ID: 944596480

View in Genome Browser
Species Human (GRCh38)
Location 2:201265924-201265946
Sequence GGTTGTGACCAGAGTGTGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 231
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 209}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944596480_944596482 -10 Left 944596480 2:201265924-201265946 CCTACCACACTCTGGTCACAACC 0: 1
1: 0
2: 1
3: 20
4: 209
Right 944596482 2:201265937-201265959 GGTCACAACCCTCTAACCATTGG 0: 1
1: 0
2: 0
3: 5
4: 63

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944596480 Original CRISPR GGTTGTGACCAGAGTGTGGT AGG (reversed) Intronic
900458431 1:2788650-2788672 GGCGGTGGCCAGATTGTGGTGGG + Intronic
902540631 1:17151909-17151931 TGTTGTGACCAAAGTGTTGATGG + Intergenic
904279659 1:29409841-29409863 GGTGGTCACCAGAGGGTGGCCGG + Intergenic
904843266 1:33388136-33388158 GCTTGTGCCCAGCATGTGGTGGG - Intronic
904938303 1:34147431-34147453 GGCTGTGGCCAGACTGTGGAAGG + Intronic
906101620 1:43267539-43267561 GGTTGAGAACAGCCTGTGGTGGG + Intronic
906240402 1:44239051-44239073 GGTAGTGACCAGGGAGTGGGAGG - Intronic
906796154 1:48697932-48697954 AGTTGTGACCAGAGTCAGGCTGG - Intronic
908538772 1:65103281-65103303 GGTTGTGGCAACAGTGTGTTGGG + Intergenic
911461651 1:98198518-98198540 GGTTGGGAACACATTGTGGTAGG - Intergenic
917588655 1:176454596-176454618 TGATGTGACCAGAGTATGGAAGG - Intergenic
917649148 1:177059354-177059376 TGTAGTGTCCAGAGAGTGGTAGG - Intronic
918003748 1:180522922-180522944 GGGCATGACTAGAGTGTGGTGGG - Intergenic
918030888 1:180809243-180809265 GCTTGTGAATAGAGTGGGGTAGG + Intronic
921583374 1:216921517-216921539 GGCTGTCACCAGAGTGCCGTAGG - Intronic
923720337 1:236461737-236461759 TGTTATGACCAAAGTTTGGTTGG - Intronic
923891032 1:238215034-238215056 GGTTTTGACCAAAATGTTGTTGG - Intergenic
924272892 1:242352218-242352240 GGTGGTTACCAGAGGCTGGTGGG - Intronic
1062846177 10:707605-707627 GGTTGTGACTAGAATGTTGGTGG - Intergenic
1063403760 10:5773101-5773123 GTTTGAGATCAGAGTTTGGTAGG - Intronic
1064450687 10:15439608-15439630 AGTTGTGTCCAGAGGGTTGTTGG - Intergenic
1064590724 10:16888053-16888075 GGTGGTTACCAGAGGCTGGTAGG + Intronic
1066414925 10:35213083-35213105 GGATCTGATCAGTGTGTGGTGGG + Intergenic
1066711822 10:38244445-38244467 GGTGGTTACCAGAGGCTGGTGGG + Intergenic
1067698858 10:48554430-48554452 GGCTGTGAACTGAGTGTGCTAGG - Intronic
1067749807 10:48963442-48963464 GGTTCTGACCAGAGAGTGTCAGG - Intronic
1068082607 10:52338340-52338362 GTTTGTGAACAGACTATGGTAGG - Intergenic
1069086897 10:64151131-64151153 GGTGGTTACCAGAGGCTGGTGGG - Intergenic
1069653258 10:70067163-70067185 TGTTGTGACCAGAGGCTTGTAGG + Intronic
1069825633 10:71253534-71253556 GGTTCTGACCACAGTGGGGGTGG + Intronic
1073693188 10:105834518-105834540 GGTTGTGACTGGAGTGTTCTGGG + Intergenic
1074580198 10:114711830-114711852 GGGTGGGAGGAGAGTGTGGTTGG - Intergenic
1075860152 10:125668073-125668095 GTCTGTGGACAGAGTGTGGTTGG + Intronic
1077234291 11:1472477-1472499 GGTTGTGGCCATGGTGTGGAGGG - Intronic
1077843095 11:5995899-5995921 GGTGGTTACCAGAGTCTGGTAGG - Intergenic
1079384749 11:19968894-19968916 GGTTGGGAACAGGGTGTGGCAGG - Intronic
1080501289 11:32873830-32873852 GGTCGTGACCAGAATGTTGGTGG + Intergenic
1080697300 11:34613615-34613637 GGAAGTGAGCCGAGTGTGGTTGG + Intergenic
1081730199 11:45366542-45366564 TTTTGTGACCAGAGAATGGTTGG + Intergenic
1083018581 11:59482306-59482328 GGTGGTTACCAGAGTCTGGAAGG + Intergenic
1083714389 11:64567428-64567450 GGTTGTGTCCTGAGTTTGGCAGG + Intronic
1084043799 11:66557596-66557618 GGCTGTGGCCAGAGTGTAGGTGG - Intronic
1085308472 11:75501664-75501686 GGCTGTGATCAGAGTGGGGAGGG + Intronic
1089652339 11:119922446-119922468 CTTTGTGAGCAGAGTGTGGCTGG + Intergenic
1090481548 11:127073387-127073409 GTGTGTGACTAGAGTGGGGTTGG + Intergenic
1091408175 12:221692-221714 GGTTTTGGGCAGAGTGTGGATGG - Intronic
1092193575 12:6536208-6536230 GCTTGTGCCCAGACTGTGGGTGG + Intronic
1092261374 12:6955037-6955059 GTCTGTGACCACAGTGTGGGTGG + Intronic
1092986530 12:13851084-13851106 GGTTGGGAGGAGAGTGGGGTGGG - Intronic
1093504526 12:19849794-19849816 TGTTGTGACCAGAGGCTGGAAGG + Intergenic
1095735064 12:45547445-45547467 GGTTGGGCTCAGAGTGTTGTGGG + Intergenic
1098214834 12:68204484-68204506 GGTAGTGTCCAGAATGTGGCTGG - Intronic
1098867785 12:75782560-75782582 GGTGGTTACCAGAGTTTGGGAGG + Intergenic
1099475695 12:83105157-83105179 GGTTGTGACCAAAGTGCTGATGG - Intronic
1099832258 12:87858650-87858672 GGTGGTTACCAGAGGGTGGGAGG + Intergenic
1099898641 12:88680622-88680644 GGTTGTGACCAAAGTGCAGATGG + Intergenic
1101737391 12:107473284-107473306 GGTAGTGACCAGAGGGAGGATGG - Intronic
1103499226 12:121388038-121388060 GGTTGTGAGGTGAGGGTGGTGGG + Intronic
1103623314 12:122201519-122201541 GGTGGTGACCAGGGTGGGGAAGG + Intronic
1104514764 12:129414824-129414846 GGTGGTGACCAGAGACTGGGCGG - Intronic
1105601991 13:21895717-21895739 GCTTGTGAACAGAGTGTGCTAGG - Intergenic
1106364430 13:29064341-29064363 GGTTGGGGCCAGATTGTGGGGGG + Intronic
1106926266 13:34616176-34616198 GATTGTAACCAGACAGTGGTTGG - Intergenic
1107209175 13:37831862-37831884 GGTGGTTACCAGAGTCTGGCAGG + Intronic
1107695884 13:42999465-42999487 GGTTGTCAACAGAATGTGCTGGG + Intergenic
1107805683 13:44151933-44151955 GGTTGAGTCCAGCCTGTGGTGGG + Intronic
1114915216 14:27255479-27255501 GGTTGTGGCCAGAGTCTGGGAGG + Intergenic
1115877765 14:37879851-37879873 AGATGTGACCAGATTGTGGAAGG + Intronic
1117320088 14:54613306-54613328 GGTGGAGACCAGAGGGAGGTGGG + Intronic
1118641259 14:67794582-67794604 TGTTATGACCAGGGAGTGGTAGG + Intronic
1118993002 14:70812472-70812494 GGTTGAGACCAGACTGTAGAGGG + Intergenic
1121439887 14:93941958-93941980 GGTGGGGAACAGAGTGAGGTTGG + Intronic
1122534236 14:102451115-102451137 AGTTCTGCCCAGAATGTGGTTGG - Intronic
1123026654 14:105427578-105427600 TGTTGTGACCAGAGGCTCGTAGG + Intronic
1124641345 15:31398413-31398435 GGCTGGGAGCAGAGCGTGGTGGG + Intronic
1124716885 15:32072052-32072074 GGTTGTGACCAGAATGCTGATGG + Intronic
1125993299 15:44131767-44131789 GGTGGTTGCCAGAGTGTGGTGGG + Intronic
1126656067 15:50979373-50979395 GGTTGTTACAAGAGTGAGTTTGG + Intronic
1126783013 15:52154560-52154582 CGTTGTGATGAGAGAGTGGTAGG - Intronic
1129300635 15:74623591-74623613 GGTTGGGACCAGTGGGTGGAGGG + Intronic
1132456579 16:27100-27122 GGCTGTGACCAGACTGAGATAGG - Intergenic
1133832231 16:9333715-9333737 GGTTGTGAACGCTGTGTGGTAGG + Intergenic
1134817933 16:17221585-17221607 TGTTTTAAGCAGAGTGTGGTGGG + Intronic
1135623702 16:23977381-23977403 GGCTGTGAGGAGAGGGTGGTGGG - Intronic
1136347349 16:29684681-29684703 GGTGGTGCCCAGAGGGTGGTAGG - Intronic
1138130365 16:54474210-54474232 GGATGTGACTAGGATGTGGTGGG + Intergenic
1138444473 16:57054880-57054902 GGTTGTGCCTGGAGTCTGGTGGG + Intronic
1142270664 16:89087788-89087810 GGTTGCAACCACAGTGTTGTGGG + Intergenic
1144345211 17:14343501-14343523 GGTGGTTACCAGAGGCTGGTTGG - Intronic
1145735155 17:27224171-27224193 GGTGGTTACCAGAGTCTGGAAGG - Intergenic
1146296941 17:31657774-31657796 TGTTGTGACCAGAGGCTTGTGGG + Intergenic
1148490788 17:48023186-48023208 GGTTGTGCCCAGACTGTTTTGGG + Intergenic
1148562499 17:48613979-48614001 GGTAGTGAAGAGAGGGTGGTGGG - Intronic
1150309306 17:64114755-64114777 GAGTGTGAACAGATTGTGGTTGG - Intronic
1151899723 17:77003994-77004016 TGTTGTGACTAAAGTGTGGCAGG + Intergenic
1152640663 17:81447949-81447971 AGTTGTCCCCAAAGTGTGGTAGG + Intronic
1155022877 18:21912612-21912634 GGTAGTGCCCAGGGTGTGCTAGG + Intergenic
1155837341 18:30602519-30602541 GGTAGTTACCAGGGTGGGGTGGG - Intergenic
1156560696 18:38122241-38122263 GGTTGGGAGCAGACTGTGGTTGG + Intergenic
1157096433 18:44689506-44689528 GATTGTGACCAGACTCTGATGGG + Intronic
1157221586 18:45832071-45832093 GAGTGTGAACAGAGGGTGGTGGG - Intronic
1157230622 18:45912367-45912389 AGGTGTGACCAGAGCCTGGTGGG + Exonic
1162405129 19:10468658-10468680 GGCTGTGATCAGAGTGTGGAAGG - Exonic
1163547909 19:17950364-17950386 GGGCGTGTCCAGAATGTGGTGGG + Intergenic
1163645719 19:18487982-18488004 GGTTGTGGCCAGAGTGAGGTGGG - Intronic
925354178 2:3225807-3225829 GGTGGTTACCAGAGGCTGGTGGG - Intronic
925744651 2:7033708-7033730 GGCTATGACCAGAGTGGGGTGGG - Intronic
927666587 2:25037006-25037028 GGTTTTGAACAGAGTGTCCTGGG + Intergenic
932223429 2:70019740-70019762 GGTGGTTACCAGAGGGTGGCGGG + Intergenic
932415534 2:71571506-71571528 GGGTGTGAGCTGTGTGTGGTGGG - Intronic
932415541 2:71571568-71571590 GGGTGTGATCTGTGTGTGGTGGG - Intronic
932415566 2:71571853-71571875 GGGTGTGATCTGTGTGTGGTGGG - Intronic
933713521 2:85344351-85344373 GCATGTGACAAGAGTGTGGTGGG + Intronic
937214913 2:120306368-120306390 GGGTGTGACCAGAGGTTGCTTGG - Intergenic
944101613 2:196033465-196033487 GGTTGTTACCAGAGGCTGGAGGG - Intronic
944596480 2:201265924-201265946 GGTTGTGACCAGAGTGTGGTAGG - Intronic
1168796818 20:615839-615861 GGATGTGAACGGAGTGAGGTTGG - Intergenic
1169055700 20:2619033-2619055 GGTTGGGACTAGAGTGAGGCGGG - Intronic
1169733887 20:8815668-8815690 GGTTGGGAGAAGAGAGTGGTCGG - Intronic
1169754573 20:9030127-9030149 GGATGTGAGCAGAGTGATGTAGG + Intergenic
1171971300 20:31566838-31566860 GGCTGTGTGCAGGGTGTGGTAGG - Intronic
1172272990 20:33664779-33664801 GTTGGTCACCAGAGTGTGGCAGG - Intronic
1172429176 20:34876197-34876219 TGGAGTGACCAGAGTGGGGTGGG - Intronic
1172955623 20:38756111-38756133 GGTTGTGCCCAGAGTCAGGAGGG + Intronic
1173163596 20:40670783-40670805 GGTACTGGTCAGAGTGTGGTGGG - Intergenic
1173548671 20:43917037-43917059 GGATGTGTCCAGAGTGGGGCGGG + Intronic
1173655109 20:44694794-44694816 GATTCTGACCAGAGCCTGGTGGG + Intergenic
1174187659 20:48718135-48718157 GTTTGTGACCCTAGGGTGGTAGG + Intronic
1178679116 21:34657395-34657417 GGATGTCACCAGAGTGTGTCTGG - Intergenic
1178894720 21:36548916-36548938 GAATGTGCCCAGGGTGTGGTGGG - Intronic
1183283904 22:36950922-36950944 GGTTGTGAACAGACTGAGGTGGG + Intergenic
1184822970 22:46924880-46924902 GGTTGTGATGAGTGTGTGGTGGG + Intronic
1184973598 22:48045427-48045449 GGTTCTGAGCACAGTGAGGTTGG + Intergenic
1185010883 22:48313355-48313377 AGTTGTGACCAGATGGTGGTTGG - Intergenic
949482893 3:4510876-4510898 GGTAGGGACGAGAGTGTTGTGGG + Intronic
949891326 3:8735687-8735709 GGTTGGGGCCAGATTGTGTTGGG - Intronic
950194638 3:11000507-11000529 GATTGTGGCCAGAGTGAGATCGG + Intronic
950478223 3:13227561-13227583 GGTTGTCACCTGGGTGAGGTGGG + Intergenic
950542749 3:13621976-13621998 GCATGTGGCCACAGTGTGGTGGG - Intronic
950657189 3:14443923-14443945 GGCTGGGACCAGAGCGTGGGTGG + Intronic
950681868 3:14590997-14591019 GGTTGGGGCCAGATTGTGGAGGG - Intergenic
951270155 3:20614848-20614870 GTTTGTGGCCAGATTGTGGGGGG + Intergenic
952467868 3:33610311-33610333 GGTTGAGATCATAGTGTGGAGGG - Intronic
953043167 3:39272922-39272944 GGTTGTGAAGAGAATGTGGTGGG - Intronic
953832833 3:46316587-46316609 GGTTGTGACAAAAGTTAGGTAGG - Intergenic
953990142 3:47477141-47477163 CATTGTGACAATAGTGTGGTGGG - Intergenic
954144766 3:48629058-48629080 GGCTGTGACCCGAATGGGGTGGG - Intronic
955389749 3:58512669-58512691 GTTGGAGACCAGAGTGTGCTTGG - Intronic
959096053 3:101957276-101957298 GGTGGTTACCAGAGAGTGGCTGG - Intergenic
961530129 3:127535635-127535657 GGCTGTGACCAGAGCGAGGGGGG - Intergenic
961786479 3:129350091-129350113 GGTTGTCACCTGGGTGAGGTGGG - Intergenic
963116420 3:141733813-141733835 GGTTGGGGCCATATTGTGGTGGG + Intergenic
963634256 3:147774786-147774808 GGTTATCCCTAGAGTGTGGTGGG + Intergenic
966295873 3:178422154-178422176 GGATGTAAGCAGAGTGTGTTGGG - Intronic
966943914 3:184764291-184764313 GGGTGTGATCAGAGTCTGGTTGG + Intergenic
967765955 3:193279840-193279862 GATTGGGACCAGATTGTGGAAGG - Intronic
969215404 4:5718228-5718250 TGTTGTGACCAGAGGCTTGTAGG - Intronic
970157834 4:13159372-13159394 GGTTGTGGTCAGAGAGTGGGAGG + Intergenic
977620720 4:99134133-99134155 GGTGGTTACCAGAGTCTGGGGGG + Intronic
979631849 4:122911412-122911434 GGTTATGACCAGAGAGTAGGAGG - Intronic
981474248 4:145172265-145172287 GGTAGTGACCAGTGTGTAGAAGG + Intronic
986034064 5:3921510-3921532 GGTGGTTACCAGAGTCTGGAAGG + Intergenic
990488567 5:56282394-56282416 TGTTGTGACCAGAGGCTGGAAGG + Intergenic
991293573 5:65058170-65058192 GGTAGTGACCACAGTGGGCTGGG - Intergenic
992159832 5:73990502-73990524 GGTTGTGATAAGACTTTGGTTGG - Intergenic
992925819 5:81585819-81585841 GGTGGTTACCAGAGGCTGGTGGG - Intronic
996352267 5:122557773-122557795 TGTTGTGAGCAGAATCTGGTGGG - Intergenic
999846674 5:155489209-155489231 TGTTGTGACCTGAGAGTGTTTGG + Intergenic
1000137935 5:158370890-158370912 GGTTGGGAACAGAGTGTGAATGG - Intergenic
1000362663 5:160462311-160462333 TGTTGTGACCAGAGGGTTGGAGG - Intergenic
1002181897 5:177435018-177435040 GGATGTGGCCTGAGTGTGGGTGG - Exonic
1003613706 6:7636100-7636122 GGTTGTGATCAGACAGTGGCTGG + Intergenic
1005898369 6:30196952-30196974 GGTTTTGACCATATAGTGGTGGG - Intronic
1006282926 6:33069642-33069664 GTTGGTGGCCTGAGTGTGGTTGG + Exonic
1012552236 6:100474339-100474361 TGCAGTGACCAGAATGTGGTGGG + Intergenic
1014245831 6:119067656-119067678 TGTTGTGACCAGAGGGTGTCAGG + Intronic
1017237847 6:152135914-152135936 CATTGTGACCAGAGTGTAGTCGG - Intronic
1018182121 6:161233057-161233079 GTGTGTGACCAGGGTGTGGTGGG - Intronic
1018200994 6:161395598-161395620 GGTTGAGACCACAGCGTGTTGGG - Intronic
1019935245 7:4250747-4250769 GATTCTGACTAGAGTGGGGTTGG - Intronic
1020384395 7:7581989-7582011 GGTTTACACAAGAGTGTGGTTGG + Intronic
1020405828 7:7833079-7833101 GCTTGGGACCACAGTGTGGAGGG + Intronic
1021287912 7:18805300-18805322 GACTGTTACCAGAGTGGGGTAGG + Intronic
1021650396 7:22827582-22827604 GGTTGAGACAAGATTGAGGTAGG + Intergenic
1027513318 7:79110289-79110311 AGTTGTGAGAAGAGGGTGGTGGG + Intronic
1027722580 7:81763001-81763023 GGTTAGGAGCAGAGTGAGGTAGG + Intronic
1029655128 7:101919133-101919155 GGCTGTGGCCGGAGTGTGCTGGG + Intronic
1032381203 7:131483432-131483454 TGTTGTGACCAGAGGCTTGTAGG - Intronic
1032743202 7:134760202-134760224 GATTGTACCCTGAGTGTGGTAGG + Intronic
1033043774 7:137942111-137942133 GGATGTGAGCACAGTGTGGCTGG - Intronic
1033537024 7:142321560-142321582 GTTTGTGCACAGAATGTGGTTGG - Intergenic
1034497275 7:151430527-151430549 TGTGGTGGCCTGAGTGTGGTGGG - Intronic
1035189325 7:157152127-157152149 GGTTGTGGCCAGAATGGGGGTGG + Intronic
1038104090 8:24414046-24414068 GGTTGTTACTAGATGGTGGTGGG - Intergenic
1038895609 8:31778333-31778355 GGTGGTGACCAGAGAGAGGCTGG - Intronic
1039508835 8:38072650-38072672 AGTTCTGACCAGGATGTGGTAGG - Intergenic
1040469420 8:47724912-47724934 GGTGGTGAGCAGAGTGAGGGAGG - Intronic
1043772208 8:84218810-84218832 GATAGTGCCCAGCGTGTGGTTGG + Intronic
1045552019 8:103181244-103181266 GGCTGTGAGCAGGGTGTTGTAGG + Intronic
1046269748 8:111879420-111879442 GGTGGTGACCAGGGTCTGGGAGG + Intergenic
1047569591 8:126083456-126083478 GATTGTGGCCAGATTGTGATGGG + Intergenic
1048429857 8:134360064-134360086 GGCTGGAATCAGAGTGTGGTGGG + Intergenic
1049517785 8:143070959-143070981 CGTATTGATCAGAGTGTGGTGGG + Intergenic
1049726537 8:144148922-144148944 GGATGTGAGCAGAGTTGGGTCGG + Intronic
1049967452 9:792258-792280 TGATGTCACTAGAGTGTGGTGGG - Intergenic
1051058769 9:13021214-13021236 GGTAGTTACCAGAGGCTGGTGGG + Intergenic
1052620630 9:30904679-30904701 TGTTGTGACCAGAGTCTTGTAGG + Intergenic
1053442280 9:38126352-38126374 GGTTGAGACCAGACTGTAGAGGG - Intergenic
1053473817 9:38367137-38367159 GGGTGTGTCCAGGGTGTGGTAGG - Intergenic
1055369365 9:75580656-75580678 AGTTGTGACGGGAGTGTGGTTGG + Intergenic
1056072467 9:83002116-83002138 GGTGGTGCCCAGGGTGTAGTGGG - Intronic
1056116406 9:83445480-83445502 AGCTGAGACTAGAGTGTGGTGGG - Intronic
1057520459 9:95755644-95755666 GGTTGTGATCAGATTGTGAGGGG + Intergenic
1057795128 9:98150353-98150375 TGCTGTGACCACAGAGTGGTGGG - Intronic
1059101322 9:111474656-111474678 GGTTGGGACCAGCATGTTGTAGG - Intronic
1059721403 9:116963541-116963563 GGATGTGCACAGAGTGTGGTGGG + Intronic
1060328799 9:122644572-122644594 GGTGGTGACCACAGTGGTGTTGG + Intergenic
1061632573 9:131882494-131882516 GGTTGTGTCCACAGTGTGCCAGG - Intronic
1062523603 9:136969595-136969617 GGTTGAGACCAGGGAATGGTGGG + Intronic
1187282333 X:17867189-17867211 GGATGTGGGCAGAGTGGGGTTGG + Intergenic
1187301917 X:18059110-18059132 GGATGTGGGCAGAGTGGGGTTGG + Intergenic
1189140260 X:38597619-38597641 TGTTGTGACCAGAGGCTTGTAGG + Intronic
1189954065 X:46260621-46260643 GGGTGGGGCAAGAGTGTGGTTGG - Intergenic
1195815737 X:108885191-108885213 GGTGGTTACCAGAGTCTGGGAGG - Intergenic
1196080302 X:111623462-111623484 GGTTGTTACCAGAGTCAGGATGG - Intergenic
1198662237 X:138982149-138982171 AGGTGTGACCAGAGAGAGGTTGG + Intronic
1200154054 X:153965914-153965936 GGGTGGGACCAGAGTGCAGTGGG - Intronic
1200204743 X:154307787-154307809 GCTTGTTACGTGAGTGTGGTGGG + Intronic
1200399783 X:156012623-156012645 GGCTGTGACCAGACTGAGATAGG + Intergenic
1200448496 Y:3294843-3294865 GCTTGTGACCAGAGCCTGGAAGG - Intergenic
1200983583 Y:9284259-9284281 GGTTGAGACCAATGTCTGGTAGG + Intergenic