ID: 944587210

View in Genome Browser
Species Human (GRCh38)
Location 2:201182943-201182965
Sequence GCTTCCTAGAAACGAACCCG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 34
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 32}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944587210_944587212 -7 Left 944587210 2:201182943-201182965 CCACGGGTTCGTTTCTAGGAAGC 0: 1
1: 0
2: 0
3: 1
4: 32
Right 944587212 2:201182959-201182981 AGGAAGCTTTTGCTTTACCTGGG 0: 1
1: 0
2: 4
3: 22
4: 210
944587210_944587211 -8 Left 944587210 2:201182943-201182965 CCACGGGTTCGTTTCTAGGAAGC 0: 1
1: 0
2: 0
3: 1
4: 32
Right 944587211 2:201182958-201182980 TAGGAAGCTTTTGCTTTACCTGG 0: 1
1: 0
2: 1
3: 14
4: 124
944587210_944587213 -6 Left 944587210 2:201182943-201182965 CCACGGGTTCGTTTCTAGGAAGC 0: 1
1: 0
2: 0
3: 1
4: 32
Right 944587213 2:201182960-201182982 GGAAGCTTTTGCTTTACCTGGGG 0: 1
1: 0
2: 0
3: 16
4: 139

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944587210 Original CRISPR GCTTCCTAGAAACGAACCCG TGG (reversed) Exonic
903220454 1:21866273-21866295 GCTTTCTAGAAACTAAACCGTGG + Intronic
905540151 1:38754291-38754313 GCTTCCTAAAATTGAACCCATGG + Intergenic
915574821 1:156768322-156768344 CCTTCCTACAAACGCATCCGTGG + Intronic
923330943 1:232924145-232924167 GCTTGCCAGAAACCAACCCAAGG + Intergenic
1065501243 10:26384827-26384849 GCTTCCTAGCAACTAACCATGGG + Intergenic
1070690446 10:78521092-78521114 GCTGCCAAGAAAGGTACCCGAGG + Intergenic
1078714445 11:13826612-13826634 GCTTCCTGGAAAGGACCCCCAGG + Intergenic
1083278111 11:61608916-61608938 GCTGCTGAGAAACGAACCCTTGG - Intergenic
1088888776 11:114028646-114028668 GCTTCCTAGAAAGGGACTCAAGG - Intergenic
1090421353 11:126577444-126577466 GCATCCTAGAAACTAACCGCTGG + Intronic
1097154838 12:57005200-57005222 GGTGCCTAGAGACGAACCAGAGG + Intronic
1107440912 13:40426313-40426335 GCTTCCTAGGAACCATTCCGTGG - Intergenic
1110384102 13:74888529-74888551 GCTTCAGAGAAAAGAGCCCGTGG + Intergenic
1128620285 15:69143317-69143339 GTCTCCTAGAAACCAACCCAAGG + Intergenic
1134079820 16:11316956-11316978 GCTTCCCAGAAACGAAACTTTGG + Intronic
1142603188 17:1067238-1067260 GCTTCCTGCAAACGAGCCAGAGG + Exonic
1144552759 17:16255864-16255886 GTTTCCTAGAAAAGAAACCAGGG + Intronic
1159582928 18:70253076-70253098 ACTTCCTAGAAATGACCCTGTGG - Intergenic
1159962152 18:74563733-74563755 GCCTCCTAGAAAATAACCCAGGG - Intronic
928128984 2:28635605-28635627 GCTTCCTAGTAGGGAACCCTGGG - Intronic
928910115 2:36411820-36411842 GATTCTTAGAAACGAACCACTGG - Intronic
932100700 2:68896804-68896826 TCTGCCTGGAAACGGACCCGGGG - Intergenic
938200443 2:129368192-129368214 CCTACCTAAAAAGGAACCCGTGG - Intergenic
944587210 2:201182943-201182965 GCTTCCTAGAAACGAACCCGTGG - Exonic
1174363892 20:50044649-50044671 GCTTCCCAGACACAGACCCGAGG + Intergenic
960875991 3:122295811-122295833 GCTGCCTGGAAAAGAACCCCAGG - Intergenic
970991577 4:22219081-22219103 GCTTCCTAGCAACTAGCCTGAGG - Intergenic
1002713922 5:181213463-181213485 GCATCCTCGAAACCAACCTGTGG - Intergenic
1015525563 6:134172713-134172735 GCAGCATAGAAACGAGCCCGTGG + Exonic
1030741229 7:113112387-113112409 GCTACCTAGGAAGGAACCCATGG + Intergenic
1033712483 7:143962535-143962557 GCTTCCTATAAAAGGACCCTTGG + Intergenic
1189221681 X:39377610-39377632 GATTCCTAAAAAAGAACCCAGGG - Intergenic
1193326052 X:80179651-80179673 GCTTCCTAGTAACCATCCTGAGG - Intergenic
1195942768 X:110179197-110179219 TCTTCCTAAAAAGGAACCCATGG - Intronic