ID: 944599542

View in Genome Browser
Species Human (GRCh38)
Location 2:201289597-201289619
Sequence CCCTGGATGGCTCTGGGTTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 369
Summary {0: 1, 1: 0, 2: 1, 3: 32, 4: 335}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944599542_944599554 12 Left 944599542 2:201289597-201289619 CCCCAACCCAGAGCCATCCAGGG 0: 1
1: 0
2: 1
3: 32
4: 335
Right 944599554 2:201289632-201289654 GCAGAGCTGGATGGAGACCTGGG 0: 1
1: 0
2: 4
3: 37
4: 439
944599542_944599549 -10 Left 944599542 2:201289597-201289619 CCCCAACCCAGAGCCATCCAGGG 0: 1
1: 0
2: 1
3: 32
4: 335
Right 944599549 2:201289610-201289632 CCATCCAGGGCAGAGCTATATGG 0: 1
1: 0
2: 0
3: 8
4: 105
944599542_944599553 11 Left 944599542 2:201289597-201289619 CCCCAACCCAGAGCCATCCAGGG 0: 1
1: 0
2: 1
3: 32
4: 335
Right 944599553 2:201289631-201289653 GGCAGAGCTGGATGGAGACCTGG 0: 1
1: 0
2: 10
3: 70
4: 574
944599542_944599552 3 Left 944599542 2:201289597-201289619 CCCCAACCCAGAGCCATCCAGGG 0: 1
1: 0
2: 1
3: 32
4: 335
Right 944599552 2:201289623-201289645 AGCTATATGGCAGAGCTGGATGG 0: 1
1: 0
2: 1
3: 18
4: 184
944599542_944599551 -1 Left 944599542 2:201289597-201289619 CCCCAACCCAGAGCCATCCAGGG 0: 1
1: 0
2: 1
3: 32
4: 335
Right 944599551 2:201289619-201289641 GCAGAGCTATATGGCAGAGCTGG 0: 1
1: 0
2: 0
3: 29
4: 243

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944599542 Original CRISPR CCCTGGATGGCTCTGGGTTG GGG (reversed) Intronic
900230868 1:1556680-1556702 CCTTGTGTGGCTCTGTGTTGAGG - Intronic
900568688 1:3347794-3347816 CCCCTGAGGGCTCTGGGCTGGGG + Intronic
900580250 1:3405187-3405209 CCCTGGCGGGCTCGGGGTGGAGG - Intronic
900946097 1:5832240-5832262 CCCTAGATAGCTGTGGGCTGGGG + Intergenic
901028446 1:6291841-6291863 CCCCTGCTGGCTCTGGGTTCTGG - Intronic
901137373 1:7006733-7006755 CCCTCAGAGGCTCTGGGTTGGGG - Intronic
903330968 1:22597222-22597244 CCTGGGATGGGTCTGGGGTGGGG - Intronic
903420712 1:23216814-23216836 CCCCGGCTGGCTCCGGGCTGGGG - Intergenic
903972408 1:27127604-27127626 CACTGGAGGGCTCTGGCCTGGGG + Intronic
904576731 1:31509643-31509665 GCCTAGCTGGCTCTGGGTTAAGG - Intergenic
904771715 1:32884721-32884743 CACTGGAGGGCCCTGGGGTGGGG + Intergenic
905300896 1:36985591-36985613 CCCTGGATGGGTCTCAGGTGTGG + Intronic
905922547 1:41729070-41729092 TCCTGGATGGCTGTGTGTTGGGG - Intronic
906575893 1:46889182-46889204 TCCTGGTTGGTTCTGGGTTGGGG - Intergenic
906596080 1:47078712-47078734 TCCTGGTTGGTTCTGGGTTGGGG + Intronic
906660634 1:47578940-47578962 CTCTGCCTGGCTCTGGTTTGGGG - Intergenic
907279791 1:53339982-53340004 CCCTGGGTGGACCTGGATTGTGG - Intergenic
912556595 1:110520654-110520676 AGCTGGATGGCTGTGGGTGGGGG + Intergenic
915625821 1:157113510-157113532 CCCTGGATGGCCCTGGGTGATGG + Intergenic
915904046 1:159865300-159865322 CCCTGCAGGGCTCAGGGTTTAGG - Intronic
916731139 1:167567825-167567847 CCCTGGAGGGCTGTGGGTTACGG + Intergenic
918043657 1:180928212-180928234 CCCTGCGTGGCTCTGGATGGGGG - Intronic
918186026 1:182128579-182128601 CCCTGGGTGGCTATGGGCTGAGG + Intergenic
919922994 1:202177404-202177426 CCCTGCAGGGCCCTGGGGTGTGG - Intergenic
919974304 1:202600771-202600793 CCCTGGGTGGATCTGGGATCTGG + Intronic
919982718 1:202652314-202652336 TCATGCATGGATCTGGGTTGGGG + Intronic
921687720 1:218109241-218109263 CAGGGGATGGCTCTGGGATGGGG - Intergenic
922755872 1:228096720-228096742 CCCTGGAAGGTTCTGTGTTGGGG + Intronic
924623177 1:245679940-245679962 GCCTGGAGGGGTTTGGGTTGGGG - Intronic
1064438572 10:15332948-15332970 CTCTGGTGGGCTCTGTGTTGAGG - Intronic
1066095947 10:32072179-32072201 CCCTCTATGGCTCTGCGCTGGGG + Intergenic
1067272234 10:44802424-44802446 CACTGGAGGCCTCTGGGTGGAGG - Intergenic
1067706580 10:48610756-48610778 CGCTGGAGGGGTCTGGGTTTGGG + Intronic
1069847692 10:71384210-71384232 CCCTGGATGGCTGAGGATAGGGG + Intergenic
1070303377 10:75222074-75222096 CCCTGTATGGGTATGGGTTGGGG + Intronic
1070780177 10:79132975-79132997 CCCTCGCAGGCTCTGGGGTGGGG + Intronic
1071202417 10:83234959-83234981 CCCTAGATAGCTTTGGGATGGGG + Intergenic
1072158442 10:92744759-92744781 GTCTGGATGGCTGTGGTTTGGGG + Intergenic
1073068077 10:100775702-100775724 CTGTGGGTGGCTCTGGCTTGAGG - Intronic
1073072902 10:100806072-100806094 CCCAGGCTGGCCCTGGCTTGGGG + Intronic
1073325768 10:102643497-102643519 GCCTGGAAGGCTCGGGGCTGCGG - Intergenic
1073426393 10:103458010-103458032 CTCCGGATGGCCCTGGGCTGAGG + Intronic
1074048962 10:109865603-109865625 CCCAGGATGGCTCAGGTTTAAGG - Intronic
1074441712 10:113483040-113483062 CCCTGGAACGCTCTGGGTCCAGG + Intergenic
1074971282 10:118541432-118541454 CCCTGGATAGTGCAGGGTTGGGG - Intergenic
1076030363 10:127152592-127152614 GACTGGATAGCTCTTGGTTGTGG + Intronic
1076319669 10:129568715-129568737 ACCTGGAGGGCTCTGGTTTCTGG + Intronic
1076477817 10:130764846-130764868 CCAAGCATGGCTCTAGGTTGAGG - Intergenic
1076511958 10:131020279-131020301 CCCTGGAGGGATGTGGGGTGTGG - Intergenic
1076511984 10:131020351-131020373 CCCTGGAGGGATGTGGGGTGTGG - Intergenic
1076511994 10:131020375-131020397 CCCTGGAGGGATGTGGGGTGTGG - Intergenic
1076512127 10:131020716-131020738 CCCTGGAGGGATGTGGGGTGTGG - Intergenic
1076726466 10:132416404-132416426 CCAGGGTTGGCCCTGGGTTGCGG + Intronic
1076737299 10:132464611-132464633 TCCTGGAAGCTTCTGGGTTGGGG - Intergenic
1076934317 10:133557198-133557220 CCCAGGAGGGCACTGGGCTGGGG + Intronic
1077187879 11:1243555-1243577 CCGTGGAAGGCTCTGTGATGTGG - Exonic
1077188300 11:1245226-1245248 CCGTGGAAGGCTCTGTGATGTGG - Exonic
1077188835 11:1247326-1247348 CCGTGGAAGGCTCTGTGATGTGG - Exonic
1077189254 11:1248997-1249019 CCGTGGAAGGCTCTGTGATGTGG - Exonic
1078191403 11:9094628-9094650 ACCCGCATGGCTCTGGGTGGAGG + Intronic
1078355666 11:10629829-10629851 CTCTTGATGGCACTGGGCTGAGG - Intronic
1078421186 11:11214355-11214377 CCCTGGAGAGCTCTGGGCTTTGG + Intergenic
1080638995 11:34147707-34147729 CCCCGGCTGGCTCTGCTTTGGGG + Intergenic
1081447532 11:43145235-43145257 CCCTGTATGGCTCTGGATTAAGG - Intergenic
1081504599 11:43702740-43702762 CCCAGGATGGCTTTGAATTGTGG + Intronic
1081968918 11:47185525-47185547 TCCTGGCTGGCTCTGGCTTCTGG - Intronic
1081992057 11:47343227-47343249 CTCTGGATGGCTTGGGGTGGGGG - Intronic
1083268090 11:61556261-61556283 TTCTGGAGGGCTCTGGGCTGAGG - Intronic
1083590742 11:63892599-63892621 CTCTGGATGGTTCTGGGATGAGG + Intronic
1084473167 11:69374864-69374886 CCCCGGATGGCACTGGGGTGGGG + Intergenic
1084517646 11:69645162-69645184 GTCTGGATGGGTCTGGGGTGGGG + Intronic
1084608933 11:70188569-70188591 CCCTGTGTGGCTCAGGGATGAGG - Exonic
1084951457 11:72668492-72668514 CCCTGGCTTGCTATGTGTTGGGG - Intronic
1084979803 11:72823001-72823023 CCCTGGCAGCCTCTGGGGTGGGG - Intronic
1085283998 11:75348352-75348374 CCCTGCCTGGGCCTGGGTTGGGG + Intronic
1085763200 11:79260009-79260031 ACCTGGAGGGCTGTGGGTGGTGG + Intronic
1086070820 11:82797158-82797180 CCATGGCTGGCCCTGGGTTCTGG + Intergenic
1086270891 11:85065345-85065367 CCCTTGATGGCTCCAGGTTTGGG + Intronic
1087048924 11:93867211-93867233 CACTGGAGGGGTCTGGGTGGAGG + Intergenic
1087052184 11:93897132-93897154 ACCTGGGTGGGTCAGGGTTGTGG + Intergenic
1089534766 11:119154239-119154261 CCCTGCAGGGATGTGGGTTGAGG - Exonic
1089638424 11:119831516-119831538 CCTTGGATGGCCTTGGGATGGGG - Intergenic
1090589487 11:128250280-128250302 CCATGGAGGGCACTGAGTTGGGG - Intergenic
1092178087 12:6424746-6424768 CCCTGTATGGTTCTGGGTGAGGG + Intergenic
1096017103 12:48286555-48286577 CAATGCATGTCTCTGGGTTGGGG + Intergenic
1096658026 12:53103798-53103820 AGCTGGGTGGCTCTGGGCTGAGG - Intronic
1098223580 12:68297499-68297521 CCCCTGATGGCTCTGGGTTTGGG + Intronic
1103680526 12:122690215-122690237 CACTGGGTGGCTGTGGGGTGGGG - Intergenic
1104838133 12:131805367-131805389 CCCTGGGTGCCTCTGGGCTGGGG + Intergenic
1104898601 12:132176078-132176100 TGCTGGAAGGCTCTGGGCTGAGG - Intergenic
1104960235 12:132485122-132485144 CGCCAGATGGCTCTGGGTTAGGG - Intergenic
1104973756 12:132542957-132542979 CCCTGGGCGGCTACGGGTTGGGG - Intronic
1105407374 13:20143383-20143405 GCCTGGATGGTACTGGGATGGGG + Intronic
1107073146 13:36293790-36293812 ACCTGGATGGTTCTTGATTGGGG - Intronic
1110244823 13:73310895-73310917 CCCTGCATGGGTCAGGGTTTGGG + Intergenic
1112133340 13:96548297-96548319 CCCTGGATGTCTCTGAGTGAGGG - Intronic
1113626675 13:111853020-111853042 ACATGGAGGGCTCTAGGTTGTGG + Intergenic
1113955532 13:114098382-114098404 CCCTGGATGTCGCTGGTGTGAGG - Intronic
1114792229 14:25672390-25672412 CCCGGGAGTGCTCTGGGTAGGGG + Intergenic
1116420465 14:44726582-44726604 ACCTGGATGATTCTGGCTTGGGG - Intergenic
1117008385 14:51445351-51445373 CAGTGGTTGGGTCTGGGTTGAGG + Intergenic
1117402509 14:55371032-55371054 CCCTGGAAGGCAGTGGGTGGGGG - Intronic
1117881208 14:60315397-60315419 GCCTGGGAGGCTCTGGGATGGGG - Intergenic
1118323060 14:64764566-64764588 ACCTGAATGTCACTGGGTTGGGG - Intronic
1118600009 14:67465363-67465385 CCCTGGATGGCACAGGGCTGGGG + Intronic
1118809178 14:69261033-69261055 CCCCGGAGTTCTCTGGGTTGAGG + Intronic
1118846027 14:69548370-69548392 CTGTGGATGGCTCTGGAGTGAGG - Intergenic
1121482174 14:94287618-94287640 CACTGGATGGTTCTGAGTAGAGG - Intronic
1124680463 15:31726032-31726054 CTCTGTCTGGCTCAGGGTTGAGG - Intronic
1125202133 15:37109539-37109561 CCCTCGATGCCTCTGCCTTGGGG - Intergenic
1126678845 15:51184987-51185009 CCCAGAATGGCTGTGGGTGGAGG + Intergenic
1130064306 15:80591962-80591984 CCCTGGATAGCTCTGGAGTCTGG - Intronic
1130077287 15:80700137-80700159 CCCTGGAAGGATGTGTGTTGAGG - Intronic
1130415035 15:83685621-83685643 TCCTGTATGGCTCTGGGAAGAGG + Intronic
1132106842 15:99069085-99069107 CCCTAGACGGCTCTGGTTAGTGG + Intergenic
1132242060 15:100265694-100265716 CCCTGTGTGGCTCTGGGGGGAGG - Intronic
1132682086 16:1146545-1146567 CCCAGGATGGAGCTGGGCTGGGG - Intergenic
1132750242 16:1454285-1454307 CCCCGGGTGGCCCTGGGATGAGG + Intronic
1132756989 16:1490336-1490358 CCCTCGAAGGCTCTGGGCTGGGG - Intergenic
1132767096 16:1539916-1539938 CCCTGGAGGTCTCAGGGCTGGGG + Intronic
1133767215 16:8846474-8846496 TCCTGCAGGGCTCGGGGTTGCGG + Intronic
1133900515 16:9969620-9969642 ATCTGGATGGCTGTGGATTGAGG - Intronic
1136714441 16:32265647-32265669 TTGTGGATGGCTCTGGGCTGGGG + Intergenic
1136753448 16:32663770-32663792 TTGTGGATGGCTCTGGGCTGGGG - Intergenic
1136814665 16:33206595-33206617 TTGTGGATGGCTCTGGGCTGGGG + Intronic
1136821141 16:33316675-33316697 TTGTGGATGGCTCTGGGCTGGGG + Intergenic
1136827704 16:33373214-33373236 TTGTGGATGGCTCTGGGCTGGGG + Intergenic
1136832770 16:33471985-33472007 TTGTGGATGGCTCTGGGCTGGGG + Intergenic
1137251103 16:46741563-46741585 CCCAGCAAGGCTCTGGGCTGTGG - Intronic
1137480572 16:48848909-48848931 TCCTGGAAAGCCCTGGGTTGAGG + Intergenic
1138025868 16:53522112-53522134 ACCTGGTTGGCTCTGGGTAAGGG + Intergenic
1141254301 16:82386429-82386451 CCACTGGTGGCTCTGGGTTGAGG + Intergenic
1141453775 16:84124686-84124708 GCCTGAATGGCTCTGGGTGTGGG - Exonic
1141501913 16:84450405-84450427 CCCTGGATGCATGTGGGGTGGGG - Intronic
1141506119 16:84479861-84479883 ACCTGGATTCCTCTGGGTAGAGG - Exonic
1141932281 16:87213987-87214009 CCATGGAAGGCTGTGGGCTGTGG + Intronic
1202993241 16_KI270728v1_random:29569-29591 TTGTGGATGGCTCTGGGCTGGGG + Intergenic
1203055609 16_KI270728v1_random:924122-924144 TTGTGGATGGCTCTGGGCTGGGG - Intergenic
1144645630 17:16971828-16971850 GTCTGGATGCCTCTGGGATGTGG - Intronic
1144996056 17:19269721-19269743 CACTGAATGGCTCTGGGTCCTGG + Intronic
1145203825 17:20969745-20969767 GTCTGGATGCCTCTGGGATGTGG + Intergenic
1145249691 17:21290290-21290312 CCCAGGACGGCTCTGGGTATGGG + Intronic
1146065407 17:29631149-29631171 ACTTGGTGGGCTCTGGGTTGTGG + Exonic
1146400654 17:32497819-32497841 CACTGGATCCTTCTGGGTTGTGG + Intronic
1146461879 17:33052609-33052631 CCCTGGAGGTCACTGGGTAGAGG - Intronic
1147211283 17:38873933-38873955 CCCTCTGTGGCTCTGGGTTGGGG - Intronic
1147446342 17:40477501-40477523 CCCTGAATGGGTGTGGCTTGTGG - Exonic
1147612458 17:41810076-41810098 CCCTGGCTCCCTCTGGCTTGGGG - Intronic
1148320056 17:46743176-46743198 CCAAGGTTGGCTCTGGGTTAGGG - Intronic
1148339286 17:46863789-46863811 CCCTGGCTGGCTCTGGATTTAGG + Intronic
1148732078 17:49843435-49843457 CTCTGGATGACTCTGGGGAGTGG - Intronic
1150952419 17:69818521-69818543 ACCTGGATGTCTTTGAGTTGAGG - Intergenic
1152224951 17:79088485-79088507 CCCTGCATGGCGGTGGGCTGGGG - Intronic
1152276745 17:79362485-79362507 GCCTGGATGGCACTAGGCTGAGG + Intronic
1152553293 17:81040468-81040490 CCCTTTCTGCCTCTGGGTTGAGG - Intronic
1152811298 17:82384041-82384063 CCCTGGAAGGCCCTGGGCAGTGG + Intergenic
1152893784 17:82898034-82898056 CACGGCATGGCTCTGGGTTTTGG + Intronic
1153817336 18:8801853-8801875 TCCAGGAGGGCTCTGGGCTGTGG - Intronic
1153983853 18:10335753-10335775 TGCTGGATGGCTGGGGGTTGGGG + Intergenic
1156098202 18:33561836-33561858 CCCTGGGTGGCACTCTGTTGTGG - Intergenic
1156498250 18:37540272-37540294 ACCTGGGAGGCTCTGGGCTGGGG - Intronic
1156558701 18:38097019-38097041 CCCTGGATATCTCTGGGCAGTGG + Intergenic
1158224020 18:55182025-55182047 CCCTGGGTGGCACTGTGCTGGGG - Intergenic
1159158545 18:64614185-64614207 CTCAGGATGGCTCTGAGTTCTGG - Intergenic
1160460877 18:79037260-79037282 CCCTGGAAGGCTCTGAGATATGG - Intergenic
1160460895 18:79037336-79037358 CCCTGGAAGGCTCTGAGATATGG - Intergenic
1160460930 18:79037488-79037510 CCCTGGAAGGCTCTGAGATATGG - Intergenic
1160686167 19:437855-437877 TCCTGGAGGGCTCTGGGAGGTGG - Intronic
1160754750 19:751448-751470 CCTTGGAGGGCTCTGGGATTTGG - Intronic
1160989603 19:1855188-1855210 CCCTGCATGCCCCTGGGTGGGGG - Intronic
1161080442 19:2307727-2307749 CACTGGTTGGGTCTGGGGTGTGG - Intronic
1161210664 19:3063554-3063576 CCCTGGAAGGCTGTGGGAGGAGG + Intergenic
1161347527 19:3775695-3775717 CCCTGGTTTGCTCAGGGCTGAGG - Intergenic
1161480112 19:4506160-4506182 CCCTGGAGGGCTCTGGGCAGAGG - Intronic
1161586150 19:5106932-5106954 CCCTGGATTGCCCTGCCTTGGGG - Intronic
1161588698 19:5118931-5118953 CCCTGGCAGGCCCTGGGGTGTGG + Intronic
1161620955 19:5296816-5296838 CCATGGAGGGCTGTGGGTAGAGG + Intronic
1161642913 19:5435584-5435606 CCATGGAGGGCTGTGGGTAGAGG - Intergenic
1162054374 19:8053906-8053928 CACTGCATGGCTCTGACTTGAGG + Intronic
1162504649 19:11076046-11076068 CCCTGGATTCCTATGGGTTCTGG + Intergenic
1163162876 19:15475944-15475966 GTCTGGATGGCTCTGGGTCTGGG + Exonic
1163359566 19:16837246-16837268 CACTGGATGGTTCTGGGAGGCGG + Intronic
1164699737 19:30276127-30276149 CTCTTGGTGGCTGTGGGTTGGGG + Intronic
1165150559 19:33757895-33757917 CTCTGGAAGGCTCTGGCCTGAGG - Intronic
1165510699 19:36265258-36265280 CCCTGGATGGCCCTGGTTGTGGG + Intergenic
1165719759 19:38070851-38070873 CTCTGGAGGGCTCAGGGATGTGG - Intronic
1166184887 19:41133502-41133524 GCCTGGATGGGCCAGGGTTGCGG - Intergenic
1166781277 19:45344942-45344964 CCCAGGAGGCCTCTAGGTTGGGG - Intronic
1166947682 19:46407072-46407094 CCCTTGATGCCTCTGGGGTGTGG - Intergenic
1167100493 19:47401695-47401717 CCAAGGATGGCTCTGGGGAGAGG + Intergenic
1167429894 19:49448112-49448134 CCCTGTCTGGGTCTGGGCTGTGG - Intronic
925122195 2:1427995-1428017 CTCTGGATCGCTCTCGGTTTGGG - Intronic
925618408 2:5766398-5766420 CCCTGGGTGGCTGTGGGCTCAGG - Intergenic
926862907 2:17327612-17327634 CACTGGGTGGCTCAAGGTTGAGG - Intergenic
927639032 2:24835162-24835184 CCCTGCAGAGCTCTGGGTGGGGG - Intronic
928091978 2:28380346-28380368 CCCTGGCTGTCTGTGGCTTGGGG - Intergenic
929593033 2:43159163-43159185 CCCCGGATGGCTCAGGGCTGTGG + Intergenic
930207390 2:48601773-48601795 CCCTGGAAGGCTTTGTGTAGAGG + Intronic
931744207 2:65277868-65277890 CCATTGATGGCTCTGTGTGGTGG + Intergenic
934655303 2:96114251-96114273 CCCTGGCAGGCGCTGGGATGGGG - Exonic
936117381 2:109712943-109712965 CCCTGCATGGCCCTGTATTGGGG + Intergenic
936380769 2:111983801-111983823 CCCAGCATGGCTCGGGGTTGGGG + Intronic
937890019 2:126931497-126931519 GCAAGGATGGCTCTGGGTGGGGG + Intergenic
938611174 2:132949081-132949103 CCCTGGATGGGGCAGGGTGGGGG - Intronic
941126907 2:161595092-161595114 AACTGGATTTCTCTGGGTTGGGG + Intronic
942335341 2:174878638-174878660 CCCTGCATGGCTCAGGTTTCTGG - Intronic
942596745 2:177598864-177598886 GCCTGGATGGCTGTAGGCTGGGG - Intergenic
944128385 2:196319202-196319224 CCCTGGTCAGCACTGGGTTGAGG + Exonic
944544747 2:200788083-200788105 CCCTGGATTTCTCTGAGCTGGGG + Intergenic
944599542 2:201289597-201289619 CCCTGGATGGCTCTGGGTTGGGG - Intronic
946063763 2:216968496-216968518 CCCTGGAAAGCTCTAGGCTGGGG + Intergenic
946082167 2:217130456-217130478 TCCTGGATGGCTCCAGGATGGGG - Intergenic
946159784 2:217829073-217829095 CCCTGAATGACTCTTTGTTGTGG - Intronic
946631800 2:221677421-221677443 TCCGGGATGGTTCTGGGTTAGGG - Intergenic
947238622 2:227970306-227970328 ACCTGGCTGGCTTTGGCTTGAGG - Intergenic
947771820 2:232676208-232676230 CCCAGAATGGCTGTGGTTTGAGG + Intronic
949045628 2:241871548-241871570 CCCTGGGTGGCTGGGGGGTGAGG + Intronic
1169077222 20:2768589-2768611 CTCTGTAGGGCTCTGTGTTGTGG - Intergenic
1169965538 20:11213520-11213542 ACCTGGAGGGCTTTGTGTTGGGG - Intergenic
1170389607 20:15857671-15857693 CTCTGAATGGTTCTGGGTTAGGG - Intronic
1171300440 20:24055261-24055283 CCCTGGTGGTCTCTGGCTTGGGG + Intergenic
1171413249 20:24960430-24960452 CTCTGGAGGGCTCTGGGGAGCGG - Intergenic
1171481663 20:25459681-25459703 CCCAGGATGGCTGTGGGGGGTGG - Intronic
1172244070 20:33433696-33433718 CCCAGGCTGGCCCTGGCTTGAGG + Intronic
1173668641 20:44781802-44781824 CCTTGGAAGGAACTGGGTTGTGG + Intronic
1174115390 20:48223403-48223425 TCCAGCATGGCTCTGGGTTCAGG - Intergenic
1174363232 20:50041236-50041258 CCCTGGAGGGCTCTGAGCAGAGG - Intergenic
1175237259 20:57523836-57523858 CCCTGGGTTGCTGTGGCTTGAGG - Exonic
1175442580 20:59002014-59002036 TCCTGGCTGGCTTTGGGGTGTGG - Intronic
1175468302 20:59207991-59208013 CCCTGGAAGGCTCTGGGGGTTGG - Intronic
1175540271 20:59743758-59743780 TCCTGGGTGACTCAGGGTTGAGG + Intronic
1175940843 20:62536899-62536921 CCAAGGGTGGCTCTGGGGTGGGG - Intergenic
1176371125 21:6061861-6061883 CGCTGGAAGGCTCTGGGCGGTGG - Intergenic
1178358079 21:31924801-31924823 CCGTGGGTGGCACTGGGCTGTGG + Intronic
1178584938 21:33863908-33863930 CACTGGCTGCCTCTGGGGTGTGG - Intronic
1179547818 21:42124351-42124373 CCCGTGCCGGCTCTGGGTTGGGG + Intronic
1179752394 21:43476680-43476702 CGCTGGAAGGCTCTGGGCGGTGG + Intergenic
1181030225 22:20145945-20145967 CCCTGGCCTGCTCTGGGTGGTGG + Intronic
1181055687 22:20259596-20259618 GCTTGGAGGGCTCTGGGTTGGGG - Intronic
1181349402 22:22244539-22244561 CCCTGGAGGCCTTTGGGTTAAGG - Intergenic
1181417826 22:22772891-22772913 CCCTGGATGGTAATGGGGTGGGG + Intronic
1181470800 22:23138167-23138189 CCCTGTGGGGATCTGGGTTGGGG + Intronic
1182121553 22:27790487-27790509 CCCTGGGTGGCTCTGAGCTGGGG + Intronic
1182958788 22:34452822-34452844 CCCCAGAGGGCTCTGGGCTGGGG - Intergenic
1183215206 22:36474900-36474922 GCCTGGAGGTGTCTGGGTTGGGG - Intronic
1183271997 22:36868107-36868129 TCCTGGATGGCTGTGGCTGGTGG - Intronic
1183384353 22:37506373-37506395 CTCTGGATGGCCTAGGGTTGGGG + Exonic
1183934263 22:41253174-41253196 CCCTGGATGGCTCTTGGTCCAGG + Intronic
1183957630 22:41391196-41391218 ACCTGGAGGGCTCTGGGCAGAGG - Intronic
1184066323 22:42123815-42123837 CCCTGGAAGGCCCAGGGCTGGGG + Intergenic
1184068791 22:42135967-42135989 CCCTGGAAGGCCCAGGGCTGGGG + Intergenic
1184944991 22:47796500-47796522 CCCTTGATGGCTCTGTTGTGTGG + Intergenic
1185189530 22:49425635-49425657 CCTTGGAGGGCTGTGGGTGGGGG + Intronic
1185341525 22:50293372-50293394 CCCCGGGTGGCTGTGGGTAGGGG - Intronic
949741215 3:7236695-7236717 GATTGGATGGCTCTTGGTTGTGG - Intronic
950544340 3:13629743-13629765 CCCTGGATGGCCCTTGGGGGTGG + Intronic
950873122 3:16246238-16246260 CTCAGGATGGCCCTGGGCTGTGG - Intergenic
951867970 3:27328667-27328689 CACTGGAAGGCTCTGGGGAGAGG + Intronic
951926836 3:27916772-27916794 ACCTGGATGGCTCTTCTTTGGGG + Intergenic
954131210 3:48561946-48561968 CCCTGCATGTCCCTGGGTCGAGG + Exonic
954486721 3:50860048-50860070 ACCTGCATCTCTCTGGGTTGGGG - Intronic
956092245 3:65680221-65680243 CCCTTGATGGGTCTAGGCTGAGG - Intronic
957570207 3:81937318-81937340 CCCTGGATGGCCCTGGCTCCAGG - Intergenic
960881391 3:122348840-122348862 TCCTGGGTGCCTGTGGGTTGCGG - Intergenic
961163083 3:124745950-124745972 CTCTGGGTAGCTCTGGGATGGGG + Intergenic
961438062 3:126932883-126932905 CCCTGGCTGCCGCTGGGCTGAGG + Intronic
961643179 3:128378157-128378179 CTCTGGATTGCACAGGGTTGGGG - Intronic
961646776 3:128397024-128397046 CCCAGGGTGCCTCTGTGTTGTGG - Intronic
961662500 3:128477053-128477075 CCAGGGCTGGCTCTGGGTTCTGG + Intergenic
962018642 3:131472041-131472063 ACCTGGATGCCTCTGACTTGGGG - Intronic
962736438 3:138329603-138329625 CCCTGGCCGGCTCCGGGGTGGGG - Intronic
964583111 3:158261989-158262011 CCATGGATGGGGCTGGGTAGGGG - Intronic
967054162 3:185813788-185813810 CCCTGGTTGGCCGAGGGTTGGGG - Intronic
968232219 3:197010832-197010854 CCCAGGATGGCTCTGGATGTCGG + Intronic
968445582 4:650589-650611 GCCTGGGTGGTTCTGGGCTGGGG - Intronic
968911109 4:3477398-3477420 GCCTGGATGTGTCTGGGTGGAGG + Intronic
969114446 4:4862333-4862355 CTCTGGATGGCCCTGGGAGGAGG + Intronic
969131817 4:4995659-4995681 CCCTGGAAGGCTGTGGGGTTGGG + Intergenic
969393428 4:6906114-6906136 CCCTTGGTGGCTCTGAGCTGGGG + Intergenic
969530361 4:7727004-7727026 CCCTGAGTGGCCCTGGGGTGGGG + Intronic
980105970 4:128588870-128588892 GCCTGTATGGCTCTGGCTTCAGG + Intergenic
985113545 4:186569957-186569979 TCCCTGATGGCTCTGGGCTGGGG - Intergenic
985631782 5:1017755-1017777 GCCTGGAGGGCTCTGGGTGCTGG + Intronic
985820847 5:2159231-2159253 CCCTGGTTGGTGCTGGGTAGGGG + Intergenic
985877430 5:2610422-2610444 CACTGGTTGGGTCTGAGTTGAGG + Intergenic
990321057 5:54630275-54630297 CACAGGATGGCTTTGGGTTTGGG + Intergenic
991005776 5:61826666-61826688 CCCTGGTTGGCCTTGGGTAGTGG - Intergenic
992065618 5:73104921-73104943 CACTGGATGGCTCTGAGTTCAGG - Intergenic
992793904 5:80238492-80238514 CCATGCCTGGCTCTGGATTGGGG - Intronic
993921569 5:93811193-93811215 CCCTGGTTGGCTCTTTTTTGTGG - Intronic
996143054 5:119938524-119938546 CACTGGATCTCTCTGAGTTGCGG - Intergenic
996494589 5:124139106-124139128 CCCTGGATTGCCCTGGCTGGAGG + Intergenic
997602606 5:135150615-135150637 CCCTCCATGGCTGTGGGGTGAGG - Intronic
997877475 5:137562259-137562281 TACTGGTTAGCTCTGGGTTGTGG + Intronic
999140725 5:149359722-149359744 CTCTGGATGACTCTTGGATGGGG - Intronic
999611322 5:153372931-153372953 CACTGAATGGCTCTGTCTTGGGG - Intergenic
999652818 5:153784179-153784201 CCCTGGTTTGCTCAGGATTGAGG + Intronic
999810727 5:155124928-155124950 TCCTGGTTGCCTCTGGTTTGGGG + Intergenic
1001721518 5:173860738-173860760 CCCCGGAAGGCTCTGGGCAGAGG - Intergenic
1001724392 5:173884914-173884936 TCCTGGAAGGCTCTAGGTTCTGG + Intergenic
1002182255 5:177436688-177436710 CCCAGGATGGGTCTGGCTTGTGG + Intronic
1003137173 6:3442529-3442551 CCCTTGATTGCTATGTGTTGAGG - Intronic
1006084560 6:31586891-31586913 CCCTGGATGGTTCTAGGTGCTGG - Intronic
1006795127 6:36727307-36727329 CCCTGGTTGCCTCTGGGGAGGGG + Intronic
1006897727 6:37481510-37481532 GCCTGTGTGGCTCTGTGTTGGGG + Intronic
1007585581 6:42986998-42987020 GTCTGGATGGCTGTGGGTGGAGG + Intronic
1009027337 6:58015878-58015900 CCATGGATGGGCCTGTGTTGAGG + Intergenic
1009202875 6:60767362-60767384 CCATGGATGGGCCTGTGTTGAGG + Intergenic
1012927367 6:105281231-105281253 TCCTTGATGGCTATTGGTTGGGG + Intronic
1015246810 6:131084201-131084223 GCCAGGATGGATCTGGGTGGGGG + Intergenic
1015509506 6:134023934-134023956 CCCTGGGTAGCTCTGGATTAGGG + Intronic
1015793590 6:136988700-136988722 TCCTGACTGGCTCTGGGGTGTGG + Intergenic
1016914650 6:149233399-149233421 CCCTGGGTGGCTCTGGGCCCAGG - Intronic
1017876042 6:158524959-158524981 CCGTGGAAGGCTCTGGGCAGAGG - Intergenic
1018093312 6:160363539-160363561 CGCTGGATGGGGCTGGGTTGGGG + Intronic
1018420449 6:163636179-163636201 CTCTGGGAGGCTCTGGGCTGGGG + Intergenic
1018945942 6:168346605-168346627 CCCTGGGTTGCTCTGGCTCGTGG + Intergenic
1019237097 6:170626859-170626881 CCCTAGTGGGCTCTGTGTTGGGG - Intergenic
1019303727 7:322460-322482 CCCTGGACGGAGCGGGGTTGGGG + Intergenic
1019334442 7:476379-476401 CCCTGAAGGGCTGTGGGGTGAGG - Intergenic
1019712778 7:2525026-2525048 CCCTGGAAGGGGCTGGGCTGCGG + Intronic
1020280175 7:6646314-6646336 CCCAGGATGAGTCTGGGATGTGG + Intronic
1023382475 7:39623168-39623190 CCCTGGGCGTCTCAGGGTTGAGG - Intergenic
1023990862 7:45127467-45127489 CCCAGGAAGGGCCTGGGTTGAGG - Intergenic
1025021400 7:55483249-55483271 CTCTGGGTGGCGCTGGGGTGAGG + Intronic
1025039141 7:55624458-55624480 ACCTGGAAGCCTCTGGGGTGGGG - Intergenic
1026273075 7:68853195-68853217 CCCTGCTTAGGTCTGGGTTGGGG - Intergenic
1026273159 7:68853726-68853748 CGCTGTTTGGGTCTGGGTTGGGG + Intergenic
1027662070 7:80998977-80998999 CCCTGGAGGGATGAGGGTTGAGG + Intergenic
1029382900 7:100225084-100225106 CCCAGGAAGGCTCTGGGTGGAGG + Intronic
1029890134 7:103919759-103919781 GCCTGGATGGCACCAGGTTGTGG - Intronic
1032838431 7:135695278-135695300 CCCTGGATGGCTCTGTGCAAGGG - Intronic
1034848815 7:154474445-154474467 CCCTGGCTGTCTCTGGGTTGTGG - Intronic
1035005311 7:155653487-155653509 CCCTAGATAGCTTTGGGGTGGGG + Intronic
1035274566 7:157739937-157739959 CCCTGGCTGGCTCTGGCTTCTGG - Intronic
1035848894 8:2894200-2894222 CCCTGGCTGTCTCTGAGGTGGGG - Intergenic
1039543122 8:38387347-38387369 CCCTGGATGGAGATGGGTTTTGG + Intronic
1039820095 8:41127409-41127431 CCCTGGGTAACCCTGGGTTGGGG + Intergenic
1040288408 8:46112009-46112031 CCCTGCAAGCTTCTGGGTTGGGG + Intergenic
1040854380 8:51933405-51933427 CCCTGGAGAGCTATGGGTAGGGG + Intergenic
1047393675 8:124474871-124474893 CCCAGGAGGTCTCTGGGTTTCGG - Exonic
1048440596 8:134456690-134456712 CCCTGGCTGCCTCTGGGTGGAGG - Intergenic
1049097105 8:140555280-140555302 CCCTGGAGGGCTCAGTGTTCAGG + Intronic
1049178764 8:141209685-141209707 CCCTGGCTGGCACTGGCTTCCGG + Intronic
1049540698 8:143207543-143207565 CCCAGGCTGGCTCTGGAGTGCGG + Intergenic
1049586474 8:143434779-143434801 CCCCAGAGGGCTCTGGGTGGAGG + Intergenic
1049785409 8:144448401-144448423 CCCAGCATGTCTCTGGGGTGGGG - Intergenic
1049870188 8:144968835-144968857 CCATGGATGGAGCTGGGTAGGGG + Intergenic
1053259142 9:36646598-36646620 CCCTGAGTGGCTCTGGATTGTGG + Intronic
1054752733 9:68924879-68924901 CAGTGGATATCTCTGGGTTGTGG - Intronic
1055064581 9:72105703-72105725 CACTTGAAGGCTGTGGGTTGTGG + Intergenic
1059106343 9:111515018-111515040 CAGTGGATGGCTATGGGTGGGGG - Intergenic
1060493761 9:124103082-124103104 CCCAGGATGGCTCTTGCTTTTGG - Intergenic
1061568259 9:131458851-131458873 CCCAGGATGGCCCTGGGCTCTGG - Intronic
1061802398 9:133119724-133119746 CCCTGGATAGATGAGGGTTGAGG + Intronic
1061812053 9:133167892-133167914 TCCTGGATGCCGCTGGGTTCTGG - Intergenic
1186250153 X:7656921-7656943 ACCTGTATGACTCTGGGTTAAGG - Intergenic
1187318533 X:18220414-18220436 CTCTTGGTGGCTCAGGGTTGGGG - Intronic
1189098900 X:38168745-38168767 CTGTGGATGGCTCTGGGAAGTGG + Intronic
1192847871 X:74924814-74924836 CCCCGGCTGGCTCGGGGTGGCGG - Intronic
1195094612 X:101492150-101492172 CAGTGGAGGGCTCTGGGCTGGGG + Exonic
1195997076 X:110741979-110742001 CATAGGTTGGCTCTGGGTTGAGG + Intronic
1196295564 X:113992987-113993009 CCTTGGCTGGCTGTGGCTTGAGG + Intergenic
1198055919 X:132994663-132994685 CTCTGGATGCCTCTGGATTTGGG - Intergenic
1198219750 X:134588553-134588575 CCCAGGATGGATGTGGGGTGAGG + Intronic
1198270903 X:135055383-135055405 CCATGGATGGGGCTGGGGTGGGG + Intergenic
1199685534 X:150261922-150261944 CCCTGGTTCTCTCGGGGTTGAGG + Intergenic
1200090684 X:153634479-153634501 CCCGGCCTGGCTCTGGGATGGGG - Intergenic
1201465837 Y:14279559-14279581 TCCTGGATGACTCTGGGTTAAGG - Intergenic