ID: 944587468

View in Genome Browser
Species Human (GRCh38)
Location 2:201185344-201185366
Sequence CAAAGCAATCTGGGGGAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 261
Summary {0: 1, 1: 0, 2: 6, 3: 25, 4: 229}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944587468_944587475 27 Left 944587468 2:201185344-201185366 CCTGCCTCCCCCAGATTGCTTTG 0: 1
1: 0
2: 6
3: 25
4: 229
Right 944587475 2:201185394-201185416 GTGCTATTTCTGCCACGTGCTGG 0: 1
1: 0
2: 0
3: 10
4: 92

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944587468 Original CRISPR CAAAGCAATCTGGGGGAGGC AGG (reversed) Intronic
901304326 1:8221694-8221716 CAAAACAATCTGGGGAGAGCTGG + Intergenic
902388956 1:16091697-16091719 CAAAGCCATCTGGGGTGGGTGGG - Intergenic
903221449 1:21871877-21871899 CAAACAGATCTGGGAGAGGCCGG - Intronic
903334419 1:22615433-22615455 CAAAGAAATATGGAGGCGGCTGG - Intergenic
903538338 1:24082162-24082184 CAAAGCCATATGGGGCAGACGGG + Exonic
904225249 1:29012003-29012025 CAAAGCAATCTGCAGTAGTCAGG - Intronic
905293010 1:36935905-36935927 GAAAGCAATCTGAGGGAGTCGGG - Intronic
905975488 1:42171039-42171061 CAAAGCAGGCTGGGGGATGCGGG - Intergenic
906490391 1:46263723-46263745 CAAAGCATTGTGGGAGAGGAAGG + Intronic
907912184 1:58836396-58836418 CAAGTCAACTTGGGGGAGGCTGG + Intergenic
908097025 1:60749818-60749840 CAAATGAATCTGGGGGTGGCTGG - Intergenic
908474908 1:64477927-64477949 CAAAATAATCTGGGGGGGCCGGG - Intronic
908775103 1:67632092-67632114 CAATGCCTTCTGGTGGAGGCAGG + Intergenic
910067900 1:83175330-83175352 CAAAGCAATAAGAGGGAGGCAGG + Intergenic
912186046 1:107276980-107277002 AAGAGGAAGCTGGGGGAGGCTGG + Intronic
912748849 1:112268717-112268739 CAAAGCCTGCTGGGGGAGGATGG - Intergenic
912937539 1:114016747-114016769 CTCAGCACTTTGGGGGAGGCAGG + Intergenic
913578005 1:120196916-120196938 CAAAGCAATCTGGGCGGAGCAGG + Intergenic
913630167 1:120701436-120701458 CAAAGCAATCTGGGCGGAGCAGG - Intergenic
914432129 1:147628453-147628475 CTAAGCAATCTGTGGGACCCAGG - Intergenic
914559921 1:148808336-148808358 CAAAGCAATCTGGGCGGAGCAGG + Intronic
914612912 1:149321879-149321901 CAAAGCAATCTGGGCGGAGCAGG - Intergenic
915225063 1:154405778-154405800 CACCGCAGTCTGTGGGAGGCTGG + Intronic
915597308 1:156902909-156902931 CAGGGCAGTCTGAGGGAGGCGGG + Intronic
916862671 1:168823380-168823402 CCTAGAAATCTTGGGGAGGCAGG + Intergenic
917256713 1:173123798-173123820 GAATGATATCTGGGGGAGGCAGG - Intergenic
917745958 1:178007403-178007425 CAGAGCAAAATGAGGGAGGCAGG + Intergenic
918276120 1:182955218-182955240 CAAAGCATCCTGGAGGAGACAGG - Intergenic
919784467 1:201250599-201250621 CTAGGCACTCTGGGGGAGGGTGG + Intergenic
920252492 1:204630839-204630861 CAAAGCCAGATGGGGGAAGCAGG + Intronic
922481896 1:225945018-225945040 GCAAGACATCTGGGGGAGGCAGG - Intergenic
923019434 1:230151520-230151542 CAGGGCTATCTTGGGGAGGCCGG - Intronic
923569293 1:235099841-235099863 GGCAGCAACCTGGGGGAGGCTGG - Intergenic
1064931590 10:20634453-20634475 CAAAGCAGCCTGGGGGTGGAAGG + Intergenic
1070628412 10:78067457-78067479 CAAAGCAAGCAGGGGAAGCCTGG - Intergenic
1071573162 10:86708952-86708974 GAAAGCCATGTGGGGGTGGCAGG + Intronic
1071696906 10:87886108-87886130 CAAAGCAACATGGAGAAGGCAGG - Intronic
1072537831 10:96376811-96376833 CACAGCCAGCTGGGGGTGGCAGG + Exonic
1073054410 10:100689835-100689857 CAAGGCAATCTGGGAGTGGAGGG - Intergenic
1073287785 10:102398915-102398937 GAAAAAAATCTGGGGGAGGCCGG + Intronic
1073799139 10:107022236-107022258 CAAAGAACTCTGGTGAAGGCCGG + Intronic
1074147659 10:110730804-110730826 CAAAGTCATGTGGGAGAGGCCGG + Intronic
1074290972 10:112137773-112137795 CAAAGCAAACTGGGGAAGAGTGG - Intergenic
1074578872 10:114697072-114697094 CAGGGCACTCTGGGGGAGGAAGG + Intergenic
1074841244 10:117353739-117353761 CAAAGCAAGATGAGGGAGGGGGG + Intronic
1075077359 10:119360104-119360126 CGAGGGAATCTGAGGGAGGCAGG + Intronic
1076527592 10:131122059-131122081 CAAAGCGCCCTTGGGGAGGCTGG - Intronic
1076533063 10:131158539-131158561 CAGAGCCATCTGGGGGCAGCTGG - Intronic
1077700253 11:4434790-4434812 GAGAGCTATCTGGAGGAGGCTGG - Intergenic
1078845195 11:15114104-15114126 CATAGCAAGATGGCGGAGGCGGG + Intronic
1079202626 11:18388476-18388498 CTAAGAAATTTGGGGGAGACAGG - Intergenic
1082938203 11:58676076-58676098 GAAAGGGAGCTGGGGGAGGCTGG + Intronic
1083607704 11:63988640-63988662 CACAGCAATCTGGAGGAGGCAGG - Exonic
1083759904 11:64810136-64810158 CAAGGCAAGCCGGGGGAGGGAGG + Intronic
1084374866 11:68769617-68769639 AAAAGCAATCAGGCGGAGGCAGG - Intronic
1084473043 11:69374387-69374409 CACCTCCATCTGGGGGAGGCGGG + Intergenic
1084580900 11:70022654-70022676 GAAAGCAAGCTAGGTGAGGCTGG - Intergenic
1084650328 11:70485843-70485865 CAAAGCTTTCAGGGGGTGGCAGG + Intronic
1084662523 11:70554551-70554573 CAGAGGAACCTGGGGGAGGGGGG - Intronic
1085062898 11:73464312-73464334 AACAGCAATCTGGGGGTGGGGGG + Intronic
1085307424 11:75495902-75495924 AAAGGCAAACTGGGGAAGGCAGG - Intronic
1089444973 11:118544720-118544742 GACAGCAATCTGAGGCAGGCAGG + Exonic
1090483205 11:127086242-127086264 CATAGCAAACTGGGGGTGGGAGG + Intergenic
1090633738 11:128674462-128674484 CAAAAGAATCTGGGGGATGATGG + Intergenic
1091390794 12:125047-125069 CAAATGAGTCTGGAGGAGGCAGG - Intronic
1091694730 12:2620591-2620613 CAAAGCAATCTAGGGAATGCAGG - Intronic
1091767751 12:3132945-3132967 CGAGACAATCTGGAGGAGGCAGG - Intronic
1091818069 12:3454453-3454475 AAAAGCACTCTAGGGGAGGGGGG + Intronic
1093057023 12:14566157-14566179 CAGAGGTACCTGGGGGAGGCTGG - Intronic
1093125526 12:15323170-15323192 CAAAGCATTCTGTGCGAGGGAGG - Intronic
1096032347 12:48430993-48431015 CACAGCAACCTGGGTGAGACTGG + Intergenic
1100217184 12:92463846-92463868 GAAAAAAATCTGAGGGAGGCAGG - Intergenic
1100959949 12:99951543-99951565 CACAGGTATCTGGGGTAGGCTGG + Intronic
1101651860 12:106684428-106684450 TAAATAAATCTGGGGGTGGCTGG + Intronic
1103015002 12:117487459-117487481 GACAGCAACCTGGGGGATGCAGG - Intronic
1103621329 12:122189168-122189190 CAAAGGAAGCTGGGAGAGGAAGG + Intronic
1106486406 13:30176799-30176821 CAATGGAGTCTGGGGGAGGTGGG - Intergenic
1108920407 13:55666104-55666126 CAAATGAATCTGGGGGAGAGGGG + Intergenic
1110512501 13:76367591-76367613 CAAAGCAATCTTGAGGAAGAAGG + Intergenic
1110602218 13:77388034-77388056 GAAAGCAATCTGGGGGAAGCAGG + Intergenic
1112342176 13:98561724-98561746 CCTAGCACTTTGGGGGAGGCAGG + Intronic
1113208145 13:107941582-107941604 CACAGCAATCTGGGTGTGGGAGG + Intergenic
1117513211 14:56473417-56473439 AAAACCAATTTGGGGGAGGAGGG - Intergenic
1119459200 14:74784800-74784822 CAGAGCAAACTGGGTGAGGTAGG - Intronic
1119495885 14:75078598-75078620 CAAAGCAAGCTGAGACAGGCTGG + Exonic
1120080969 14:80215978-80216000 CAAAGCAACTTGGGGGCGGGAGG + Intronic
1125419594 15:39491140-39491162 TAAAGCTTCCTGGGGGAGGCGGG - Intergenic
1127259856 15:57319761-57319783 CAAAGCAAAGTGGGTGTGGCTGG + Intergenic
1127313145 15:57770172-57770194 GAAGGCATTCTGGGGAAGGCTGG - Intronic
1127342467 15:58062293-58062315 CACAACGATCTGGGGGAGGGAGG + Intronic
1128750841 15:70147945-70147967 CAAAGGAAACTGGGGGCTGCCGG + Intergenic
1129210347 15:74064658-74064680 GAAAGGACCCTGGGGGAGGCAGG - Intergenic
1129288648 15:74546197-74546219 CAAAGCAATCAGTGGGAGGCGGG - Intronic
1129332938 15:74837058-74837080 CAGAGTAACCTGAGGGAGGCTGG + Exonic
1129403673 15:75300744-75300766 GAAAGGACCCTGGGGGAGGCAGG + Intergenic
1130353924 15:83113141-83113163 CAAAGCATGCTGGGGTTGGCAGG - Intronic
1130852322 15:87806604-87806626 CAAAGCCACCTGGGTGAGACTGG - Intergenic
1131098415 15:89670236-89670258 AGAAGCAATCTGGGGGAAGTTGG + Exonic
1133424652 16:5677504-5677526 CAAAGCAACATGAGGGAGGCAGG - Intergenic
1133780741 16:8937251-8937273 ACAAGCAATCTGGGCCAGGCAGG + Intronic
1133853202 16:9525306-9525328 CACAGCAACCTGAGGGAGGAAGG - Intergenic
1135007427 16:18839039-18839061 CAAACCAATGTTGGGCAGGCTGG + Intronic
1137061292 16:35793553-35793575 CACAGCTATCTGGGAAAGGCAGG + Intergenic
1138971754 16:62152738-62152760 CAAAGCAATCTGGAGAATGAAGG - Intergenic
1141116158 16:81311677-81311699 CAAAGCAAACTGTGGGATGTGGG - Intergenic
1141493685 16:84392171-84392193 CAAAACAATCTGGGGTAGACAGG - Intronic
1142229952 16:88895499-88895521 GGAGGCAATCTGGGGGAGCCGGG - Intronic
1142677115 17:1520729-1520751 CAAAGCAGCCTCGGGGAGGCTGG - Intronic
1142839055 17:2613190-2613212 GAATGCAAGCTGTGGGAGGCAGG + Intronic
1143335437 17:6168654-6168676 CAAGGCATTTTGGGGGAGGGGGG + Intergenic
1143548672 17:7615141-7615163 CCAACCAATCAGGGGGAGGGAGG + Intronic
1143563554 17:7708761-7708783 CAGAGGAAGCTGGGGAAGGCAGG - Intronic
1146300048 17:31680844-31680866 AAAAGCAATATGGGGCAGGCAGG + Intergenic
1148127568 17:45244805-45244827 CAGGACAATCTGGGAGAGGCAGG - Exonic
1148892642 17:50819287-50819309 CAAAGTAACGTGTGGGAGGCTGG + Intergenic
1149041036 17:52188306-52188328 GAATGCACACTGGGGGAGGCTGG - Intergenic
1151291801 17:73155961-73155983 AAAAGCTATCTGGGGGTGGCGGG - Intergenic
1151724707 17:75877358-75877380 CAAAGGAAACTGGGGGCGGGAGG + Intronic
1152393817 17:80019446-80019468 CAGAACAATCTGGGAGGGGCGGG - Intronic
1152476459 17:80521555-80521577 CAAAGCAATCTGGGAGTCTCAGG - Intergenic
1152625001 17:81384054-81384076 CAAACCGCTCTGGGGGAAGCTGG + Intergenic
1153085242 18:1278567-1278589 CAAAGCCATCTGGAGGAGCATGG - Intergenic
1154194278 18:12254430-12254452 CACGGCAATCAGGGGGACGCGGG - Intronic
1154355373 18:13620290-13620312 TGCAGGAATCTGGGGGAGGCAGG - Intronic
1156700046 18:39815021-39815043 CAAACCAAACTGGGGGTGGAAGG - Intergenic
1159501996 18:69284018-69284040 CAAAGCAGTTTGGGGGAAGTGGG - Intergenic
1159827139 18:73227292-73227314 AGAAGCAACCTGGGCGAGGCAGG - Intronic
1161558041 19:4955445-4955467 GAAAGCATCCTGGGTGAGGCGGG - Intronic
1162497410 19:11030979-11031001 CAAGACAATGTGGAGGAGGCTGG - Intronic
1163146945 19:15386529-15386551 CACACTAAGCTGGGGGAGGCAGG - Intronic
1164724574 19:30457561-30457583 GAGAGCACTCTGGGGGACGCAGG + Intronic
1164906616 19:31973465-31973487 CAGAGCCATCTGGAGGATGCTGG + Intergenic
1164933145 19:32190775-32190797 CAAGGGAATTTGGGGGGGGCGGG - Intergenic
1164983378 19:32630623-32630645 CACAGCACGCTGGGGGAGGTGGG + Intronic
1166098357 19:40555524-40555546 GAAAGGAAACTGGGTGAGGCTGG + Intronic
1166684842 19:44790132-44790154 CAAGGCAACGTGGGGGTGGCAGG - Intronic
1168411322 19:56141753-56141775 CAAAGGAGTCTGGGGGCGCCGGG + Intronic
1168435516 19:56314263-56314285 CCAAGCGAACTGCGGGAGGCAGG + Intronic
925217410 2:2109328-2109350 CACAGGAATCTGGAGGGGGCTGG - Intronic
931717087 2:65037799-65037821 TAGAGCCATCTGGGTGAGGCAGG - Intergenic
932707691 2:74039313-74039335 CAAAGAAATCTCAGAGAGGCTGG - Intronic
935175099 2:100642443-100642465 CACAGCCCTCTGGGGGAGGCAGG - Intergenic
935654503 2:105410197-105410219 AAAAGGAATCAGGCGGAGGCCGG + Intronic
935744862 2:106181420-106181442 CAAAGAAAGCTGGGGCAAGCGGG + Intronic
936847124 2:116850598-116850620 TAAATGAATCTGGGGGAGGTGGG - Intergenic
937497187 2:122433029-122433051 GGCAGCAATCTGGGGGAAGCAGG + Intergenic
938303510 2:130232056-130232078 GAAAGAAAGCTGTGGGAGGCAGG + Intergenic
938399271 2:130975540-130975562 CAAGGCAAAGTGGGGCAGGCAGG - Intronic
938453167 2:131442200-131442222 GAAAGAAAGCTGTGGGAGGCAGG - Intergenic
939521910 2:143241958-143241980 TAAAGCAATCTGTGGGAGGAAGG + Intronic
944587468 2:201185344-201185366 CAAAGCAATCTGGGGGAGGCAGG - Intronic
946022510 2:216650776-216650798 CAAAGGAAACTGGGAGAGGAGGG + Intronic
947569826 2:231224334-231224356 CCCAGCTATCTGGGGGAGACAGG + Intronic
948336202 2:237209217-237209239 CAGAACACTCTGGAGGAGGCAGG - Intergenic
948715865 2:239862820-239862842 CCAAGCAATGTGGGAGAAGCTGG + Intergenic
1169233380 20:3908771-3908793 GAAAGCATTCTGGGAGAGGAGGG - Intronic
1169665848 20:8034582-8034604 CAAAGCAATATGGATAAGGCTGG + Intergenic
1170093218 20:12616422-12616444 GGAAGCAATCTGGTGGGGGCTGG - Intergenic
1172478167 20:35254255-35254277 CAAAGCCATCTGACTGAGGCAGG + Intronic
1172657263 20:36544782-36544804 AAAGCCAGTCTGGGGGAGGCAGG + Intronic
1172705629 20:36880344-36880366 CCCAGCACTTTGGGGGAGGCTGG - Intronic
1172823901 20:37763598-37763620 CAAACCAAGCTTGAGGAGGCAGG - Intronic
1172902066 20:38342581-38342603 CAAAGCTCTCTGCGAGAGGCAGG + Intergenic
1172989298 20:39021102-39021124 CAAAGCACGCTGGGGGCTGCTGG - Intronic
1173834029 20:46113454-46113476 TACAGCAATCTTGGGGAGGAAGG + Intergenic
1174983335 20:55421719-55421741 GACGGCATTCTGGGGGAGGCTGG - Intergenic
1175268399 20:57716541-57716563 CAGAGCGATTTAGGGGAGGCTGG + Intergenic
1180022422 21:45136725-45136747 CCAAGCAACCTGGGGGAGAGCGG - Intronic
1182146467 22:27999691-27999713 CAAGCCAATCTTGGGGAGACAGG + Intronic
1183064851 22:35355798-35355820 CAAAGGACCCTGGTGGAGGCTGG + Intergenic
1183781776 22:40003461-40003483 CAATCCAAGCTGGGGGAGGTGGG + Intronic
950015267 3:9750498-9750520 CAAAGGAATTTGGGGGATGATGG + Intronic
950958008 3:17075649-17075671 CAATGCAATTTGGGGGAGCAGGG - Intronic
951541110 3:23782971-23782993 GAAACCACTCTGGGGCAGGCTGG + Intergenic
951855346 3:27190354-27190376 CAAAATAATCTGGGGAAGGAAGG + Intronic
952509561 3:34039391-34039413 CAAAGCATCCTGTGGTAGGCAGG - Intergenic
952560453 3:34586732-34586754 CAAAGCCATCTGGGGAATGCTGG + Intergenic
955411012 3:58655413-58655435 GAAAGCAATCCAGGGGAGGCTGG - Intronic
956254297 3:67267128-67267150 CAATCCAATCTGATGGAGGCTGG - Intergenic
956774064 3:72550365-72550387 CACCGGAAGCTGGGGGAGGCAGG - Intergenic
961521260 3:127468588-127468610 CACAGGAATATGGAGGAGGCAGG + Intergenic
962203844 3:133419282-133419304 CACAGGAATTTGGGGGAGGAAGG + Intronic
963060833 3:141223888-141223910 AAAAGCAAGCGGGGGGAGGGGGG + Intergenic
969451088 4:7273831-7273853 CCAAGCAGCCTGGGGGAGGGAGG - Intronic
971481609 4:27119680-27119702 CAAATCCCTCTGGGAGAGGCTGG - Intergenic
972036907 4:34535168-34535190 CAAAGCAATGAGGGCAAGGCAGG - Intergenic
972496479 4:39639148-39639170 TGAAGCAATCGGGGCGAGGCCGG + Intergenic
973639032 4:52885414-52885436 CAAAATAATCTGGGGCAGGGTGG - Intronic
975265181 4:72355345-72355367 CAAAACAATGTGGGGGTGGAGGG + Intronic
976456025 4:85247568-85247590 CAGAGCAAAATGAGGGAGGCAGG - Intergenic
977916670 4:102601840-102601862 AAAAGCAATCAGGGGCAGGAAGG - Intronic
979847930 4:125540368-125540390 TAATACAATATGGGGGAGGCAGG + Intergenic
980488901 4:133499146-133499168 TAAAGCATTCTGGGGGCAGCGGG - Intergenic
980962701 4:139492139-139492161 CAAAACAAGCAGGGTGAGGCTGG - Intergenic
981237374 4:142434961-142434983 CAAAGCAATCCTGGGGCCGCAGG + Intronic
981719528 4:147787513-147787535 CTAAGGAATCTGGGGGACTCTGG + Intronic
983187217 4:164713825-164713847 CACAGCAATGTTGGGGAGGGTGG - Intergenic
983279779 4:165665650-165665672 CTTAACCATCTGGGGGAGGCAGG - Intergenic
984967259 4:185150267-185150289 CAAAGCACCATGGGGGTGGCTGG + Exonic
985062397 4:186092394-186092416 CAGAGCAGTCTTGCGGAGGCTGG + Intergenic
986026899 5:3859460-3859482 CACAGGAATCTGGAGGAGCCAGG + Intergenic
986446206 5:7823753-7823775 AAAAGCAATTTGAGTGAGGCAGG + Intronic
988596058 5:32592242-32592264 GAAAGCAACTTGGAGGAGGCAGG + Intronic
992417640 5:76566933-76566955 CCAAGCAGACTGGGGCAGGCAGG + Intronic
994965948 5:106670661-106670683 GAAAGCAAATAGGGGGAGGCTGG + Intergenic
998258726 5:140611302-140611324 AAAAGCAGACTGGGGGTGGCGGG - Intergenic
998785862 5:145708103-145708125 CAAAGCACTCTTGGGGTGGTTGG + Intronic
1000379905 5:160619772-160619794 AAAATCCATCTGGGGGAGGCTGG + Intronic
1001418172 5:171563664-171563686 CAAAGCAATTTGGTGGAGAAAGG - Intergenic
1003495728 6:6661518-6661540 CAAAGCAAACTGGGGAGGGGGGG + Intergenic
1004713103 6:18191249-18191271 CAAAGCCCTCTGTGTGAGGCCGG + Intronic
1006447601 6:34088588-34088610 CAATGCAAGCTGGAGGAGACAGG + Intronic
1007480357 6:42145693-42145715 CAGAGCAATTTGGGGGCTGCAGG + Intergenic
1007642536 6:43353983-43354005 CCCAGCACTCTGGGAGAGGCTGG + Intronic
1009442639 6:63699883-63699905 GAAAGAAACCTGAGGGAGGCCGG - Intronic
1010631874 6:78207973-78207995 CAAAGCATTCAAGAGGAGGCAGG - Intergenic
1010882828 6:81200904-81200926 CAAAGCATTCGAGGGGAAGCAGG + Intergenic
1013011192 6:106122077-106122099 CATAGCAATACTGGGGAGGCGGG + Intergenic
1013253511 6:108359482-108359504 CAAAGCAATCTGGACAGGGCAGG - Intronic
1013303181 6:108823122-108823144 CAGAGGATTCTGGGGGAAGCAGG - Intergenic
1016760607 6:147732160-147732182 CAAAGCAAAATGAGGGATGCTGG - Intronic
1018468955 6:164079824-164079846 CAAAGGCATCTGAGGGAGCCTGG - Intergenic
1018646383 6:165952610-165952632 CTAAGAAATCTGGGAGAGGCAGG + Intronic
1019521952 7:1464845-1464867 CACAGCAATCAGAGGCAGGCTGG - Intergenic
1019759231 7:2797056-2797078 CAGAGCAATCTGAGGGACTCAGG + Intronic
1021626513 7:22598830-22598852 GCCAGCAACCTGGGGGAGGCAGG - Intronic
1022728942 7:33005084-33005106 CAGAGCAGTCTGGGGGTGACAGG - Intronic
1024377530 7:48656321-48656343 CAAAGCCACCTGGAGGATGCTGG - Intergenic
1025044704 7:55682894-55682916 CAGAGCAGTCTGGGGGTGACAGG + Intergenic
1027276194 7:76559432-76559454 AAAAGCAATAAGAGGGAGGCAGG - Intergenic
1028787407 7:94811346-94811368 CAAAGCAATCCTGGGGAGGCAGG + Intergenic
1029576096 7:101404431-101404453 CAAAGCCATTTGGGGGGGGAGGG - Intronic
1030811563 7:113978775-113978797 CCCAGCACTCTGGGAGAGGCAGG + Intronic
1032445206 7:131976420-131976442 CAAAGCCAACTGGGGGAGGCTGG + Intergenic
1037480493 8:19300857-19300879 CAAAGCAAACTGTGGGTGACAGG + Intergenic
1037579984 8:20239377-20239399 CAAAGCAAGCTGGGGGTGGCGGG - Intergenic
1042311966 8:67387790-67387812 CAAAGAAATGGGGGTGAGGCCGG - Intergenic
1043818878 8:84838965-84838987 AAAAACAATTTGGGGGCGGCAGG + Intronic
1045832759 8:106483820-106483842 CAAGGTTATCTGGGGGAGGTTGG - Intronic
1048279233 8:133092744-133092766 CAAAGCACTCGGGGGCAGGAGGG - Intronic
1051133509 9:13891019-13891041 AGAAGCAAGCTGGGTGAGGCTGG - Intergenic
1051536977 9:18170287-18170309 AAAAGGAAGCTGGGGAAGGCTGG + Intergenic
1051800964 9:20933493-20933515 CACAGCAATCTGGATGAGACTGG - Intronic
1053066740 9:35074408-35074430 CACTGCACTCTGGTGGAGGCTGG - Exonic
1054949121 9:70830083-70830105 CAAAGCAGTCTGTGAGAGGCAGG + Intronic
1054969260 9:71066064-71066086 CAAAGCAATCTGGGTGACTAGGG - Intronic
1057144713 9:92749941-92749963 CACAGCAGTCTGGGCCAGGCTGG + Intronic
1058373311 9:104294794-104294816 TAAAGCATCCTGGGGGAAGCAGG + Intergenic
1061163044 9:128906934-128906956 GAAACCACCCTGGGGGAGGCAGG - Intronic
1061362581 9:130153072-130153094 CATAGGAATTTAGGGGAGGCCGG + Intergenic
1061973387 9:134056514-134056536 CAAGGGCTTCTGGGGGAGGCAGG - Intronic
1062439533 9:136563505-136563527 CAGAGCCAGCTGGGGCAGGCTGG + Intergenic
1185545082 X:936931-936953 CAAAGCAATATGGGCTTGGCTGG + Intergenic
1186325366 X:8471117-8471139 GAAAGCAAGCTGAGAGAGGCAGG - Intergenic
1186971284 X:14847081-14847103 CAAAATAATCTGGGGGATGGGGG + Intronic
1188446635 X:30259608-30259630 CACAGCAATCTCTGGGAGGCGGG - Intergenic
1188493045 X:30756104-30756126 CAAAGCAATGTGGGGTTGGCTGG - Intergenic
1189768083 X:44392490-44392512 CAAACCCATGTGGAGGAGGCAGG + Intergenic
1193622481 X:83772592-83772614 AAAATCCATCTGGGGAAGGCAGG - Intergenic
1193927510 X:87506240-87506262 TAAAGAAATATGGGAGAGGCCGG - Intergenic
1199220396 X:145309997-145310019 CAAAGCATTCTAGAGGAAGCAGG - Intergenic