intronic
1035287312 7:157814566-157814588 GACGGGGGGCAGGAGGGGGCAGG + Intronic
1035458914 7:159027379-159027401 GATGGGAGGCAGAAGGTGCAGGG - Intergenic
1035720496 8:1787899-1787921 AAAAGGAGGCAGGAAGGGGCGGG - Intergenic
1035850824 8:2917684-2917706 TTTGGGAGGCAGAGGTGGGCAGG + Intergenic
1036479175 8:9122877-9122899 AATGAAAGGCATACGGGGGCCGG - Intergenic
1036798746 8:11774131-11774153 TTTGGGAGGCAGAGGTGGGCAGG + Intronic
1037331428 8:17747482-17747504 AATTCTAGGCAGACGGGGGCAGG + Intronic
1037840751 8:22243927-22243949 ATTGGGAGGCCGAAGCGGGTGGG + Intergenic
1038134832 8:24773884-24773906 AAGGGGAGGGAGAAAGGGGAGGG + Intergenic
1038420483 8:27431071-27431093 AAAGGGGGCCAGGAGGGGGCAGG + Intronic
1039017978 8:33174094-33174116 TTTGGGAGGCAGAGGCGGGCAGG + Intergenic
1039714717 8:40095040-40095062 AAGGGGAGGCACCAGGAGGCAGG - Intergenic
1039918238 8:41875318-41875340 AACTGGAGGCAGGAGGAGGCAGG + Intronic
1041616805 8:59916744-59916766 AATGTTAGGATGAAGGGGGCAGG + Intergenic
1041648111 8:60274345-60274367 AATGGGCGGCGGTAGGGGGGTGG + Intronic
1042333427 8:67606522-67606544 AAAGGGAGGCTGCAGGGGGCAGG - Intronic
1042445955 8:68885191-68885213 AATTCTAGGCAGAAGAGGGCAGG - Intergenic
1042695184 8:71547740-71547762 AACTGGAGGCAGAAGCCGGCGGG + Intronic
1043151176 8:76717837-76717859 TGTGGGAGGCTGAGGGGGGCGGG - Intronic
1043497015 8:80812652-80812674 AATGAGAGCCAGAAGGGCACTGG - Intronic
1044021578 8:87111790-87111812 AATGGCAGGATGCAGGGGGCGGG - Intronic
1044569211 8:93699450-93699472 TTTGGGAGGCTGAAGGGGGGCGG + Intronic
1044837545 8:96311006-96311028 TTTGGGAGGCAGAAGGTGGGTGG - Intronic
1045891668 8:107165166-107165188 TCTGGGAGGCAGAGGTGGGCGGG - Intergenic
1046439218 8:114236628-114236650 TATGGGAGCCAGAAGGGGAACGG - Intergenic
1046607879 8:116390908-116390930 CATGGGAAGCACAAGGGGTCGGG + Intergenic
1047152145 8:122275675-122275697 AATGAAAGGCAGAAGAGAGCAGG + Intergenic
1048572942 8:135669952-135669974 AATGTGAGGCAGAAGAGGGAGGG - Intergenic
1049436921 8:142590698-142590720 CATGGGGGGCAGAAGTGAGCAGG - Intergenic
1049451542 8:142664706-142664728 GAAGGGAGGCAGAAGGGGGACGG - Exonic
1049998762 9:1053658-1053680 AATGGGGGCGAGAAGGGGGAAGG - Intronic
1050320672 9:4449025-4449047 CCTGGGAGGCACAAGGGGTCAGG + Intergenic
1050550517 9:6744960-6744982 AATAGGAGGAGGAAGAGGGCTGG - Intronic
1050829109 9:9989531-9989553 AAGGGGAGCTAGAAGGGGGATGG - Intronic
1051159911 9:14195848-14195870 ATTGGGAGGAAAAAGGGGGTGGG + Intronic
1052173331 9:25427810-25427832 AATGGCAGGTAGAAGGGGAAGGG - Intergenic
1052939952 9:34125626-34125648 ACTGAGAGGGAGAAGGGGGCTGG - Intronic
1053090961 9:35276061-35276083 TTTGGGAGGCTGAAGTGGGCAGG + Intronic
1053202977 9:36165252-36165274 CATGGGAGCCAGAAGGTGTCTGG + Intergenic
1053233582 9:36432546-36432568 TTTGGGAGGCAGAGGCGGGCGGG + Intronic
1053281251 9:36820925-36820947 AATGGGAGGCAGCAGAAGACTGG - Intergenic
1053424646 9:38003177-38003199 GATGAGAGTGAGAAGGGGGCAGG + Intronic
1053485724 9:38454622-38454644 AAGTGGAAGCAGAATGGGGCTGG - Intergenic
1054793867 9:69280590-69280612 GATGGAAGCCAGAAGGGGGAAGG - Intergenic
1055053379 9:72001290-72001312 AAGGGGATGCAGAAGGAGGATGG + Intergenic
1055478266 9:76685045-76685067 AATAAGAGGCAGAAGTGGCCGGG - Intronic
1055664251 9:78537888-78537910 ATTGGGAGGCAGAAGATGGGAGG - Intergenic
1056205255 9:84313670-84313692 GATGGGAGGCCGAAGTGGGAGGG + Intronic
1056409040 9:86307025-86307047 TTTGGGAGGCTGAAGTGGGCCGG + Intronic
1056871905 9:90289626-90289648 ATGGGGAGCCAGAAGGGGGATGG - Intergenic
1057349729 9:94285765-94285787 TTTGGGAGGCTGAAGTGGGCGGG + Intronic
1057743108 9:97729710-97729732 TTTGGGAGGCGGAAGCGGGCTGG - Intergenic
1057788290 9:98105003-98105025 AATGGCAGGCAGGAAGAGGCAGG + Intronic
1058236598 9:102498123-102498145 ATGGGGAGCCAGAAGGGGGATGG + Intergenic
1058297450 9:103326922-103326944 AGTTGGAGGCAGTAGGGGTCAGG - Intergenic
1058903859 9:109465332-109465354 TTTGGGAGGCCGAAGCGGGCGGG + Intronic
1059144553 9:111886741-111886763 TTTGGGAGGCCGAAGGGGGCAGG - Intergenic
1059476427 9:114551500-114551522 CTTGGGAGGCTGAAGGGGGAGGG - Intergenic
1059814917 9:117901357-117901379 AAAGGGAGGGAGAAGAGGGAGGG + Intergenic
1060128975 9:121076701-121076723 AATGGGAGGCAGAGGTGGGTGGG + Intronic
1060354814 9:122895408-122895430 TTTGGGAGGCTGAAGTGGGCAGG - Intronic
1060877003 9:127090704-127090726 AAATGGAGGCAGGAGGGGACTGG + Intronic
1061013945 9:127971343-127971365 AATGGAAAGGAGGAGGGGGCTGG - Intronic
1061019436 9:128004509-128004531 ATTGGGAGGCAGAGGTGGGCGGG + Intergenic
1061230393 9:129312556-129312578 CATGGGGGGCAGGATGGGGCTGG - Intergenic
1061238719 9:129357063-129357085 AGTGGGAGGTGGATGGGGGCAGG + Intergenic
1061246048 9:129401748-129401770 AGGGGGAGGGAGAAGGGGGGAGG - Intergenic
1061259202 9:129470311-129470333 ATTGGGAGGCTGAGGCGGGCGGG + Intergenic
1061368489 9:130185053-130185075 AGTGGGAGGAAGCAGAGGGCTGG - Intronic
1061488799 9:130934027-130934049 AATGGAAAGCTGAAGGTGGCGGG + Intronic
1062008508 9:134254382-134254404 AAAGGGAGGGAGAAGGAGGGAGG + Intergenic
1062250245 9:135590196-135590218 AAGGGGAGGCTGCAAGGGGCTGG + Intergenic
1062345823 9:136114731-136114753 GACGGGAGGCGGGAGGGGGCTGG - Exonic
1062578986 9:137221438-137221460 AGGGGGAGGCAGGCGGGGGCAGG + Intronic
1062684492 9:137803380-137803402 AATGGGTGGCAGGGGTGGGCTGG - Intronic
1185625542 X:1478882-1478904 AAAGGCAGACAGCAGGGGGCAGG - Intronic
1185696117 X:2196024-2196046 TTTGGGAGGCCGAAGCGGGCAGG - Intergenic
1185756675 X:2659242-2659264 AAGGGGAGGGGGAAGGGGGGAGG - Intergenic
1186174108 X:6907093-6907115 AATGGGAGGGAGACGGTGGGAGG + Intergenic
1186532850 X:10314687-10314709 AATGAGAGGCAGGAGAGGGAAGG + Intergenic
1187097280 X:16161906-16161928 ATGGGGAGCCAGAAGGGGGATGG - Intergenic
1187138524 X:16571154-16571176 ATGGGGAGCCAGAAGGGGGATGG - Intergenic
1187416413 X:19097084-19097106 GAGGGGAGGCAGAGAGGGGCTGG - Intronic
1188192010 X:27182818-27182840 AATGGGAGGCAAAAACGGGAAGG + Intergenic
1188662203 X:32774577-32774599 ACTAGGTGGCAGGAGGGGGCAGG + Intronic
1188680369 X:32996578-32996600 TTTGGGAGGCAGAGGCGGGCGGG + Intronic
1189233043 X:39466896-39466918 AGTTGCAGTCAGAAGGGGGCTGG - Intergenic
1189816915 X:44833516-44833538 TTTGGGAGGCAGAGAGGGGCGGG - Intergenic
1189837332 X:45039210-45039232 ATGGGGAGGCAGAGGGGGGATGG - Intronic
1190023452 X:46900416-46900438 TTTGGGAGGCTGAAGCGGGCGGG + Intergenic
1190286123 X:48962494-48962516 TTTGGGAGGCAGAGAGGGGCAGG - Exonic
1190598554 X:52068305-52068327 AATATTAGGCAGTAGGGGGCGGG + Intronic
1190610270 X:52185768-52185790 AATATTAGGCAGTAGGGGGCGGG - Intronic
1190715611 X:53100555-53100577 TTTGGGAGGCAGAGGCGGGCGGG + Intergenic
1191057306 X:56254966-56254988 AATTCTAGGCAGAAGTGGGCAGG - Intronic
1191221216 X:57989978-57990000 AGTGGGAGACTGAGGGGGGCTGG + Intergenic
1191974902 X:66861309-66861331 ATGGGGAGCCAGAAGGGGGATGG + Intergenic
1192557369 X:72101328-72101350 AATGGGAGGAGGCAGGTGGCTGG + Intergenic
1192857309 X:75025746-75025768 ATTGGGAAGCACAAGGGGTCGGG - Intergenic
1192967272 X:76192071-76192093 AGTGGGAGGCTGAGGGGGGGAGG - Intergenic
1193787134 X:85772815-85772837 CATGGGAAGCACAAGGGGTCAGG - Intergenic
1193871304 X:86802360-86802382 AATGGAAGGTAGAAGGGAGCAGG - Intronic
1194006111 X:88494876-88494898 AATGGTAGCCAAAAGGGAGCAGG - Intergenic
1195761145 X:108247758-108247780 AATTGGTGGCAGTGGGGGGCAGG - Intronic
1196935374 X:120725226-120725248 AATGGTGGGCACAAGGAGGCTGG - Intergenic
1197745611 X:129931132-129931154 AAACGGAGGCAGGAGTGGGCAGG - Intergenic
1197960308 X:131997434-131997456 AATGGGAGAGAGAAGAGGGAAGG + Intergenic
1198720390 X:139611969-139611991 AAAGGGAAGAAGAAGTGGGCAGG + Intronic
1198853037 X:140986187-140986209 TTTGGGAGGCAGAGGCGGGCAGG - Intergenic
1199451350 X:147981725-147981747 AGGGGGAGGGAGAGGGGGGCGGG + Intronic
1199978734 X:152909270-152909292 TATGGGTGGCAGCAGGGGGTGGG - Intergenic
1200656849 Y:5912673-5912695 AAAGGGAGGGGGAAGGGGGAGGG + Intergenic
1200808478 Y:7457813-7457835 AATAGGAGGAGGAAGTGGGCTGG + Intergenic
1200971709 Y:9159512-9159534 TTTGGGAGGCAGAGGTGGGCAGG + Intergenic
1201072956 Y:10166005-10166027 CCTGGGATGCAGAAGGGGTCAGG - Intergenic
1201297874 Y:12480296-12480318 TTTGGGAGGCTGAAGGGGGTGGG + Intergenic
1201916838 Y:19191036-19191058 ACTGGGAAGCAAAAGGGGTCAGG - Intergenic
1202099177 Y:21287972-21287994 CTAGGGAGGCAGCAGGGGGCAGG - Intergenic
1202139313 Y:21704783-21704805 TTTGGGAGGCAGAGGTGGGCAGG - Intergenic