ID: 944593037

View in Genome Browser
Species Human (GRCh38)
Location 2:201236196-201236218
Sequence CTAAATGCCTAAAAGGAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 227
Summary {0: 1, 1: 0, 2: 0, 3: 31, 4: 195}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944593037_944593040 11 Left 944593037 2:201236196-201236218 CCCTGCTCCTTTTAGGCATTTAG 0: 1
1: 0
2: 0
3: 31
4: 195
Right 944593040 2:201236230-201236252 TTCTCCTAGCCTTGCTTTAGCGG 0: 1
1: 0
2: 1
3: 8
4: 145

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944593037 Original CRISPR CTAAATGCCTAAAAGGAGCA GGG (reversed) Intronic
905984463 1:42266428-42266450 CCACATTCCTAAGAGGAGCAAGG + Intronic
907955871 1:59227743-59227765 CTTAATGCCAAAATTGAGCAAGG + Intergenic
910447042 1:87309451-87309473 TTAGATGCCTAAAAAGAGAAAGG + Intergenic
910727193 1:90351483-90351505 CTCAAGGCCTTAAAGGAGCAGGG - Intergenic
911874824 1:103147294-103147316 TTAACTCCCTAAAAAGAGCATGG + Intergenic
915942919 1:160130246-160130268 CAAAATGCCTACATGGAGCTGGG + Exonic
916591285 1:166193306-166193328 TTAGATGCATAAAAGGGGCAAGG + Intergenic
917492829 1:175512940-175512962 CTAAATGACTGAATGGACCAAGG + Intronic
918511008 1:185314701-185314723 CTCACTGCCTTAAAGGAGCATGG - Intronic
920703982 1:208238539-208238561 ATAACTGCCTAACAGGGGCATGG - Intronic
921060970 1:211584122-211584144 CTAAATGCCACAAAAGAGCCGGG - Intergenic
922535293 1:226375415-226375437 CTAAATGACTAACAGGAGGCAGG + Intronic
923294487 1:232580503-232580525 TAAAATGCCTGACAGGAGCATGG + Intergenic
924503175 1:244655540-244655562 CTAAATTCCTTAAAGAAGAAAGG - Intronic
1064441730 10:15359898-15359920 CTGAATTCCAAAAAGGAACATGG + Intronic
1065479148 10:26175313-26175335 TTAAATGCCTAGAAAGAGAAAGG - Intronic
1067459122 10:46444484-46444506 CTAAGTGCCCAACAGGAACAAGG + Intergenic
1067628074 10:47940146-47940168 CTAAGTGCCCAACAGGAACAAGG - Intergenic
1069600550 10:69703493-69703515 CTAAATTCCTGAAAGGCACATGG - Intergenic
1071804283 10:89099799-89099821 GTCAATGACTCAAAGGAGCAAGG + Intergenic
1074038792 10:109767521-109767543 TGATATGCCCAAAAGGAGCAAGG + Intergenic
1076640663 10:131914582-131914604 CTAAATGCCTAAAAGTAGTGAGG + Intronic
1079930161 11:26548858-26548880 GGAAATGCCGAAAAGGAGGATGG - Intronic
1080045275 11:27801437-27801459 CTAAATTCCAAAAGGGAGGAGGG + Intergenic
1080500099 11:32862464-32862486 CTAAAAACCTGAAAGGAACAAGG - Intergenic
1082755869 11:57075793-57075815 TTAAATACCTAAAAAGAGAAAGG + Intergenic
1083143062 11:60737580-60737602 ATAAATGCCCCAAAGGTGCAAGG - Intronic
1086284967 11:85237253-85237275 CTAAATGGCAAAAAGGAGGGTGG + Intronic
1090279053 11:125440760-125440782 CTTATCTCCTAAAAGGAGCATGG - Intergenic
1092687172 12:11062748-11062770 CTAAATTCTTAAAAGGAGCTTGG + Intronic
1093439259 12:19174182-19174204 GTAAATGCCTGTAAGGGGCATGG + Intronic
1095657697 12:44689639-44689661 CTAAATAAAGAAAAGGAGCATGG - Intronic
1096219660 12:49821104-49821126 CTACAGGCCTTGAAGGAGCAAGG - Intronic
1098527541 12:71503037-71503059 CTTATTTCCTAAAAGGATCAAGG - Intronic
1103262383 12:119598615-119598637 CTAAATGCCTTCAAGGGGAATGG + Intronic
1106086087 13:26543092-26543114 AGAAATGCCTTAAAGAAGCAGGG - Intergenic
1107205511 13:37781019-37781041 TCAAATGCCTATAAGGAGCCAGG + Intronic
1108299037 13:49055448-49055470 CTAAATTCCAAAAGGGAGGAGGG - Intronic
1108390969 13:49947335-49947357 CTGAATTCCAAAAAGGAGAAGGG - Intergenic
1111286529 13:86100433-86100455 CTAAATGGCAAAAATGAACAAGG - Intergenic
1117873524 14:60225458-60225480 CTTAAAGCCTCAAAGGAACAGGG - Intergenic
1119243540 14:73083179-73083201 CTAAATGCCTAAAATTAGAATGG - Intronic
1119522299 14:75294986-75295008 TTAAGCGCCTAATAGGAGCAAGG - Intergenic
1121319502 14:92982836-92982858 TTAGATGCCTTCAAGGAGCAGGG - Intronic
1121531877 14:94660315-94660337 GTAAATCCCTAAATGAAGCATGG - Intergenic
1202888194 14_KI270722v1_random:128442-128464 CTTAATGGCTTAAAGGAACATGG - Intergenic
1123454167 15:20402110-20402132 TTAATTGCCTAAAAGGATCATGG - Intergenic
1125984404 15:44035828-44035850 TTAAATGCCTCAAAGTAGCATGG - Intronic
1126044992 15:44631229-44631251 CTAAATGTCTAACAGGAGTTTGG + Intronic
1127901254 15:63342605-63342627 CTAAATTCCAAAAGGGAGGAGGG + Intronic
1128455418 15:67828888-67828910 GAAAATGCCTAAAAGGAGGCGGG + Intronic
1130629787 15:85555196-85555218 CTAAATGCCAGAAAGGGGTAGGG - Intronic
1133514731 16:6497486-6497508 CAAAATGCCGCAATGGAGCAAGG + Intronic
1134042629 16:11080224-11080246 CTAGATGCCTGAAGGGAGGAGGG - Intronic
1135781197 16:25302304-25302326 CTAAATGTTTAAAATCAGCATGG - Intergenic
1137297768 16:47112991-47113013 CTAAATGCCCAATAGGAGAATGG - Intronic
1137421947 16:48342393-48342415 CTAAATGCCTCAAAGAATCATGG + Intronic
1139048578 16:63095042-63095064 TTGTATGTCTAAAAGGAGCATGG - Intergenic
1139362601 16:66410137-66410159 CTAAATGGCTAAATGCAGCAGGG + Intergenic
1143455551 17:7065398-7065420 CAAAATGCCTAAAAGCAGGATGG + Intergenic
1144192896 17:12862336-12862358 CTCAATGACTAAAACGTGCAAGG - Intronic
1146287546 17:31584401-31584423 CCAAATACCCAAAAGGAGAAAGG - Intergenic
1146892192 17:36513456-36513478 GTCAATGCCCAAATGGAGCATGG + Exonic
1147451153 17:40505314-40505336 TTCAATCCCTGAAAGGAGCATGG - Intergenic
1148594399 17:48841391-48841413 CTAAATGACTTAAATAAGCAAGG - Intronic
1149577195 17:57722644-57722666 CTAAATGCTTAAAAGATGCAAGG + Intergenic
1151112434 17:71694605-71694627 CTCAATGCCTAACTGGATCAAGG + Intergenic
1151601855 17:75110627-75110649 CTAGATGCCTAAATGGGCCAGGG + Intronic
1151685045 17:75641265-75641287 ATACATGCCAAAGAGGAGCAAGG + Exonic
1158652924 18:59303782-59303804 CTACATGTCTACAGGGAGCATGG - Intronic
1158773093 18:60544955-60544977 CTACAACCCTCAAAGGAGCAGGG - Intergenic
1160070545 18:75624317-75624339 CTAAATGGCTAGAAAAAGCATGG - Intergenic
1161876614 19:6916234-6916256 CTCAATGTCTAAAAAGAGAAAGG - Exonic
1162366800 19:10254641-10254663 GTGAGTGCCTAAATGGAGCAAGG + Intronic
1167817822 19:51899455-51899477 CTAATTGCCTAAAAAATGCAAGG - Intronic
1167923554 19:52804664-52804686 CTAAATGCCAAAAATGGGCTAGG - Intronic
1167933136 19:52884611-52884633 CTAAATGCCAAAAATGGGCCAGG - Intronic
1167936262 19:52911172-52911194 CTAAATGCCAAAAATGGGCCAGG - Intergenic
1202663590 1_KI270708v1_random:95237-95259 CTTAATGGCTTAAAGGAACATGG - Intergenic
926481120 2:13397108-13397130 TTAATTGCCTAAAAGGATCATGG + Intergenic
927959321 2:27230891-27230913 CAATATGCCTAAAACGGGCATGG - Intronic
929920567 2:46168459-46168481 CGAAAGGCATAAAAGGAGAAAGG + Intronic
930394837 2:50808537-50808559 TCAAATGTCTAAAAGGACCAGGG + Intronic
930892866 2:56411491-56411513 ATAAATGCCTAGAGGGAGCAGGG + Intergenic
931137780 2:59423448-59423470 ATAAATGACAAAAAGGAGGAAGG - Intergenic
932584984 2:73022097-73022119 CTGACTGCCTAAAAGGGGCAGGG + Intronic
935466153 2:103400409-103400431 CTATATGCTTAAAAGGAAGATGG + Intergenic
935895825 2:107736391-107736413 CTACATCCCTAAAATGAGCTAGG - Intergenic
938149264 2:128867994-128868016 CCAAATGCAAAAGAGGAGCAGGG - Intergenic
939109062 2:137985135-137985157 CTATCTGCCTAAAACGTGCATGG + Intronic
939874883 2:147566436-147566458 GTAAAAGACTAAAAGTAGCATGG + Intergenic
940464144 2:154007311-154007333 CTAAACTCCAGAAAGGAGCAAGG + Intronic
940733331 2:157419834-157419856 TTAAATGCTTAAGAGGAACATGG + Intronic
941858474 2:170254206-170254228 CTAAATGTCTATAGGGATCATGG - Intronic
943079656 2:183242966-183242988 CTGAATGACTAAAGGGAGCACGG + Intergenic
943086164 2:183313959-183313981 GTACAGGCCTAAAAGGAGCTAGG + Intergenic
944465791 2:199998149-199998171 CTAAATATTTAAAAGGATCAAGG - Intronic
944593037 2:201236196-201236218 CTAAATGCCTAAAAGGAGCAGGG - Intronic
944973114 2:205016753-205016775 CTAAATGCCTAAAAGAACAGTGG - Intronic
945920288 2:215748752-215748774 CTGAATGCCTAAATGAAGCCGGG + Intergenic
948505530 2:238424999-238425021 CTAAATGCCCACATGGTGCAGGG - Intergenic
1171954745 20:31452531-31452553 CTAACTGCCTAACAGAAGAAAGG + Intergenic
1173242946 20:41313890-41313912 TTAAAGGCCTAAAAGGAGGCTGG - Intronic
1173297204 20:41770323-41770345 GTAAATGCCTTATATGAGCAGGG - Intergenic
1174448653 20:50607080-50607102 CAAAATGCAGAAAAGGAGCAGGG - Intronic
1177286753 21:19061576-19061598 ATAAATACATAAAAGGAGTAAGG - Intergenic
1179277114 21:39902140-39902162 CTACATGTCTTGAAGGAGCAAGG + Intronic
1180237099 21:46469196-46469218 TAAAATGCCTAAAATGTGCAAGG - Intronic
1180330323 22:11472118-11472140 CTTAATGCCTTAAAGGAACATGG - Intergenic
1181482650 22:23210628-23210650 AGAAATGCCTACAAGGAACAAGG - Intronic
1184025313 22:41851469-41851491 CAAAAAGACTAAAAGAAGCAGGG - Intronic
950814637 3:15687396-15687418 CCAAATGCATAAAATGGGCAAGG + Intronic
951550980 3:23874843-23874865 CCAAGTGCCTGAAAGAAGCAGGG - Intronic
953593695 3:44286229-44286251 CTTAATGACAAAAAGGAGAAAGG + Intronic
955075794 3:55611799-55611821 CAAAATGCCTAAAAGAACTAGGG - Intronic
955706030 3:61728733-61728755 CCATATGCTTAAAAGGACCAGGG + Intronic
956069061 3:65428607-65428629 ATAAATACCTAAAAGGAGTCAGG + Intronic
956237720 3:67093080-67093102 CTCAATGCCTAAGAGGACAATGG + Intergenic
956579083 3:70790727-70790749 CTAAATACCTCACAGCAGCATGG + Intergenic
958012118 3:87892932-87892954 TTAAATTCCTGAAAGGAGAAGGG + Intergenic
959130137 3:102344753-102344775 CTAAATGACAAGAAGGAGCCTGG + Intronic
959382230 3:105654684-105654706 TTGTAAGCCTAAAAGGAGCAAGG - Intergenic
959562847 3:107802234-107802256 CTGGATGTCAAAAAGGAGCATGG - Intronic
962154502 3:132931715-132931737 CTAAATACCTCACAGCAGCATGG + Intergenic
962857617 3:139363183-139363205 CTTAATGCCTTAATGGAGCATGG - Intronic
963425735 3:145120344-145120366 CAAAATGTGTAAAAGAAGCAGGG - Intergenic
963733602 3:148994358-148994380 CTCAATTCCTGAAAAGAGCATGG - Intronic
966214372 3:177486949-177486971 CTAAATACATAAAAGTAGCCAGG - Intergenic
966410069 3:179638506-179638528 CAAAATACCTAAAAGGGGCTGGG - Intergenic
966718212 3:183035072-183035094 CCAAATGCCTATAAGGGGCCAGG - Intronic
969272453 4:6112051-6112073 CTAAATTCCAAAAGGGAGTAGGG - Intronic
971829183 4:31668242-31668264 TTAAATTCCTGAAAGCAGCATGG - Intergenic
974105394 4:57464202-57464224 CTAGAAGCAAAAAAGGAGCATGG - Intergenic
974676624 4:65098629-65098651 GTAAATGCCTAAAAGCAGAATGG + Intergenic
976323591 4:83745880-83745902 GTAAATGCCTAAAAATAGAATGG - Intergenic
977465406 4:97378254-97378276 CTAGATGACAAAAAGGAGGAAGG + Intronic
981010395 4:139919328-139919350 GCAAATGCCTTAAAGGAGCTAGG + Intronic
981711575 4:147714096-147714118 CTAAATTCCTAAAAGCATTAGGG + Intergenic
981958867 4:150511360-150511382 CTATATGACTAAAAGCAGAAGGG - Intronic
982765331 4:159340851-159340873 CAAATTGCCTAAAAGGAAAAGGG + Intronic
985659044 5:1146602-1146624 CTAAATTCCGAAAGGGAGGAGGG - Intergenic
985751142 5:1676246-1676268 CTAAAAGCCAAAAAAGAGAAGGG + Intergenic
987828757 5:23068146-23068168 GTGAATGCCTAAAAGGGGAATGG - Intergenic
988783722 5:34546710-34546732 CTAAATTCCTAAAATTAGCTTGG - Intergenic
989118883 5:37983576-37983598 CTGAATTCCTAAAAGGAACAGGG - Intergenic
990069784 5:51766997-51767019 CTAAATGCATAAAAATAGAAAGG - Intergenic
991329562 5:65479161-65479183 TTAAACACCTGAAAGGAGCATGG - Intronic
992416794 5:76559588-76559610 CTAAAGGCATAAAAGAAACATGG - Intronic
992697253 5:79302382-79302404 CTAAAAGACTAGGAGGAGCAGGG - Intronic
992956220 5:81911289-81911311 CTAACTGCCTTAAAGGAGGTAGG - Intergenic
994474200 5:100246664-100246686 ATAAATGCCTAAAAAGAACAAGG + Intergenic
996914231 5:128693314-128693336 CTACATGGTTAAAAGGAGTAGGG + Intronic
998517387 5:142769002-142769024 TTAAATTCATAAATGGAGCATGG - Intergenic
999568585 5:152893098-152893120 CTATATGCCTCAAAGGATGATGG + Intergenic
999771075 5:154775925-154775947 TTAAATGCACAAAAGGGGCACGG + Intronic
1003021746 6:2515683-2515705 CTAAAAGCCTGAACGGAGTAAGG - Intergenic
1003543866 6:7041981-7042003 CTAAATTCCTTAAAAGAGCATGG + Intergenic
1004519217 6:16346498-16346520 CTAAATGCAAAGAGGGAGCAAGG - Intronic
1006747807 6:36357188-36357210 CTGAAAGCCTAAAAGGTCCAGGG + Intronic
1007968805 6:46029869-46029891 TTTAATCCCTAACAGGAGCAGGG - Intronic
1008077810 6:47163896-47163918 CTAAATGGCTAAAAATAGGAAGG + Intergenic
1008184926 6:48376856-48376878 TGAAATGCCTAAAATGACCAAGG + Intergenic
1009042186 6:58191797-58191819 ATGAATACCTAAAAGGAGCAAGG - Intergenic
1009218023 6:60946031-60946053 ATGAATACCTAAAAGGAGCAAGG - Intergenic
1010542405 6:77108089-77108111 GAAAATGCCTTAAAGGAGAAAGG + Intergenic
1010920084 6:81670233-81670255 CTAAATCCCTAAAATGAAAATGG + Intronic
1011566733 6:88682182-88682204 TTAAAAGTTTAAAAGGAGCAAGG + Intronic
1012832691 6:104225575-104225597 TTAAATACCTTAGAGGAGCAAGG + Intergenic
1015210147 6:130687517-130687539 GTAAATGCTAAAAAGAAGCAAGG - Intergenic
1015221199 6:130805509-130805531 ATAAATGCCTAAAGGTAGAAAGG + Intergenic
1015714800 6:136181358-136181380 ATAAATGCCTAAAAGAAGACAGG - Intronic
1015975938 6:138790744-138790766 TTAAATGCCTTCAAGGACCATGG + Intronic
1016125320 6:140395164-140395186 CTTAATGCCTATAATGAGAAGGG - Intergenic
1016427485 6:143949790-143949812 ATAAATGACTGCAAGGAGCAGGG - Intronic
1016628286 6:146198350-146198372 CTAAATTCCTAAAGGAGGCAGGG - Intronic
1017045299 6:150341639-150341661 CTAAATGGATAAAAAGAGAAAGG - Intergenic
1018326731 6:162678309-162678331 GTAAATGTCTAAAAGTAGAATGG + Intronic
1018492837 6:164313363-164313385 ATATATGCCTAAAAGTAGAATGG - Intergenic
1018999102 6:168732590-168732612 ATAAACGCCTGAAAGAAGCAAGG + Intergenic
1023435606 7:40137568-40137590 CTAGAAGCTTAAAAAGAGCATGG - Intronic
1027799486 7:82733840-82733862 CTAAAAGCGTAAAAGGGTCATGG - Intergenic
1027900931 7:84113654-84113676 TTAAATTCCAAAAAGGATCAAGG - Intronic
1028711091 7:93909244-93909266 TTAAATGCCTAAGAGGTGCCTGG - Intronic
1029928834 7:104348863-104348885 ATAAATGTCTAAATGGAGCAGGG - Intronic
1030002119 7:105076028-105076050 CGAAATGCCTAAAATAAACATGG - Exonic
1031943178 7:127811175-127811197 CTAAGTGCCTAAAAAGAGCTGGG - Intronic
1032588889 7:133174328-133174350 GTAATTTCCTAAAAGGAGCAGGG - Intergenic
1032598607 7:133268806-133268828 CTAAAGGGCTAAAAGGACCACGG - Intronic
1033665127 7:143433539-143433561 CTAAATGCTCGAATGGAGCAAGG + Intergenic
1034286909 7:149890802-149890824 CTAAATTCTTAAAAAGTGCAAGG + Intergenic
1034307315 7:150054762-150054784 TGAAATGCCTACAAGAAGCATGG - Intergenic
1034468361 7:151242949-151242971 CTACATGCCCAAAAGTAGGATGG - Intronic
1034664211 7:152802097-152802119 CTAAATTCTTAAAAAGTGCAAGG - Intronic
1034799533 7:154045919-154045941 TGAAATGCCTACAAGAAGCATGG + Intronic
1035865879 8:3081064-3081086 CCAAATGGCTACAAGGGGCAGGG + Intronic
1038333507 8:26628324-26628346 CTAAATGCCTAGAAGGCGTGTGG + Intronic
1038442780 8:27583527-27583549 CTAACTGCCTGAAAGGTGCTGGG + Intergenic
1040020884 8:42739904-42739926 CTGAATTCCAAAAAGGAGGAGGG + Intergenic
1040361059 8:46664863-46664885 CTAAATTCCAAAAAGGAGGAGGG - Intergenic
1041828537 8:62125918-62125940 GTAAATGCTTAATAGAAGCATGG + Intergenic
1042742707 8:72068563-72068585 TTTAATGACTAAAAGGAGGAAGG - Intronic
1044029786 8:87222319-87222341 CTAAATGCCTAAAATTATCTAGG + Intronic
1045206577 8:100048182-100048204 CTAAATGTCCAAATGGAGAATGG + Intronic
1045872096 8:106938957-106938979 CTAAATACACAAAAGGAGCTGGG - Intergenic
1046157305 8:110309298-110309320 CTAAATACCTAAGAGGATCTGGG - Intergenic
1046328229 8:112678138-112678160 TCAAATGCTTAACAGGAGCAAGG - Intronic
1046573969 8:116001984-116002006 TTAAAAGCATATAAGGAGCATGG + Intergenic
1046713307 8:117538808-117538830 CTGAATGCCTGAAATGTGCACGG - Intronic
1049426470 8:142540134-142540156 CTAAATGACCAGAGGGAGCATGG - Intronic
1050795987 9:9542310-9542332 CTTAATGCCAAAAAAGATCATGG + Intronic
1056637144 9:88340570-88340592 CTTAATGTCTAAAAGGAAAATGG + Intergenic
1057341826 9:94209303-94209325 GTAAATACCTAAGAGGAGAATGG + Intergenic
1057586630 9:96334223-96334245 CAAAAGGCCTAAAGGGATCAAGG + Intronic
1058301082 9:103373713-103373735 CTAAATTCCGAAAGGGAGGAGGG - Intergenic
1059244263 9:112836217-112836239 CTGAACGCCTACAAGAAGCAAGG + Exonic
1060856520 9:126918087-126918109 CCATATGCATAAAAGTAGCAGGG - Intronic
1185817358 X:3168727-3168749 CTGAATTCCAAAAAGGAGGAGGG + Intergenic
1186630749 X:11346089-11346111 ATATATGCCTAAACTGAGCATGG - Intronic
1188253095 X:27923966-27923988 CAAAATGCCTAAAAGGAAGATGG - Intergenic
1188544397 X:31287726-31287748 ATAAATGCCTATAACTAGCATGG - Intronic
1188594565 X:31882799-31882821 CTAAATGGTTAAAAGGATAAAGG + Intronic
1188757417 X:33979838-33979860 CTACATACCAAAAAGGAGAATGG + Intergenic
1189409765 X:40759913-40759935 CTAAATGCCTGAAAAGACCTGGG - Intergenic
1193256811 X:79358044-79358066 CTATATGCTTAATAGGGGCAGGG + Intergenic
1195393105 X:104383717-104383739 CTAAATGACTAAAAGAAAAATGG - Intergenic
1195966208 X:110432334-110432356 CTAAATGCCTAGAAAGAACCCGG - Intronic
1201653042 Y:16312878-16312900 CAAAATGCATAAAAGTAACATGG + Intergenic