ID: 944605542

View in Genome Browser
Species Human (GRCh38)
Location 2:201348625-201348647
Sequence GTGTGTAAGGGGGTGGTGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1578
Summary {0: 1, 1: 1, 2: 8, 3: 152, 4: 1416}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944605542_944605554 5 Left 944605542 2:201348625-201348647 CCCCCCACCACCCCCTTACACAC 0: 1
1: 1
2: 8
3: 152
4: 1416
Right 944605554 2:201348653-201348675 GGCACACACACACTCAGTTCAGG 0: 1
1: 0
2: 3
3: 31
4: 339
944605542_944605556 16 Left 944605542 2:201348625-201348647 CCCCCCACCACCCCCTTACACAC 0: 1
1: 1
2: 8
3: 152
4: 1416
Right 944605556 2:201348664-201348686 ACTCAGTTCAGGGAACTGTGTGG 0: 1
1: 0
2: 0
3: 17
4: 176
944605542_944605555 6 Left 944605542 2:201348625-201348647 CCCCCCACCACCCCCTTACACAC 0: 1
1: 1
2: 8
3: 152
4: 1416
Right 944605555 2:201348654-201348676 GCACACACACACTCAGTTCAGGG 0: 1
1: 0
2: 4
3: 71
4: 632

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944605542 Original CRISPR GTGTGTAAGGGGGTGGTGGG GGG (reversed) Intronic
900016806 1:156862-156884 CTTTGGGAGGGGGTGGTGGGGGG + Intergenic
900047066 1:515454-515476 CTTTGGGAGGGGGTGGTGGGGGG + Intergenic
900069270 1:757169-757191 CTTTGGGAGGGGGTGGTGGGGGG + Intergenic
900188857 1:1345013-1345035 GTGAGTCAGAGGGTGCTGGGTGG - Intronic
900215642 1:1480187-1480209 GGGTGTGTGGGGGTGGGGGGTGG - Intronic
900357983 1:2273894-2273916 GTGAGTGAGAGGGTGGTGGGCGG - Intronic
900358965 1:2278846-2278868 GTGAGCCAGGTGGTGGTGGGGGG + Intronic
900428522 1:2591505-2591527 GGGGGTGAGGGGGTTGTGGGTGG + Intronic
900658066 1:3769942-3769964 CTGTGGTAGGGGGTTGTGGGGGG + Intronic
900663744 1:3799769-3799791 GGGTGCAAGGGGGTGCAGGGGGG - Intergenic
900710072 1:4108017-4108039 GTGTGTTTTGGGGGGGTGGGTGG - Intergenic
901166209 1:7223394-7223416 GTGTGTGAGTGTGTGATGGGAGG + Intronic
901179982 1:7335132-7335154 GTGTGTGTGGGGGGGGGGGGGGG + Intronic
901179984 1:7335134-7335156 GTGTGTGGGGGGGGGGGGGGGGG + Intronic
901209156 1:7514833-7514855 GCGAATAATGGGGTGGTGGGGGG - Intronic
901488078 1:9579320-9579342 GTGGGTAAGTGGGTGGGCGGGGG - Intronic
901745986 1:11373872-11373894 GTGTGGATGGGTGTGGTGTGTGG + Intergenic
902535121 1:17115287-17115309 GTCTGTGAGGTGGAGGTGGGAGG - Intronic
902742319 1:18447328-18447350 GTGTGTATGGTGGGGGTTGGGGG + Intergenic
902757806 1:18560646-18560668 TTTTTTATGGGGGTGGTGGGGGG - Intergenic
902835390 1:19043771-19043793 GGGTGGGAGGGGGTGGAGGGGGG + Intergenic
902838069 1:19059356-19059378 GGGTTCAAGGGGGGGGTGGGAGG + Intergenic
903143887 1:21357416-21357438 GTGTGAAAGGCTGAGGTGGGAGG - Intergenic
903338687 1:22641445-22641467 GTGTATGTGTGGGTGGTGGGGGG - Intergenic
903622460 1:24707813-24707835 GTGTGTGTGGGGGGGGGGGGGGG + Intergenic
903622462 1:24707815-24707837 GTGTGTGGGGGGGGGGGGGGGGG + Intergenic
903634789 1:24804507-24804529 GTGTGTATGTGGGTGGGTGGGGG + Intronic
903634798 1:24804533-24804555 GTGTGTATGTGGGTGGGTGGGGG + Intronic
903891488 1:26573190-26573212 GTGGGCAAGGGGGTTGGGGGAGG - Intronic
904049854 1:27632661-27632683 GTGTTTTAGAGGCTGGTGGGTGG - Intronic
904254324 1:29244954-29244976 GTGGGGACGGGGGTGGTGGTTGG + Intronic
904465856 1:30707214-30707236 ATGTGAAGGTGGGTGGTGGGGGG - Intergenic
904499213 1:30904531-30904553 GTGTGTTGGGGGTTGGTGCGAGG - Intronic
904568899 1:31445777-31445799 GTGTGTGTGTGTGTGGTGGGAGG - Intergenic
904814172 1:33182630-33182652 GTGTGTAAGGCGGTGAGGGGTGG + Intergenic
904842147 1:33379455-33379477 GTGGGTGGGGGGATGGTGGGGGG - Intronic
905145469 1:35883929-35883951 GAGGGTCAGGGGGCGGTGGGTGG + Intronic
905482093 1:38268644-38268666 CGGTGCAGGGGGGTGGTGGGGGG - Intergenic
905548901 1:38820200-38820222 GTGTGTGTGGAGGTGGTGGGAGG - Intergenic
906038112 1:42766008-42766030 GTGTGTGTGGGGGCGGGGGGGGG - Intronic
906083127 1:43107491-43107513 GGGGGGCAGGGGGTGGTGGGGGG + Intergenic
906083136 1:43107509-43107531 GGGGGTAGGGGGGCGGTGGGAGG + Intergenic
906083172 1:43107571-43107593 GGGGGTGTGGGGGTGGTGGGGGG + Intergenic
906547722 1:46633131-46633153 GTGTGTGGGGGGGTGGTGTACGG + Exonic
906641168 1:47441377-47441399 ATGTGTTAGGGGGTGGCGGGGGG - Intergenic
906904502 1:49875298-49875320 GTGTGGAGGGGGGAGGGGGGAGG - Intronic
907052812 1:51341179-51341201 GTGTGTGGGCGGGGGGTGGGGGG - Intronic
907334485 1:53691349-53691371 GTGTCTCATGTGGTGGTGGGAGG - Intronic
907617881 1:55943145-55943167 GTGTGGAGGGGGGTGGTGGCTGG + Intergenic
907663476 1:56414557-56414579 GTGTGTGTGTGTGTGGTGGGGGG - Intergenic
908227215 1:62068036-62068058 CTGTGTAAGGCCGAGGTGGGTGG - Intronic
908328894 1:63051078-63051100 GTGTGTACGGGGGTTGGGGACGG + Intergenic
908817543 1:68049963-68049985 GTGTGGAGGGGAGTGGGGGGGGG - Intronic
909115021 1:71522714-71522736 GTGTGTAAGGGGGGGGTAGAGGG - Intronic
909616488 1:77615924-77615946 GTGTGTGTGTGTGTGGTGGGGGG - Intronic
909662069 1:78095133-78095155 GTAAGTCAGGGGTTGGTGGGCGG + Intronic
909764717 1:79341275-79341297 GTGTGTGTGTGGGTGGGGGGGGG - Intergenic
910227103 1:84947299-84947321 GTGTGTGTGTGTGTGGTGGGGGG - Intronic
910480004 1:87648422-87648444 GTATTTTAGGGGGTAGTGGGAGG - Intergenic
910497587 1:87849603-87849625 GTGTGCAGCGGGGGGGTGGGGGG + Intergenic
910608305 1:89111622-89111644 GGGGGTAATGGGGTGGTGGGGGG + Intronic
910621430 1:89259826-89259848 GTGTGTGCGGGGGTGTCGGGGGG - Intronic
912212739 1:107572389-107572411 GTGTGTGCGGGGGAGGTGGATGG + Exonic
912259715 1:108098256-108098278 TTGTGTAAGGGCATGCTGGGGGG + Intergenic
912415065 1:109502484-109502506 GTGAGGATGTGGGTGGTGGGTGG + Intronic
912442894 1:109712482-109712504 GTGTGTTTGGGGGTGGGGGCGGG + Intronic
912465033 1:109866535-109866557 GTGTGTATGGGGATGGGGGTGGG + Intergenic
912777261 1:112513538-112513560 GAATGCAGGGGGGTGGTGGGGGG + Intronic
914380005 1:147107308-147107330 CTGTATGAGGGAGTGGTGGGAGG - Intergenic
914598036 1:149174003-149174025 GTGGGTTGGGGGGAGGTGGGAGG - Intergenic
914687211 1:149991221-149991243 GTGTTTGTGGGGTTGGTGGGAGG - Intronic
914900595 1:151709192-151709214 GTGGGGAAGGGGGAAGTGGGTGG + Intronic
915248241 1:154570923-154570945 AGGTAGAAGGGGGTGGTGGGTGG - Intronic
915287735 1:154863497-154863519 GTGTGTGCGGGGGTTGTGAGGGG - Intronic
915323812 1:155070414-155070436 GTGTGCAAAGGGGTGGGGGAGGG - Intergenic
915342863 1:155185754-155185776 GTGTGTGAGGGGGCTGGGGGAGG - Intronic
915413908 1:155725325-155725347 GTGTGGAAGGAGTGGGTGGGGGG - Intronic
915462915 1:156080711-156080733 GTGTGTCTGGGTGTGTTGGGAGG - Intronic
915852699 1:159343045-159343067 GTGTGTGGGGGGGGGGCGGGCGG + Intergenic
915925855 1:160019074-160019096 GTGTGTATGGGGGTGGCGGATGG - Intergenic
916088937 1:161291950-161291972 GTGTGTATTGGGGTGGGGGGTGG + Intergenic
916187224 1:162145247-162145269 GTATGTGAGGGGTGGGTGGGGGG + Intronic
916249680 1:162724763-162724785 GTGTGTAGGTGGGTGGCGCGGGG + Intronic
916435812 1:164776921-164776943 GTGTGTGTGTGTGTGGTGGGAGG + Intronic
916436600 1:164783366-164783388 GTCAGTAAGGTGGGGGTGGGGGG + Intronic
916809828 1:168295747-168295769 CTGGGAAACGGGGTGGTGGGGGG + Intronic
917002602 1:170375944-170375966 GTGTGTGTGGGGGGGGTGGGGGG + Intergenic
917121811 1:171651337-171651359 GTGTGTGTGGGGGGGGTGCGGGG - Intronic
917380090 1:174396893-174396915 GTTTGGAAGGTGGAGGTGGGAGG + Intronic
918377186 1:183920962-183920984 GTGTCGAGGGGGGTCGTGGGGGG + Intronic
918422882 1:184381940-184381962 GTGTGTGTGTGTGTGGTGGGGGG - Intergenic
918433222 1:184483905-184483927 GTGTGTGGGGCGGGGGTGGGGGG + Intronic
918447790 1:184632226-184632248 GTGTGTGAGGGTCTGGTGGGTGG - Intergenic
918473284 1:184897304-184897326 GTGTGTGTGTGTGTGGTGGGTGG + Intronic
918672656 1:187239149-187239171 GTGGGGGAGGGTGTGGTGGGGGG + Intergenic
918881625 1:190131174-190131196 GTGTGGCGGGGGGTGGGGGGTGG + Intronic
919009952 1:191947248-191947270 GTGTGTTGTGGGGTGGGGGGAGG - Intergenic
919786500 1:201261600-201261622 GTGAGCAAGGGGGTGATGGTGGG + Intergenic
919861266 1:201740570-201740592 GGGTGAAAGGAGGTGGTGGGAGG + Intronic
919924230 1:202184178-202184200 GTGTGTGTGTGTGTGGTGGGGGG + Intergenic
919974543 1:202602199-202602221 GAGTGTGAGGGTGGGGTGGGAGG + Intronic
920002132 1:202807649-202807671 GTGTGTGATGGGGTGGGGTGGGG - Intronic
920098239 1:203500220-203500242 GTGTGGAGGTGGGTGGTAGGTGG - Intronic
920232710 1:204481145-204481167 GTGTGTATGGGGAGGGTGTGAGG - Intronic
920422900 1:205847529-205847551 GTGTGTAAGGAGGTAGGGGTGGG + Intronic
920423556 1:205854208-205854230 GTGTGTAAGGAGGTAGGGGTGGG - Intergenic
920439879 1:205972782-205972804 GTGTGTGATGGGGTGGGGAGTGG - Intergenic
920558811 1:206924101-206924123 GTGTGTGAGTGTGTGGTGTGTGG + Intergenic
920558841 1:206924680-206924702 GTGTGTGAGTGTGTGGTGTGTGG + Intergenic
920669324 1:207991172-207991194 GAGTGTACGGGGGTGGGGGGTGG + Intergenic
920689517 1:208135151-208135173 ATTTCTTAGGGGGTGGTGGGGGG + Intronic
920816784 1:209342144-209342166 GGGTGAAAGGTGGTGGTGGGGGG - Intergenic
920866605 1:209758655-209758677 GTGGGTAATGAGGTCGTGGGAGG + Exonic
921341211 1:214136282-214136304 GTGAGGATGGGGGTGGTTGGGGG + Intergenic
921348771 1:214214164-214214186 GTGTGTGTGTGTGTGGTGGGGGG - Intergenic
921435052 1:215108832-215108854 GTGTGTGAGGGGTTGGGGAGAGG + Intronic
921712133 1:218383522-218383544 GTGTGTATGTGGGGGGTGTGGGG + Intronic
921974846 1:221191286-221191308 GCATGTATGGGGGTGGGGGGTGG - Intergenic
922090327 1:222389608-222389630 GAGGGTTAGGGGGAGGTGGGTGG - Intergenic
922104634 1:222502564-222502586 TTTTGGGAGGGGGTGGTGGGGGG + Intergenic
922434807 1:225593393-225593415 GTGTGTGTGGGGGGGGGGGGGGG + Intronic
922434809 1:225593395-225593417 GTGTGTGGGGGGGGGGGGGGGGG + Intronic
922531551 1:226349085-226349107 CTGTGTGTTGGGGTGGTGGGGGG + Intergenic
922618773 1:226978304-226978326 GTGTGCAGGTGTGTGGTGGGTGG - Intronic
922629033 1:227085186-227085208 GAGTGTATGTGGGGGGTGGGAGG - Intronic
922764894 1:228151593-228151615 GTGTGTGGGGGGGTGGAGGGAGG + Intronic
922856849 1:228782926-228782948 GTGTGTGTGGGTGTGGTGTGTGG + Intergenic
922881884 1:228987226-228987248 GTGTGTATGCGTGTGGGGGGGGG - Intergenic
923072036 1:230574507-230574529 GTGTGCATGGGGGTGGTGTGGGG + Intergenic
923420913 1:233813947-233813969 GTGTGTCTGGGCGGGGTGGGAGG + Intergenic
923471016 1:234291130-234291152 GTGTGTCAGGGAGGGGTTGGTGG - Intronic
923658012 1:235935079-235935101 GTGTGTGTGGGGGGGGTGTGGGG + Intergenic
923869090 1:237971560-237971582 GTGTGTGTGTGTGTGGTGGGGGG + Intergenic
924017585 1:239744365-239744387 GTGTGGAATGGGGTGGTGATGGG + Intronic
924085497 1:240447255-240447277 GTGTGTTGGGGGATGTTGGGAGG + Intronic
924089217 1:240485583-240485605 GTGTGTTAGGGGTAGGTGTGGGG - Intergenic
924227396 1:241933210-241933232 ATGTGGTAGTGGGTGGTGGGAGG - Intergenic
924302619 1:242654773-242654795 GCCTGTCAGGGGGTGGGGGGCGG + Intergenic
924346806 1:243080091-243080113 CTTTGGGAGGGGGTGGTGGGGGG + Intergenic
924437615 1:244056660-244056682 GGGTGGAGGGTGGTGGTGGGGGG - Exonic
924588611 1:245381737-245381759 GTTTGCCAGGGGCTGGTGGGAGG - Intronic
1062768820 10:84098-84120 ATGTGTGAGTGTGTGGTGGGTGG - Intergenic
1062831465 10:608486-608508 GTGTGTGTGGGGGGGGTGGGGGG - Intronic
1062831496 10:608551-608573 GTGTGTGTGGGGGGGGGGGGGGG - Intronic
1063039242 10:2319984-2320006 GTGTGTGTGTGTGTGGTGGGGGG - Intergenic
1063135201 10:3210192-3210214 GTGTGCGTGGGGGTGGTGGGCGG + Intergenic
1063170809 10:3508448-3508470 TTATGTAAGAGGGAGGTGGGAGG + Intergenic
1063225344 10:4010494-4010516 CTTTGGGAGGGGGTGGTGGGAGG - Intergenic
1063369856 10:5514127-5514149 CTGTGCTGGGGGGTGGTGGGTGG - Intergenic
1063378017 10:5565776-5565798 GTGTGGATGGTGGGGGTGGGAGG - Intergenic
1063669725 10:8090374-8090396 GTCTGTCAGGGGGTTGAGGGAGG - Intergenic
1064127529 10:12676365-12676387 GTGTGTCACGAGGTGGTGGCGGG - Intronic
1064288689 10:14014058-14014080 GTGAGTATCGGGGAGGTGGGTGG + Intronic
1064323552 10:14328356-14328378 GTGTGTGTGTGGGTGGGGGGGGG + Intronic
1064451340 10:15444844-15444866 GTGTGTGTGGGGGGGGGGGGGGG - Intergenic
1065021669 10:21507100-21507122 GTGTGTATGTGGGGGGTGGGAGG - Intergenic
1065139377 10:22705548-22705570 GTGCCTCAGGGGCTGGTGGGAGG - Intronic
1065288566 10:24208397-24208419 GTGTGTAAGTGTGTTGGGGGAGG + Intronic
1065513925 10:26506243-26506265 GTGTGTGTGGGGGGGGGGGGTGG + Intronic
1065513929 10:26506247-26506269 GTGTGGGGGGGGGGGGTGGGGGG + Intronic
1065789049 10:29243035-29243057 GTGTGTTGGGGAGTGGTGGTGGG - Intergenic
1065791709 10:29266304-29266326 GTGTGTATGTGGGCGGTGCGGGG - Intergenic
1065816973 10:29491340-29491362 GTGTGCATGGGCGTGGTAGGGGG - Intronic
1065860693 10:29870394-29870416 GTGTATGAATGGGTGGTGGGTGG - Intergenic
1066293265 10:34033105-34033127 GTATGTATGGTGGGGGTGGGGGG + Intergenic
1066469865 10:35687935-35687957 GTTGGTGAGGGGGTGGGGGGTGG + Intergenic
1066625266 10:37399698-37399720 GTGTGTATGTGGGTGGGCGGTGG + Intergenic
1066729541 10:38424771-38424793 CTTTGGGAGGGGGTGGTGGGGGG - Intergenic
1067092224 10:43273669-43273691 CTGTGCAAGGGGGCGGTGGGTGG + Intergenic
1067390703 10:45860503-45860525 GTGTGTGTGTGTGTGGTGGGGGG - Intergenic
1067550520 10:47231599-47231621 GTGTGTGTAGGGGTGGTGGCTGG - Intergenic
1067711571 10:48655249-48655271 GTGTGTGTGGGGGGGGGGGGGGG + Intronic
1067777588 10:49174692-49174714 GTGTGCAAAGCAGTGGTGGGGGG + Intronic
1067991867 10:51223008-51223030 GTGTGGCGGGGGGTGGTGCGGGG + Intronic
1068576939 10:58694710-58694732 ATGTGTTTGGGGGTGGTGGTGGG + Intronic
1068633678 10:59324752-59324774 GTGTATGAGGGGGTGGTGGCAGG - Intronic
1069286594 10:66722568-66722590 GTGTGTGGTGGGGTGGGGGGAGG - Intronic
1069870461 10:71529805-71529827 GTGGGTAAGGAGGAGGTGGGAGG - Intronic
1069943388 10:71970253-71970275 CTTTGTGAGGAGGTGGTGGGGGG - Intronic
1069981759 10:72257499-72257521 GTGTGTGTGGGTGTGTTGGGGGG + Intergenic
1070137890 10:73710738-73710760 GTGTGTGTGTGTGTGGTGGGGGG - Intergenic
1070524825 10:77286759-77286781 GTGTGTGCGGGGGGGGGGGGGGG + Intronic
1070713443 10:78700288-78700310 TTGTGTACTGGGGGGGTGGGAGG - Intergenic
1070775720 10:79108644-79108666 GTGTATTAGGGGGTGATGGTTGG - Intronic
1070782136 10:79143776-79143798 GTGTGATAGGGGCTGGGGGGTGG + Intronic
1071239313 10:83686752-83686774 GTGTGTGTGGGGGGGGGGGGTGG + Intergenic
1071239315 10:83686756-83686778 GTGTGGGGGGGGGGGGTGGGTGG + Intergenic
1071338978 10:84625221-84625243 GTGTGTGTAGGGGTGGGGGGTGG + Intergenic
1071396933 10:85233296-85233318 CTGTGGATGGGGGTGGTGAGCGG + Intergenic
1072107627 10:92289912-92289934 GTGTGTATGTGTGTGGTGGGGGG + Intronic
1073059543 10:100725074-100725096 GTGTGTATGGGGGAGGGGGAGGG - Intergenic
1073090006 10:100928032-100928054 GTGTGTGTGGGGGGGGGGGGGGG - Intronic
1073094360 10:100970568-100970590 TTGTGTGTGGGGGTGGTGAGGGG - Intronic
1073102650 10:101014870-101014892 GTGTGTGAGGGCGAGCTGGGGGG - Intronic
1073177466 10:101565207-101565229 GAGTGTATGGGGGAGGTGGGAGG - Intergenic
1073215848 10:101835671-101835693 GTGTGTAAAGGGGTGGGGAGAGG + Intronic
1073371372 10:102992618-102992640 GTGTGTAAAGGGGGACTGGGAGG + Intronic
1073465401 10:103692324-103692346 GTTTGGAAGGGGGTGGAGGCAGG - Intronic
1073959803 10:108912638-108912660 GTGTGTGTCGGGGGGGTGGGGGG + Intergenic
1073975661 10:109097772-109097794 GTGGGGTAGGGGGTGGGGGGAGG + Intergenic
1073982360 10:109169070-109169092 GTGTGTGTGGTGGTGGGGGGTGG - Intergenic
1074088543 10:110226639-110226661 GCGTGTAAGGGGGGCGTGTGAGG + Intronic
1074280238 10:112044581-112044603 GTCTGTCATGGGGTGGGGGGAGG + Intergenic
1074332063 10:112523576-112523598 GTGTGTGTGTGGGTGGCGGGGGG + Intronic
1074359976 10:112817838-112817860 ATGTTTAAGGGAGTGGTTGGGGG + Exonic
1074372729 10:112913366-112913388 GTGTGTGAGGGGTGGGTGTGTGG + Intergenic
1074422203 10:113319168-113319190 GTGTGTGTGGGGGGGGGGGGTGG + Intergenic
1074422205 10:113319172-113319194 GTGTGGGGGGGGGGGGTGGGTGG + Intergenic
1074672028 10:115802075-115802097 GTGTGTGTGGTGGTGGGGGGCGG - Intronic
1074706952 10:116141579-116141601 TTTTTTGAGGGGGTGGTGGGCGG + Intronic
1074768275 10:116716440-116716462 GTGTGTTGGGGGGTGGGGTGGGG + Intronic
1075275342 10:121087914-121087936 GTGTGTATGTGTGTGGTGTGCGG - Intergenic
1075541294 10:123316708-123316730 GTATGTAATAGGGTGGCGGGTGG + Intergenic
1075714054 10:124545638-124545660 GTGTGTCAGGGGGCGGGGTGGGG + Intronic
1075834243 10:125439983-125440005 GTGTGTGGGGGGGTGGGGGTTGG + Intergenic
1076047997 10:127310256-127310278 GGGGGTAAGGGGGTGGGGTGGGG - Intronic
1076117172 10:127908428-127908450 GTGTGTATGTGGGTGGGGAGGGG + Intronic
1076120516 10:127933244-127933266 GTGTGTATGGAGGGGGTGGTAGG - Intronic
1076120587 10:127934009-127934031 GTGTGTGCGCGGGGGGTGGGGGG - Intronic
1076292535 10:129358152-129358174 GTGTGTGTGGGGGGGGTGGGGGG + Intergenic
1076458105 10:130617862-130617884 AGGTGTAGGGTGGTGGTGGGTGG + Intergenic
1076480748 10:130783745-130783767 CTGTGTGAGGGGGTGCTGGTGGG + Intergenic
1076594114 10:131614732-131614754 GGGTGAAAGGAGGTGGTGAGTGG - Intergenic
1076884355 10:133254862-133254884 GTGTGTAGGTGTGTGGTGTGTGG - Intergenic
1076896685 10:133316674-133316696 GTGTGTGGGGGGGGGGGGGGGGG - Intronic
1076896687 10:133316676-133316698 GTGTGTGTGGGGGGGGGGGGGGG - Intronic
1076901242 10:133339121-133339143 GTGTGTCTGGGGGGGGTGTGTGG - Intronic
1076973396 11:151935-151957 CTTTGGGAGGGGGTGGTGGGGGG + Intergenic
1077093658 11:790354-790376 GTGGGTGAGGGGTCGGTGGGTGG + Intergenic
1077133699 11:987921-987943 GTGTGCAAGGGGCTCGTGGTGGG + Intronic
1077305576 11:1867338-1867360 GTGTGTGTGGGTGTGGTGGGTGG - Intronic
1077466630 11:2736613-2736635 CTGTGTAACTGGGGGGTGGGAGG - Intronic
1077736048 11:4792371-4792393 GTTTGTTAGGGGCTGGAGGGAGG - Intronic
1077924092 11:6663270-6663292 GTGTGTAAGTGTGTGGTAGTGGG + Intergenic
1078090021 11:8259314-8259336 GTGTGTGTGGGGTTGGGGGGCGG + Intronic
1078143142 11:8705999-8706021 GTTTGGGAGGGGGAGGTGGGAGG + Intronic
1078451952 11:11447081-11447103 GTGTGTAAGGGGGCAGTAGTTGG - Intronic
1078655917 11:13239023-13239045 GTGGGTAAGGGTTTGGTGGAGGG - Intergenic
1078855083 11:15200678-15200700 GTGTGTAAGTGTGTGTGGGGCGG + Intronic
1079016111 11:16870288-16870310 GTGTGTGTGGGGGTGGGGGTAGG - Intronic
1079204273 11:18400416-18400438 GTGTGTGTGGTGGTGGTGGTAGG - Intronic
1080001638 11:27356925-27356947 GTGGGGTTGGGGGTGGTGGGGGG + Intronic
1080451847 11:32384488-32384510 GTGTGTGGGTGGGTGGTGGTCGG - Intergenic
1080935261 11:36856835-36856857 GTGTGTGCGGGGGGGGGGGGTGG - Intergenic
1081049697 11:38322969-38322991 GTGTGTGTGTGTGTGGTGGGAGG + Intergenic
1081204588 11:40260403-40260425 GTGGGTTAGGGGGAGGGGGGAGG + Intronic
1081408164 11:42722372-42722394 GTGTGTGTGTGTGTGGTGGGGGG - Intergenic
1081502160 11:43677592-43677614 GCCTGTCATGGGGTGGTGGGGGG - Intronic
1081651171 11:44825087-44825109 GGGTGGTGGGGGGTGGTGGGAGG - Intronic
1081663644 11:44903753-44903775 GTGTGTGATGGGGTGGGGGGCGG - Intronic
1081670898 11:44942026-44942048 GTGTGTATGTGTGTGGTGTGTGG - Intronic
1081753416 11:45528037-45528059 GTGTGTGTGTGGGTGGAGGGTGG - Intergenic
1081846862 11:46247029-46247051 GTGGGCAAGGGGGTGGGGGTGGG - Intergenic
1081864137 11:46350503-46350525 GTGTGTATGTGGGTGGGGTGGGG - Intronic
1082059388 11:47847635-47847657 GTGTGTGTGGGGGTGGGGGGGGG + Intronic
1082141227 11:48611901-48611923 GTGGGTTATGGGGTGGGGGGAGG - Intergenic
1082625221 11:55476579-55476601 GACTGTTACGGGGTGGTGGGAGG - Intergenic
1082633412 11:55567381-55567403 GGGGGGAAGGGGGAGGTGGGAGG - Intergenic
1083068223 11:59947589-59947611 GTGTGTTGGGGAGTGGTGGCGGG + Intergenic
1084028470 11:66467098-66467120 GCGTGTCTGGGGGTGGTGGAGGG + Intronic
1084215406 11:67644725-67644747 GTGTGTGTGTGTGTGGTGGGGGG - Intronic
1084487111 11:69454908-69454930 GCATGTATGGGGGTGGGGGGGGG + Intergenic
1084525967 11:69698173-69698195 GTGGGGAAGGGGCTGGTGGGGGG - Intergenic
1084536551 11:69760804-69760826 GTGTGTCAGGGGGAGGGTGGTGG + Intergenic
1084665378 11:70573536-70573558 GTGTGTGTGGGGGCGGGGGGGGG + Intronic
1085089727 11:73700602-73700624 GTGTGTGTGGGGGGGGGGGGGGG + Intronic
1085329981 11:75640180-75640202 GTGTGTGGGGGGGTGGGGGTTGG - Intronic
1085486873 11:76872025-76872047 GGATGAATGGGGGTGGTGGGTGG - Intronic
1086000101 11:81973224-81973246 GTGTGTGTGTGTGTGGTGGGTGG - Intergenic
1086062752 11:82717356-82717378 GTGAGGAAGTGGGTGGGGGGGGG - Intergenic
1086189975 11:84067549-84067571 GTGTGTGTGTGTGTGGTGGGGGG - Intronic
1086935468 11:92741282-92741304 ATTTGTGAGGTGGTGGTGGGAGG - Intronic
1086996955 11:93368976-93368998 GTGTGTTGGGGGGTGGCTGGTGG - Intronic
1087308219 11:96508322-96508344 GTGTGTTTGGGGGTGGGGGTGGG + Intergenic
1087429916 11:98040567-98040589 GTGTGTATGTGGGTGGTTGTGGG - Intergenic
1087457498 11:98405187-98405209 ATGTGTGGGGGGGTGGGGGGAGG - Intergenic
1088200719 11:107330637-107330659 GTGTGTGTGTGTGTGGTGGGGGG - Intronic
1088223625 11:107594118-107594140 GTGTTTATGGTGGTGGTGGAGGG + Intronic
1088247969 11:107837901-107837923 GTGTATAAGGTGGGGGTGGGTGG - Intronic
1088630528 11:111769974-111769996 GGGTGTTAGGGGGTGGAAGGTGG - Intergenic
1089203275 11:116738517-116738539 GTGTGCACGTGGGTGGGGGGTGG + Intergenic
1089220999 11:116871570-116871592 GTGTGAAAAGGGCTGGTGGCAGG + Intronic
1089270816 11:117300252-117300274 GTGTGTAAGGTGGAGAGGGGAGG - Intronic
1089691350 11:120188704-120188726 GTGTGTAGGGGCGTGGGGTGAGG - Intergenic
1089975048 11:122725034-122725056 GGGGGTTAGGGGGTGGTGGGAGG - Intronic
1090252938 11:125263902-125263924 GCGTATAAGGGGGTGCGGGGAGG + Intronic
1090660498 11:128878695-128878717 ATGACTGAGGGGGTGGTGGGTGG - Intergenic
1091077463 11:132633715-132633737 GTGTGTATGGGTGTGGGGTGGGG + Intronic
1091196920 11:133739119-133739141 GTGTGTATGTGGGTGTTTGGGGG + Intergenic
1091208186 11:133834772-133834794 GTGGGTGGGGGTGTGGTGGGAGG - Intergenic
1091332375 11:134740101-134740123 GTGTGTGTGGGTGTGGTGTGTGG + Intergenic
1091332425 11:134740540-134740562 GTGTGTGTGGGTGTGGTGTGTGG + Intergenic
1091332968 11:134744881-134744903 GTGTGTGTGTGTGTGGTGGGGGG - Intergenic
1091590542 12:1840433-1840455 ATGTGGAAGAGGGGGGTGGGTGG + Intronic
1091669989 12:2446034-2446056 GTGGGTAAGTGGGTGGATGGTGG + Intronic
1091704406 12:2684040-2684062 GTGTGGCTGGAGGTGGTGGGAGG + Intronic
1091710980 12:2740390-2740412 GTGTGGCTGGAGGTGGTGGGAGG + Intergenic
1091799513 12:3316089-3316111 GTGTGTGTGTGTGTGGTGGGGGG + Intergenic
1091823286 12:3491884-3491906 GTGTGTTGGTGGGGGGTGGGGGG + Intronic
1092239399 12:6827980-6828002 GAGTGTGGGGGGGTGGGGGGGGG + Intronic
1092253963 12:6916269-6916291 GTGTGTGGGGTGGGGGTGGGGGG + Intronic
1092394089 12:8109828-8109850 GTGTGTAATGGGATGGTGTAAGG + Intergenic
1092728394 12:11506311-11506333 GTGTGGCTGGAGGTGGTGGGAGG - Intergenic
1093081903 12:14821996-14822018 GTGTGTGTGGGGGTGGGGTGGGG + Intronic
1093184271 12:16002126-16002148 GTGGGGAAGGGGGAGGGGGGAGG - Intronic
1093319204 12:17691841-17691863 GTGTGGTAGGGGGAGGAGGGAGG + Intergenic
1094078820 12:26509990-26510012 GTGTGTGTGTGTGTGGTGGGGGG + Intronic
1094794844 12:33959847-33959869 GTGTGTGTGTGTGTGGTGGGGGG - Intergenic
1095069488 12:37823515-37823537 GTGGGTTAGGGGGAGGGGGGAGG - Intergenic
1095082696 12:38025766-38025788 GTGTGTGTGTGTGTGGTGGGGGG - Intergenic
1095189793 12:39244327-39244349 GTGTGTGGGGTGGTGGGGGGGGG + Intergenic
1095500289 12:42830166-42830188 GTGTGTCAGGGGTGGGTGGGTGG + Intergenic
1095807377 12:46334892-46334914 AAGGGTAGGGGGGTGGTGGGGGG - Intergenic
1095958724 12:47820445-47820467 GTGTGTGTGTGTGTGGTGGGGGG - Intronic
1096214890 12:49793301-49793323 GTGGGTAGGGGGGTGGGGGCAGG + Intronic
1096412980 12:51390811-51390833 CTGTGTATGGGGGTGGAGGGTGG - Intronic
1096596239 12:52697577-52697599 GTGTGTAAGGGTGGGGGGCGGGG - Intronic
1096713071 12:53471988-53472010 GTTTTCAAGGGGTTGGTGGGGGG + Intronic
1096826863 12:54285882-54285904 GGGTGGGAGGTGGTGGTGGGTGG + Intronic
1096842052 12:54385650-54385672 GTATGAAAGGGGGTGGTGTCTGG - Intronic
1096863193 12:54545096-54545118 ATGGGGAAGGGGGTTGTGGGAGG - Exonic
1097145633 12:56937602-56937624 GAGAGTAATGGTGTGGTGGGAGG - Intergenic
1097938271 12:65277903-65277925 GTGTGGAGGGGGTTGGGGGGTGG + Intergenic
1098103893 12:67049066-67049088 CTGTGTAAGGCTGAGGTGGGAGG - Intergenic
1098281901 12:68870502-68870524 GTGAGTATGGGTGTGGTGGATGG + Intronic
1098579777 12:72085619-72085641 GTGTGTGTGTGTGTGGTGGGGGG + Intronic
1098683119 12:73382880-73382902 GTGTGTGTGTGGGTGGCGGGCGG - Intergenic
1098732919 12:74061539-74061561 GTCTGTCATGGGGTGGGGGGAGG + Intergenic
1098924773 12:76337342-76337364 TTGGGTTAGGGGGTGGTGGCTGG + Intergenic
1099143007 12:79003299-79003321 GTGTGTATGTGTGTGGTGGGGGG - Intronic
1099542629 12:83932134-83932156 GTGTGTGTGGGGGGGGGGGGCGG + Intergenic
1099653919 12:85465277-85465299 GTGTGTGTGTGTGTGGTGGGGGG + Intergenic
1100727593 12:97425415-97425437 GTGTGGGAGGGGGTGGTTTGGGG - Intergenic
1100755683 12:97748835-97748857 GAGTTTAAGAGGGTGGTGTGTGG + Intergenic
1101374028 12:104155256-104155278 GGGGGAAAGGGGGAGGTGGGGGG + Intergenic
1101674597 12:106906536-106906558 GTGTGGTTGGGGATGGTGGGTGG - Intergenic
1101757942 12:107635855-107635877 GTGTGTGGGTGGGTGGGGGGGGG - Intronic
1102009195 12:109607601-109607623 GTGTGTGTGGCGGGGGTGGGGGG - Intergenic
1102057629 12:109908432-109908454 ATGAGTAAGTGAGTGGTGGGAGG + Intronic
1102165443 12:110802547-110802569 GTGTATAAGGGGGTCTGGGGAGG + Intergenic
1102426458 12:112847980-112848002 GTGGGGAAGGGGGTGGGGCGGGG - Intronic
1102466021 12:113131240-113131262 GCGTGTGTGGGGGGGGTGGGGGG + Intronic
1102572707 12:113836904-113836926 GTGTGTATGTGGGGGGGGGGGGG - Intronic
1102720723 12:115013754-115013776 GCGTGTAGGGAGGAGGTGGGGGG - Intergenic
1102915486 12:116749282-116749304 GTCTCAAAAGGGGTGGTGGGGGG - Intronic
1103015219 12:117489152-117489174 GTGTGTGTGTGTGTGGTGGGCGG + Intronic
1103063251 12:117875858-117875880 GGGTGTGTGGTGGTGGTGGGGGG - Intronic
1103404392 12:120665060-120665082 GGGTGCAAGGGGTTGGGGGGAGG + Intronic
1103424717 12:120823202-120823224 GTGTGTGTGGGGGTGGGGGGTGG + Intronic
1103954451 12:124568418-124568440 GTGTGTGTGGGGGGGGCGGGGGG - Intergenic
1103962342 12:124617041-124617063 GTGAGTAAGGGTGAGGCGGGAGG - Intergenic
1104281641 12:127383346-127383368 GTGTGTTGGGGGGCGGAGGGGGG - Intergenic
1104360558 12:128129147-128129169 GTGTGTGTGGGGGGGGCGGGGGG - Intergenic
1104385228 12:128345062-128345084 GCCTGTTAGAGGGTGGTGGGCGG - Intronic
1104460566 12:128952418-128952440 GGGTGTAGGGTGGGGGTGGGGGG + Intronic
1104557885 12:129818417-129818439 GTGTGTATGTGTGTGGTGGGGGG + Intronic
1104586437 12:130051779-130051801 GTGTGGAAGGAGATGGTGTGTGG - Intergenic
1104801104 12:131555847-131555869 GTGTGTATGTGGGGGGGGGGTGG - Intergenic
1104876665 12:132039579-132039601 GTGAGAAACGGGGTGGTGGCGGG - Intronic
1105205324 13:18218436-18218458 GTTTGGAAGGTGGAGGTGGGCGG - Intergenic
1105532066 13:21229301-21229323 GTGAGTGTGGGGGGGGTGGGAGG - Intergenic
1105638420 13:22238513-22238535 GTGTGTGAGTGTGTGGTTGGGGG + Intergenic
1106138281 13:26990690-26990712 GCGTGTGAGGGTGTGGTGGGAGG - Intergenic
1106227933 13:27799045-27799067 GTGTGTGTGGGGGGGGGGGGTGG - Intergenic
1106229930 13:27813956-27813978 GTGTGTCAGGGGCAGGAGGGTGG - Intergenic
1106408058 13:29491037-29491059 GTGTGTGTGTGTGTGGTGGGAGG + Intronic
1106560769 13:30844209-30844231 GTGTGTGTGGGTGTGGTGTGTGG + Intergenic
1106813239 13:33380472-33380494 TTGTGTGTGGGGGGGGTGGGGGG - Intergenic
1106896631 13:34309868-34309890 GTGTGTTTGGTGGGGGTGGGGGG + Intergenic
1107013172 13:35687653-35687675 GTGGGTGCGGGGGAGGTGGGTGG - Intergenic
1107077974 13:36344384-36344406 GTGTGTAGGGGTGGAGTGGGAGG + Intronic
1107108688 13:36673744-36673766 GTGTGTCGGGGGGAGGAGGGGGG - Intergenic
1107283957 13:38768518-38768540 GTTTGGAAGGGCGAGGTGGGTGG - Intronic
1107484465 13:40813127-40813149 GTGTGTGTGTGGGTGGGGGGGGG - Intergenic
1108084227 13:46768204-46768226 CAATGGAAGGGGGTGGTGGGGGG - Intergenic
1108265427 13:48702252-48702274 GTCTGTCATGGGGTGGGGGGAGG + Intronic
1108561613 13:51649567-51649589 GTGGGGTAGGGGGTGGGGGGAGG - Intronic
1109013346 13:56977023-56977045 GTGTGTGTGGGTGTGGTGGTAGG + Intergenic
1109061598 13:57629137-57629159 GTGTGTCGGGGGTTGGGGGGTGG + Intergenic
1109725705 13:66338636-66338658 GTGTGTAGAGGGGTGGGGGGTGG + Intronic
1109952429 13:69516098-69516120 GCCTGTAAGGGGGTGGTTGTGGG + Intergenic
1110383031 13:74876257-74876279 TTGTGTGTGTGGGTGGTGGGTGG - Intergenic
1110943319 13:81380686-81380708 GTGTGACAGGGTGGGGTGGGGGG + Intergenic
1111251700 13:85609368-85609390 GTATGTGAGTGGGTGATGGGAGG - Intergenic
1111640083 13:90957603-90957625 GTGTGTGTGGGGGTGGGGGGGGG - Intergenic
1111646617 13:91039414-91039436 GCCTTTAAGGGGGTGGGGGGAGG + Intergenic
1111649314 13:91069202-91069224 GTGTGTCTGGGTGGGGTGGGGGG + Intergenic
1111757974 13:92422473-92422495 GTGTGTGAGATGGTGATGGGTGG - Intronic
1111786319 13:92791411-92791433 GTGTGTGAGTGTGTGGGGGGGGG + Intronic
1111869459 13:93812129-93812151 GAGTGCAAGGCGGTGGGGGGGGG + Intronic
1112298229 13:98207895-98207917 GTGTGTGTGGAGGTGGTGGTCGG - Intronic
1112310114 13:98310669-98310691 GTGTGACTGGTGGTGGTGGGTGG + Intronic
1112324275 13:98432940-98432962 GGGCGTTAGGGGGTGTTGGGGGG + Intronic
1112447373 13:99476574-99476596 GTGTGTGGGGGGGGGGTGGCGGG - Intergenic
1112503159 13:99957373-99957395 GTGTGTGTGGGGGGGGTGGTAGG + Intergenic
1112786456 13:102956943-102956965 TTGTGTTAGAGGGTGGAGGGAGG - Intergenic
1112826722 13:103400175-103400197 GTGGGATAGGGGGAGGTGGGAGG - Intergenic
1112827120 13:103404479-103404501 GGGTGTAAGGGAGTAGTGGGGGG + Intergenic
1112986656 13:105458273-105458295 GTGAGGAAGGGGGAGCTGGGGGG - Intergenic
1113098384 13:106690551-106690573 GTTTATCAGAGGGTGGTGGGGGG + Intergenic
1113109102 13:106802843-106802865 GTGTGTTGGGGGGTGGAGGCGGG + Intergenic
1113389594 13:109882666-109882688 GTGTGTGTGGGGGGGGGGGGTGG + Intergenic
1113389598 13:109882670-109882692 GTGTGGGGGGGGGGGGTGGGGGG + Intergenic
1113693808 13:112330256-112330278 GAGGGTGAGCGGGTGGTGGGAGG - Intergenic
1113873712 13:113581381-113581403 TTGTGTCTGGGGGTGGTGGGGGG + Intergenic
1113904942 13:113814852-113814874 GTGGGGCAGGGGGTGCTGGGGGG + Exonic
1114093197 14:19305959-19305981 GTGTGGATGGGGGTGGGGGGTGG - Intergenic
1114492643 14:23113048-23113070 GTGTGTGTGGTGGTGGTGGTGGG + Intergenic
1114494558 14:23123715-23123737 GGGAGTAAGGGGGTGGTGGAGGG - Intergenic
1115212736 14:30984130-30984152 GTGTGTGGGGGGGGGTTGGGGGG - Intronic
1115566386 14:34629051-34629073 GTGTGTATGTGGGGGGTGAGTGG + Intronic
1115981403 14:39055766-39055788 GTGTTTGAGGGAGTGCTGGGAGG - Intronic
1116157981 14:41232814-41232836 ATGTGTAAGGGTGAAGTGGGAGG + Intergenic
1116771460 14:49131614-49131636 GTGGGGGGGGGGGTGGTGGGGGG - Intergenic
1117450998 14:55849913-55849935 GTGAGGAAGGAGGTGGTGGTAGG - Intergenic
1117619293 14:57568075-57568097 GTGTGTAACAGGCTGGAGGGAGG + Intronic
1117627672 14:57656293-57656315 GTGTGTGTGGGGGGTGTGGGGGG - Intronic
1117628504 14:57665128-57665150 GTGTGCGGGGTGGTGGTGGGCGG - Intronic
1117963990 14:61188581-61188603 GTGTGTGTCGGGGGGGTGGGGGG + Intronic
1118005626 14:61562258-61562280 GTGTGTTGCGGGGTGGGGGGTGG - Intronic
1118011168 14:61612036-61612058 GTGTGTGTGGAGGGGGTGGGAGG - Intronic
1118064951 14:62180518-62180540 GTGTGGGTGGGGGTGGTCGGGGG + Intergenic
1118384328 14:65243247-65243269 GTGTGTGAGAGTGAGGTGGGTGG + Intergenic
1118667855 14:68089666-68089688 GGGGGAAAGGGGATGGTGGGAGG - Intronic
1118971412 14:70641644-70641666 GTCTGAAAGGAGGTGGGGGGAGG - Intergenic
1119093010 14:71801794-71801816 GTATGTATGGGGGTGGGGGCAGG + Intergenic
1119113475 14:71996780-71996802 GGGAGGAAGGGGGTGGCGGGAGG + Intronic
1119333000 14:73809479-73809501 GTGTCTTGGGTGGTGGTGGGAGG - Intergenic
1119521580 14:75289929-75289951 GTGTGTGAGGGGGCAGTGAGGGG + Intergenic
1119730841 14:76950286-76950308 GTGTGTAGGGGGCAGGTGGTGGG + Intergenic
1119864908 14:77965425-77965447 ATGTGTAGGGGTGGGGTGGGAGG + Intergenic
1119974586 14:79011367-79011389 GTGGGTTGGGGGGAGGTGGGGGG - Intronic
1119996718 14:79261637-79261659 GTGTGTGATGGGGTGGGGGCGGG + Intronic
1120410273 14:84145279-84145301 GTGTATAGGTTGGTGGTGGGAGG + Intergenic
1120723755 14:87915965-87915987 GTGTGTTGGGGGGTAGGGGGAGG + Intronic
1120816651 14:88866837-88866859 GTGTGTATGGGAGTCTTGGGTGG - Intronic
1121056290 14:90856829-90856851 GTTTTTCAGGGGCTGGTGGGAGG - Exonic
1121203931 14:92145340-92145362 GTGGGTTAGGGGGTGGTGTAGGG - Intronic
1121255068 14:92525129-92525151 GTGTGTATGGGGGTGGGGTGGGG + Intronic
1121273290 14:92651883-92651905 CTGGGGGAGGGGGTGGTGGGCGG - Exonic
1121563252 14:94889761-94889783 GTGTGCATGGGGGTGGAGGTGGG + Intergenic
1121627993 14:95400642-95400664 GGGTGTGGGGGGGTGGGGGGTGG + Intergenic
1121718998 14:96096200-96096222 GTGTGGTGGGGGGTGGGGGGAGG + Intergenic
1121746195 14:96295720-96295742 GTGTGTGTGTGTGTGGTGGGGGG - Intronic
1122041874 14:98993591-98993613 GTTTGGAAGGGAGAGGTGGGAGG - Intergenic
1122069679 14:99197536-99197558 GGGTGTCAGAGGGTGGTGAGGGG + Intronic
1122137686 14:99644458-99644480 GTGTGTGGGGGGGTGGGGCGGGG + Intergenic
1122434362 14:101684127-101684149 TTGTGTGTGGGGGTGGGGGGTGG + Intergenic
1122657393 14:103271390-103271412 GTGTGTGGGGGGGGTGTGGGGGG - Intergenic
1122657395 14:103271392-103271414 GTGTGTGTGGGGGGGGTGTGGGG - Intergenic
1122879849 14:104685836-104685858 ATGGGTAAGTGGATGGTGGGTGG + Intergenic
1123055971 14:105570913-105570935 GTGTATGAGTGGGTGGTGTGTGG - Intergenic
1123112482 14:105879867-105879889 GTGTGTAAGTGGTTGGGGGAGGG + Intergenic
1123208754 14:106738666-106738688 GTGTGTGTGGGGGGGGTAGGTGG - Intergenic
1123722282 15:23069763-23069785 GTGTGGGGGGGTGTGGTGGGGGG + Intergenic
1124106167 15:26740137-26740159 GTGAGGATGGGGATGGTGGGGGG - Intronic
1124452763 15:29811429-29811451 GGGGGTGGGGGGGTGGTGGGAGG + Intronic
1124641834 15:31400696-31400718 GTGTGGAAGGTGGAGGAGGGTGG + Intronic
1124875108 15:33584772-33584794 GTGGGTGAGGTGGGGGTGGGGGG - Intronic
1124884232 15:33669836-33669858 GTGTGTGTGGGGGGGGGGGGGGG + Intronic
1124998615 15:34748174-34748196 GTGTGTGTGTTGGTGGTGGGGGG - Intergenic
1125183014 15:36898633-36898655 GTGAGTAAGGGAGTGTTTGGGGG - Intronic
1125183983 15:36909842-36909864 GTGTGTGTGGGGGTGGGGGTGGG + Intronic
1125186225 15:36933594-36933616 GTGTGTGTGGTGGGGGTGGGCGG + Intronic
1125271195 15:37940497-37940519 GTGTGAGAGGAGGTGGTAGGTGG - Intronic
1125314655 15:38418223-38418245 GTGTGTGTGTGGGTGGTGGGGGG + Intergenic
1125376508 15:39035987-39036009 GGGTGGAAGGGGGAGGGGGGAGG - Intergenic
1125419327 15:39488319-39488341 GTGTGTGTGTGTGTGGTGGGGGG - Intergenic
1125501028 15:40240386-40240408 GTGTGTCAGGAGGAGGGGGGAGG + Intronic
1125548473 15:40526229-40526251 GTTTGTAAGTGTGTGTTGGGGGG + Intergenic
1125756164 15:42066451-42066473 GTGTGTGTGTGTGTGGTGGGGGG + Intergenic
1126067425 15:44836954-44836976 AGGGATAAGGGGGTGGTGGGTGG - Intergenic
1126092452 15:45063927-45063949 AGGGATAAGGGGGTGGTGGGTGG + Intronic
1126257761 15:46647947-46647969 GTGTGTGAGTGGGTGGGAGGTGG + Intergenic
1126685556 15:51246252-51246274 GTGTGTTTGGGGGTGAGGGGAGG - Intronic
1127222263 15:56892088-56892110 GTGTGTGAGCTGGTGGTGGAGGG + Intronic
1127304144 15:57685506-57685528 GTGTGTCGGGGGAGGGTGGGGGG + Intronic
1127360010 15:58237060-58237082 ATGGGTAAGTGGGTGGAGGGTGG + Intronic
1127390413 15:58500751-58500773 ATGAGAAGGGGGGTGGTGGGGGG - Intronic
1127453775 15:59140082-59140104 GTGTGTATGGGGGTGGGTGCGGG + Intronic
1127667984 15:61167829-61167851 CTGTGTAGGAGAGTGGTGGGTGG - Intronic
1127761947 15:62148125-62148147 GTGTGTATGTGTGTGGAGGGTGG + Intergenic
1128078476 15:64842444-64842466 GTGTGTATGTGTGTGTTGGGGGG + Intronic
1128078485 15:64842503-64842525 GTGTGTATGTGTGTGTTGGGGGG + Intronic
1128132748 15:65240296-65240318 GTGTGTGTGTGTGTGGTGGGGGG + Intronic
1128282552 15:66408536-66408558 GTGTGTGTGGGGGTGGTATGGGG + Intronic
1128397501 15:67243149-67243171 GTGGGCAGGGGGGTTGTGGGGGG + Intronic
1128514125 15:68331648-68331670 GTGCCAAAGGGGGTGATGGGAGG + Intronic
1128604716 15:69028116-69028138 GTGTCTGGGGTGGTGGTGGGGGG - Intronic
1128632439 15:69280390-69280412 GTGTGTGGGGGGGTGGTGATGGG - Intergenic
1128717652 15:69920386-69920408 GTGTGTGAGTGTGTGGTGTGGGG - Intergenic
1129151820 15:73693886-73693908 GTGTGTATGCGGTGGGTGGGGGG + Intronic
1129672993 15:77617321-77617343 GTGAGTAGGGGGGTTGGGGGAGG + Intronic
1129685301 15:77682732-77682754 GTGTGGATGGGGGTGGCTGGGGG - Intronic
1129710409 15:77817990-77818012 GTGTGGAGGGGTGTGGTGGCTGG - Intronic
1129732905 15:77942024-77942046 GTGTGTTGGCGGGGGGTGGGGGG + Intergenic
1129768013 15:78182415-78182437 GGGTGCAAGGGGGTTATGGGTGG - Intronic
1129787763 15:78320755-78320777 GTATGTCAGGGGGTGGGGGCGGG + Intergenic
1129797831 15:78391540-78391562 GAGTTTAAGGGGGTTGGGGGTGG + Intergenic
1130360452 15:83179994-83180016 GTGTGTATGTGTGTGGCGGGGGG + Intronic
1130961332 15:88660382-88660404 ATGTTTAAGGGGGTGGAGCGGGG - Intergenic
1131177580 15:90219712-90219734 GTGTGGAAGGGGGGGCTCGGCGG + Intronic
1131223920 15:90608144-90608166 GTGAGTAAGGGGATGGAGAGAGG + Intronic
1131241203 15:90744940-90744962 GTGTGGGAGGGTGAGGTGGGAGG + Intronic
1131313006 15:91307724-91307746 GTGTGTGTGTGTGTGGTGGGGGG + Intergenic
1131326342 15:91450460-91450482 GTGTGTGTGGGTGTGGGGGGTGG + Intergenic
1131545493 15:93312639-93312661 GTCTCTGAGTGGGTGGTGGGGGG + Intergenic
1131593571 15:93773989-93774011 GTGTGGATGGGGGAGGAGGGGGG - Intergenic
1131971624 15:97899357-97899379 TTAAATAAGGGGGTGGTGGGCGG - Intergenic
1131998244 15:98154269-98154291 GTGTGTGTGTGTGTGGTGGGGGG - Intergenic
1132045178 15:98557625-98557647 GTGTGTAATGGCGGGGTGGGGGG + Intergenic
1132166958 15:99602724-99602746 GTGTGTGGGGGGGTGGGGGTGGG + Intronic
1132177407 15:99726481-99726503 GTGTGGAGGGGAGGGGTGGGAGG - Intronic
1132457678 16:33122-33144 ATGTGTGAGTGTGTGGTGGGTGG - Intergenic
1132584217 16:699295-699317 GTCTGTAAGTGGGTGGCAGGGGG + Intronic
1132606997 16:797752-797774 GTGTGTGTGGGGGTGTTGTGGGG + Intronic
1132691299 16:1183038-1183060 GTGGGGGCGGGGGTGGTGGGTGG - Intronic
1132724573 16:1333345-1333367 GTCTAGAAGGGGGTGGTCGGCGG - Intergenic
1133069418 16:3235621-3235643 GAGAGTAGGGGGGTGGGGGGTGG - Intronic
1133165290 16:3942527-3942549 GTCTGTCATGGGGTGGGGGGAGG + Intergenic
1133483250 16:6192483-6192505 ATGTGTATGGGGGTGTTGGGAGG - Intronic
1133563742 16:6973185-6973207 GTGTGTGTGGTGGTGGGGGGCGG + Intronic
1133589284 16:7227281-7227303 GTGTGTGTGGGGGTGGGGTGGGG - Intronic
1134427441 16:14164447-14164469 GTGTGTGCGGGGGTGGGGGATGG + Intronic
1135003135 16:18793968-18793990 GTGTGTATGGCGGTGGTGGGTGG + Intronic
1135007955 16:18844458-18844480 GTGTGTAGGTGGGCGGGGGGGGG - Intronic
1135031933 16:19045466-19045488 GTGTGCATGTGTGTGGTGGGGGG - Intronic
1135113435 16:19707958-19707980 CTGTGTAGGGAGGTGGGGGGAGG - Intronic
1135193593 16:20375994-20376016 GTCTGGGAGGGGGTGGTGTGAGG - Intronic
1135528952 16:23236087-23236109 ATGTGACAGGGGGTAGTGGGAGG + Intergenic
1135964533 16:27024864-27024886 GTGTGTGTGGGGGGGGGGGGGGG - Intergenic
1135992899 16:27228587-27228609 GGGTGGAAGAGGGTGGTGGCTGG - Intronic
1135992937 16:27228699-27228721 GGGTGGAAGAGGGTGGTGGCTGG - Intronic
1136071800 16:27791867-27791889 GTGTGTTATTGGGTGGTAGGAGG - Intronic
1136114961 16:28088821-28088843 GTGTGTGGGGGGGTTGTGTGTGG - Intergenic
1136348860 16:29694501-29694523 GTGAGGAAGGGGGGCGTGGGGGG - Intronic
1136476446 16:30516743-30516765 GTGTGTGAGAGTGTGCTGGGCGG + Intronic
1136692787 16:32047788-32047810 GTGTGTGTGGGGGGGGTGGTTGG + Intergenic
1136793283 16:32991013-32991035 GTGTGTGTGGGGGGGGTGGTTGG + Intergenic
1137000439 16:35225160-35225182 GTGTGTCAGGGAGTGTTGGCGGG + Intergenic
1137278679 16:46956113-46956135 TTTTTTAAGGGGGTGGTGGTAGG + Exonic
1137288171 16:47033394-47033416 GTGTGGAGGGAGGCGGTGGGAGG - Intergenic
1137427783 16:48394347-48394369 GTCTGGATGGGGGTGTTGGGAGG - Intronic
1137507639 16:49068286-49068308 GTTTTTAAGGGGATGGTGGAGGG + Intergenic
1137603088 16:49769749-49769771 GTGTGAAATGAGGTGGTGGGGGG - Intronic
1137827099 16:51507883-51507905 GTGTGTAGGGAAGCGGTGGGAGG - Intergenic
1138234929 16:55374093-55374115 GTGTGTAAGTGTCGGGTGGGAGG - Intergenic
1138366272 16:56480322-56480344 GTGTGTGAGGGGGTGTTCTGTGG - Intronic
1138529340 16:57626714-57626736 GTGTGTGTGGTGGTGGTGGTGGG + Intronic
1138691748 16:58775280-58775302 GTGTGTGTGGGGGGGGGGGGTGG + Intergenic
1138903388 16:61301444-61301466 CTTTGGAATGGGGTGGTGGGTGG + Intergenic
1139035679 16:62943642-62943664 GTTTGAAATGGTGTGGTGGGGGG - Intergenic
1139839655 16:69868179-69868201 GTGTGTTGGGGGGTGGTGGCTGG + Intronic
1139846191 16:69923304-69923326 GTGTGTGTTGGGGGGGTGGGGGG + Intronic
1139912698 16:70408001-70408023 GTGTGTAAGTGGGTGGAGAGGGG - Intronic
1140043571 16:71425195-71425217 GTGTGTTGGGGGGGGGGGGGGGG + Intergenic
1140126362 16:72122047-72122069 GTCTGTCAGAGGGTGGAGGGTGG - Intronic
1140295084 16:73702162-73702184 GTGTGAACGGGGAGGGTGGGGGG - Intergenic
1140313743 16:73873091-73873113 GGGTGGTAGTGGGTGGTGGGTGG + Intergenic
1140313784 16:73873204-73873226 GGGTGGTAGTGGGTGGTGGGTGG + Intergenic
1140313816 16:73873292-73873314 GGGTGGTAGTGGGTGGTGGGTGG + Intergenic
1140517407 16:75553978-75554000 ATGTGATAGGGGATGGTGGGAGG - Intronic
1140929882 16:79617790-79617812 GTGTGTCTGTGTGTGGTGGGAGG + Intergenic
1140996799 16:80268035-80268057 GTGTGTGGGGGGCTGGGGGGTGG + Intergenic
1141266156 16:82499168-82499190 GTGTGTGTCGGGGGGGTGGGGGG - Intergenic
1141343261 16:83222990-83223012 GTGTGTGTGTGGGTGGGGGGTGG - Intronic
1141620751 16:85235563-85235585 GTGTGTGTGTGGGTGGGGGGGGG + Intergenic
1141633628 16:85302449-85302471 GTGTGTGTGGGGGCGGGGGGGGG - Intergenic
1141659680 16:85435299-85435321 GTGGGGGAGGGGGTGGTGGGAGG - Intergenic
1141675752 16:85516332-85516354 GAGTTCAAGGGGGCGGTGGGCGG + Intergenic
1141762703 16:86039072-86039094 GGAGGGAAGGGGGTGGTGGGTGG + Intergenic
1141882335 16:86868265-86868287 TTGTGTGAGGGTGAGGTGGGCGG + Intergenic
1141916006 16:87097571-87097593 GTGTGTCAGGGGGGGCGGGGGGG + Intronic
1141928417 16:87184415-87184437 GTGTGTGTGGAGGTGTTGGGAGG + Intronic
1142064763 16:88055274-88055296 GTGTGTGCGGAGGGGGTGGGTGG - Intronic
1142172601 16:88630747-88630769 GTGTGGGGGGGGGTGGGGGGTGG - Intronic
1142269553 16:89082042-89082064 GGGAGTAGGGGGGTGGTGAGGGG + Intergenic
1142345669 16:89552520-89552542 GTGTGCAAGGAGGTGGCGCGGGG - Intronic
1142446854 16:90145595-90145617 CTTTGGGAGGGGGTGGTGGGGGG - Intergenic
1203095542 16_KI270728v1_random:1252704-1252726 GTGTGTGGGGGGGGGGTGGTTGG + Intergenic
1142460635 17:89730-89752 CTTTGGGAGGGGGTGGTGGGGGG + Intergenic
1142629310 17:1214223-1214245 AGGTTTAAGGTGGTGGTGGGGGG - Intronic
1142639174 17:1275706-1275728 GTGTGTGTGGGGGGGGTGTGTGG + Intergenic
1142787617 17:2236375-2236397 GTGTGTTCGGGGGTGGGGTGGGG + Intronic
1142812085 17:2400148-2400170 GTGTGTAACGGAGTGGGGGTGGG - Intronic
1143077574 17:4357501-4357523 GTGTGTGTGGGGGGGGGGGGTGG + Intronic
1143240968 17:5443114-5443136 GTGTGGGCGGGGGGGGTGGGGGG - Exonic
1143272147 17:5683683-5683705 GTGTTTCAGGGAGTGGGGGGTGG - Intergenic
1143287993 17:5805450-5805472 GTGTGTCGGGGGGTGGGAGGAGG + Intronic
1143434672 17:6914733-6914755 GTGTGTGGGGGGGGGGGGGGGGG - Intronic
1143471596 17:7179103-7179125 GTGTGTTGGGGGGTGCTGGGTGG - Intronic
1143483104 17:7238432-7238454 GTGAGTACGGGGGCGGAGGGGGG - Intronic
1143590706 17:7884770-7884792 GTGGGTGGGGGGGTGGTGGGGGG + Intronic
1143619776 17:8074148-8074170 GTCTGGAAGGAGGTGATGGGAGG - Intronic
1143631724 17:8143729-8143751 GTGGGCCAGGGGGTGGAGGGTGG + Exonic
1143746943 17:9002121-9002143 GTGTGTGTGGGGGCGGGGGGCGG - Intergenic
1143746956 17:9002155-9002177 GTGTGTGTGGGGGTGGGGGGCGG - Intergenic
1143761988 17:9111419-9111441 GTGTGTGTGGTGGTGGTGGTAGG + Intronic
1143767830 17:9149254-9149276 GTGTGTGTGGGGGTGTGGGGGGG - Intronic
1143781032 17:9229894-9229916 GTGGGTCAGTGTGTGGTGGGCGG + Intronic
1143841680 17:9737220-9737242 GTGTGTGTGTGGGGGGTGGGGGG + Intergenic
1143873942 17:9977744-9977766 GTGGGGAAGGGGGGGGTTGGGGG + Intronic
1143997454 17:11019601-11019623 GTGTGTGTGTGTGTGGTGGGGGG + Intergenic
1144170981 17:12659758-12659780 GTGTGTCGGGGGGTGGGGTGGGG - Intergenic
1144192359 17:12858306-12858328 GTGAGTAGGGGTGTGGTTGGAGG - Intronic
1144591880 17:16531332-16531354 GTGTGTGTGGGGGTGGGTGGGGG - Intergenic
1144600503 17:16608578-16608600 TTCTGAAAGGGGGTCGTGGGTGG + Intergenic
1144710039 17:17395499-17395521 GTAAGTAAGGCGGTGCTGGGTGG + Intergenic
1144726506 17:17505096-17505118 GTCTGTATGGGGGTGAGGGGTGG - Intergenic
1144844239 17:18207840-18207862 GTGGAGAAGGGGGTGTTGGGAGG + Intronic
1144968861 17:19094488-19094510 GTGTGTGGGGGGGAGGTTGGAGG + Intronic
1144979055 17:19157578-19157600 GTGTGTGGGGGGGAGGTTGGAGG - Intronic
1144989167 17:19220654-19220676 GTGTGTGGGGGGGAGGTTGGAGG + Intronic
1145252041 17:21301979-21302001 GCGGGCAAGTGGGTGGTGGGTGG + Intronic
1145829115 17:27900808-27900830 GTGGGTTAGGGGGAGGGGGGAGG - Intergenic
1145867030 17:28248022-28248044 GTTTGAAAAGGTGTGGTGGGGGG + Intergenic
1145974781 17:28977765-28977787 GTGGGAAAGGGGGTGGGAGGGGG - Intronic
1146416457 17:32637761-32637783 GTGTGTGAGGGGGTTGGGTGAGG + Intronic
1146453498 17:32992618-32992640 GTGTGTGAGAGTGTGGGGGGTGG + Intronic
1146520059 17:33519359-33519381 GTGTTTAAGGGGGTGCTCAGTGG - Intronic
1146527921 17:33582744-33582766 GTGTATGAGGGGGTGGGGTGTGG - Intronic
1147120931 17:38334666-38334688 GAGTGGAAGGGGGTGTGGGGAGG + Intronic
1147168471 17:38605339-38605361 GTGTGGAAGGGGGAGGGGTGAGG - Intronic
1147314236 17:39611974-39611996 GTGTGTGGAGGGGAGGTGGGAGG + Intergenic
1147335597 17:39725405-39725427 GTGTGATGGGGGGTGTTGGGAGG + Intronic
1147387387 17:40090442-40090464 GTGTGGAAGGAGGAGGTGGATGG - Intronic
1148048415 17:44757993-44758015 GTGTGGTAGGGCATGGTGGGTGG - Intergenic
1148228354 17:45915264-45915286 GTGTGTATGTGTGTGGTGTGGGG + Intronic
1148349076 17:46926358-46926380 GGATGTTATGGGGTGGTGGGGGG + Intronic
1148403777 17:47392450-47392472 GTGTGTTGGGGGGTGGGGGTTGG + Intronic
1148789844 17:50167030-50167052 GTGTGTGAGGGGATGTGGGGGGG - Intronic
1148837637 17:50474268-50474290 GTGTGTAAGGTGGAGGAGGCTGG + Intronic
1149013508 17:51882450-51882472 GTGTGTATGGGTGTTGGGGGAGG + Intronic
1149109861 17:53015568-53015590 GCCTGTAAGGGGGTGGGGTGGGG + Intergenic
1149420493 17:56506211-56506233 GCCTGTCATGGGGTGGTGGGAGG - Intronic
1149431571 17:56598327-56598349 GTGTGTGTGTGTGTGGTGGGGGG - Intergenic
1149458692 17:56810150-56810172 GTGTGTGAGGTGGGGGTGTGAGG - Intronic
1149863350 17:60136693-60136715 GTGTGTCGGGGGGGGGGGGGGGG - Intergenic
1150160549 17:62894372-62894394 GGGTGGTGGGGGGTGGTGGGCGG - Intergenic
1150172117 17:63008835-63008857 GTGTGTGTGGTGGTGGGGGGTGG + Intergenic
1150470245 17:65431201-65431223 GTGGGGAATGCGGTGGTGGGTGG - Intergenic
1150478600 17:65492268-65492290 GTGTGAGAGGGGGTGGGGTGAGG + Intergenic
1150486028 17:65544382-65544404 GTGTGTGTGGTGGTGGTGGTGGG - Intronic
1150840535 17:68601599-68601621 GTGTGGGGGGGGGTGGGGGGAGG + Intergenic
1151145269 17:72034674-72034696 GTGTGTGAGGAGGTGGGGTGGGG - Intergenic
1151210264 17:72539150-72539172 GTGTGTGTGGGTGTGGTGGGGGG - Intergenic
1151369732 17:73640262-73640284 GTGTGTGGGGGGGTCGAGGGTGG + Intronic
1151491308 17:74433449-74433471 GTGTGTAGGTTGGTGGGGGGTGG - Intronic
1151631754 17:75315768-75315790 GCGTGTCAGGGAGGGGTGGGGGG + Intergenic
1151797060 17:76353515-76353537 CAGAGTAAGGGGGCGGTGGGAGG - Exonic
1151955727 17:77379237-77379259 GGGTGTCAGGAGGTGGAGGGGGG + Intronic
1152167947 17:78723194-78723216 GTGGGTAAGAGGCTGGTGGATGG - Intronic
1152312622 17:79560058-79560080 GTGGGTGGGTGGGTGGTGGGTGG + Intergenic
1152426907 17:80222967-80222989 GTGTGTAGGTGGGTGGGTGGTGG + Intronic
1152481986 17:80560485-80560507 GGGTGTGAGGTGGTGGTGGCTGG + Intronic
1152551410 17:81032193-81032215 GTCTGGGAGGGGGTGGTGGCTGG + Intergenic
1152609391 17:81308190-81308212 GTGAGCTAGGGGGTGCTGGGAGG - Intergenic
1152961706 18:83931-83953 ATGTGTGAGTGTGTGGTGGGTGG - Intergenic
1153073260 18:1131530-1131552 GTGTGTAGGAGGATGGAGGGAGG + Intergenic
1153326832 18:3829445-3829467 GGGTGGGAGGGGGTGGAGGGTGG + Intronic
1154080067 18:11247665-11247687 GTGTGAAAGTGTGTGGTGTGAGG - Intergenic
1154377729 18:13823322-13823344 GTGGGTGGGTGGGTGGTGGGTGG - Intergenic
1154490264 18:14916593-14916615 GAGTGTATGTGTGTGGTGGGTGG + Intergenic
1155333143 18:24738137-24738159 GTGTGTGTGGGGGTGGGGGCTGG + Intergenic
1155622213 18:27792756-27792778 GTGTGGACGGGGGTGTTGGGGGG + Intergenic
1155767938 18:29659160-29659182 GTATGTATGGGGGTGGGGGATGG + Intergenic
1156505038 18:37585108-37585130 GTGTGTGAGGGCAGGGTGGGAGG + Intergenic
1156519782 18:37712576-37712598 GTGTGTGAGGGAGGGGAGGGGGG - Intergenic
1156840841 18:41607963-41607985 GTGTGTGTGGGGGTGGGGTGGGG + Intergenic
1156953707 18:42936008-42936030 GTGCGAAAGGGGGTGGTGCAGGG + Intronic
1157066764 18:44359114-44359136 GCTTGTCAGGGGGTGGGGGGAGG - Intergenic
1157162260 18:45324750-45324772 GTGTGTGCGGGGGTGGGGGGCGG - Intronic
1157184625 18:45528175-45528197 GTGTGTGCGGGGGGGGGGGGGGG + Intronic
1157312059 18:46560064-46560086 GAGCGTAAGTGGGTCGTGGGGGG - Intronic
1157352915 18:46906766-46906788 GTGTGTGTGGGGGGGGGGGGAGG + Intronic
1157566384 18:48681490-48681512 GTCTGTAATGGGGTTGTAGGTGG - Intronic
1157650674 18:49327023-49327045 GTGTGTGTGTGTGTGGTGGGGGG + Intronic
1158408234 18:57179400-57179422 GTGTGTAGGTGGGAGGTGGCAGG + Intergenic
1158662000 18:59396610-59396632 GTGTGTGTGGTGGTGGTGGTGGG + Intergenic
1158714669 18:59867521-59867543 GGGTGTGAGGGGGTGGTGCTGGG - Intergenic
1158836140 18:61333669-61333691 GGGGGTAGGGGGGTGGGGGGCGG + Exonic
1158911947 18:62073199-62073221 GTGTGTAAGGGGGGGATGGAGGG + Intronic
1159448975 18:68575984-68576006 GTGTGTAGGGGGGTGTGGGAGGG - Intergenic
1159624411 18:70675384-70675406 GTGTGTAAAGGGATGGGGGAAGG + Intergenic
1160112957 18:76051001-76051023 GTGTGTAAGTGGGTTGGTGGTGG - Intergenic
1160266439 18:77343367-77343389 GTGTTGGAGGGGGTGTTGGGAGG + Intergenic
1160266475 18:77343457-77343479 GTGTTGGAGGGGGTGTTGGGAGG + Intergenic
1160350454 18:78174073-78174095 GTGGGTGGGGGGGTGGGGGGAGG + Intergenic
1160626443 18:80210890-80210912 GTGTGTTTGGGGATGGGGGGTGG - Intronic
1160632827 18:80258534-80258556 GTGTGTGTGGGTGTGGTGTGTGG + Intergenic
1160650352 19:222236-222258 CTTTGGGAGGGGGTGGTGGGGGG + Intergenic
1160960396 19:1718301-1718323 GTGAGTGGGTGGGTGGTGGGTGG + Intergenic
1160963260 19:1734201-1734223 GTGTGGCTGGGGGTTGTGGGGGG - Intergenic
1161271910 19:3394521-3394543 TAGTGTAAGCGGGTGGGGGGTGG - Intronic
1161721881 19:5907394-5907416 GTGTGGAAGGAACTGGTGGGAGG + Intronic
1161887486 19:7007953-7007975 GTGTGTGTGTGTGTGGTGGGGGG - Intergenic
1162015131 19:7841521-7841543 CTGTGTTTGGGGGTTGTGGGGGG - Intronic
1162547199 19:11338203-11338225 GTCTGTATTGGGGTGGAGGGTGG + Intronic
1162569784 19:11465234-11465256 GTGTGTATGTGTGTGGTGTGCGG - Intronic
1162796963 19:13092031-13092053 GTGTGTCTGGGAGTGGTTGGGGG + Intronic
1162966040 19:14156559-14156581 GTGTGTGTGGGGGGGGTGGGGGG + Intronic
1163323292 19:16587111-16587133 GTGTGTTGGGGGTTGGGGGGTGG - Intronic
1163633360 19:18427840-18427862 CTGTGGAAGGGGGTTGAGGGAGG + Intronic
1163637162 19:18442329-18442351 GTGTGTTGGGGTGTGGTGTGTGG - Intergenic
1163675807 19:18654726-18654748 ATGGGTAAGTGGGTGGAGGGAGG - Intronic
1164137344 19:22427183-22427205 GAGGCTAAGGGGGTGGCGGGGGG + Intronic
1164380318 19:27730991-27731013 TTGTGTGTGGGGGGGGTGGGGGG - Intergenic
1164498559 19:28793037-28793059 TCGTTTAAGGGGGTGGGGGGGGG - Intergenic
1164564087 19:29313649-29313671 GAGGCTCAGGGGGTGGTGGGAGG - Intergenic
1164664104 19:30011890-30011912 GTCTGTCATGGGGTGGGGGGAGG + Intronic
1164790572 19:30974242-30974264 GTGTGTAAGATGGAGGTGGAGGG - Intergenic
1165239034 19:34448627-34448649 GTGTGTAGAGGGGTTGGGGGAGG + Intronic
1165255295 19:34574057-34574079 GTGAGTATGGGTGTGGGGGGAGG + Intergenic
1165266806 19:34667817-34667839 GTGAGTATGGGTGTGGGGGGAGG - Intronic
1165323869 19:35102793-35102815 GTGAGTGAGGGGCAGGTGGGAGG - Intergenic
1165838779 19:38774537-38774559 GTGGGTTTTGGGGTGGTGGGTGG + Intergenic
1166359666 19:42247888-42247910 ATGTGTTGGGGGGTGGGGGGCGG - Exonic
1166729669 19:45052006-45052028 GTGTGTGAGGGGGTGGGGTTTGG + Intronic
1167072629 19:47229799-47229821 GTATGTATGTGTGTGGTGGGGGG - Intronic
1167087641 19:47321052-47321074 GTGTGTGTGGGGGGGGTGGGGGG - Exonic
1167610838 19:50507093-50507115 GTGGGTGGGTGGGTGGTGGGTGG - Intronic
1167713796 19:51127966-51127988 GTGACTCAGGGGGTGGTCGGGGG + Exonic
1167782189 19:51605977-51605999 GTGTGTGTGGGGGTGGAGGGAGG - Intergenic
1168281038 19:55305438-55305460 GAGTGGGAGGGGGTGGTTGGAGG - Intronic
1168316035 19:55485192-55485214 GTCTGGAAGGGGGTCGCGGGCGG - Exonic
1168328080 19:55548398-55548420 GTGTATGGGGGGGTGGTGGGTGG + Intergenic
924958080 2:10020-10042 GTGTGTGTGGGTGTGGTGTGTGG - Intergenic
924958112 2:10154-10176 GTGTGTGTGGGTGTGGTGTGTGG - Intergenic
925000818 2:401484-401506 GTGTGGAAGGCGGTGGAGGCTGG + Intergenic
925130874 2:1493196-1493218 GTGTGTGAGTGGGTGGGGGGGGG + Intronic
925140683 2:1547966-1547988 GTGTGTGTGTGTGTGGTGGGTGG - Intergenic
925140687 2:1548011-1548033 GTGTGTGTGTGTGTGGTGGGTGG - Intergenic
925154991 2:1642146-1642168 ATGTGTGTGTGGGTGGTGGGGGG + Intronic
925385420 2:3458516-3458538 GTGTGTATGTGTGTGGTGTGTGG + Intronic
925937578 2:8780528-8780550 GTGTGTGTGTGTGTGGTGGGGGG + Intronic
926209134 2:10856132-10856154 GTGTGTTGGGGGGGGGTGGTGGG + Intergenic
926533238 2:14078582-14078604 GTGTGTGTGTGTGTGGTGGGGGG + Intergenic
927211289 2:20640635-20640657 GTGTGTCAGGGGGTTGTATGTGG + Intronic
927702115 2:25275412-25275434 GTGTGTGAGGGGGCGGAGGGTGG - Intronic
927904834 2:26848696-26848718 GTGTGTATCTGGGTGGTGTGTGG - Intronic
928404648 2:31005266-31005288 GTGTGTGTGGGGGTGGGGAGTGG + Intronic
928483427 2:31706610-31706632 GGTGGAAAGGGGGTGGTGGGGGG - Intergenic
928507191 2:31965811-31965833 GCCTGTCAGGGGGTTGTGGGAGG + Intronic
928549618 2:32357692-32357714 GCGAGTCAGGGAGTGGTGGGAGG + Intronic
928685247 2:33743059-33743081 GTGTGGAAGGCCGAGGTGGGCGG - Intergenic
928887546 2:36167368-36167390 GTGTGTGTGGGGGGGGGGGGGGG - Intergenic
928937680 2:36696740-36696762 GTGTGTATGTGTGTGGGGGGGGG + Exonic
928938343 2:36703338-36703360 GGGTGTAGGGGGGTGGGGGTAGG - Intronic
929011233 2:37447277-37447299 GGGGGTGGGGGGGTGGTGGGTGG + Intergenic
929250527 2:39749755-39749777 GTCTGTCAGGGGGAGGTGGGAGG - Intronic
929932450 2:46269462-46269484 GTGTGTGAGGTGGGGGTGGGTGG - Intergenic
930002951 2:46873588-46873610 CTGTGCAATGGGGTGGTGGTGGG - Intergenic
930003497 2:46878122-46878144 GTGTGTATGTGTGTGGTGTGTGG - Intergenic
930226982 2:48804120-48804142 GTGTGTTGGGAGGTGGTAGGTGG + Intergenic
930385966 2:50695178-50695200 CTGGGTAAGGGGGTGGCGGTGGG + Intronic
930393460 2:50790128-50790150 GTGTGTGTGTGTGTGGTGGGAGG - Intronic
930904236 2:56546818-56546840 GTGGGGTAGGGGGAGGTGGGGGG + Intergenic
931710672 2:64987646-64987668 GTGTGTGGGGGGGGGGGGGGTGG - Intergenic
931715770 2:65027453-65027475 GTGTGTAGGGGTGTGGGGTGTGG - Intergenic
931748047 2:65307944-65307966 GTGTGAATGGGGGGGGCGGGGGG - Intergenic
932091224 2:68808090-68808112 GGGAGGAAGGGGGTGGTGGGAGG - Intronic
932091451 2:68809548-68809570 GTGTGAAAGGGGGTGGAAAGAGG + Intronic
932158454 2:69438897-69438919 GTGTGTGGGGGGGTGGGTGGGGG - Intergenic
932312321 2:70753583-70753605 GTGTGTCAGGGGTTGGGGGGTGG + Intronic
932417791 2:71584184-71584206 GTGTGAATGGGGGTGAAGGGTGG + Intronic
932529914 2:72518506-72518528 GTGTGTGTGTGTGTGGTGGGTGG + Intronic
932586770 2:73035231-73035253 GTGTGGATGGAGGAGGTGGGTGG - Intronic
932617659 2:73244963-73244985 CTGTGTCAGTGGGTGGTGGAGGG + Intronic
933100821 2:78254585-78254607 GTCTGTCAGAGGGTAGTGGGTGG - Intergenic
933365713 2:81351137-81351159 GTGGGGAAGGGGGAGGGGGGAGG - Intergenic
933555963 2:83831036-83831058 GTGTATATGGGGGTGGGTGGGGG - Intergenic
933690145 2:85173315-85173337 GTGGGTACGGAGGGGGTGGGGGG + Intronic
933703515 2:85273149-85273171 GTGAGTGAGGAGGAGGTGGGAGG - Intronic
933709583 2:85315573-85315595 CTGGGTGAGGGGGTGGAGGGAGG + Intergenic
933778943 2:85788211-85788233 GTGTGGAAGGGGGTGGAGGGCGG + Intergenic
934095174 2:88595134-88595156 GTGTGGAATGGGGTGGGGGTGGG + Intronic
934676606 2:96253813-96253835 GTGTGTAAGCAGGGGGTGGCTGG + Exonic
934768608 2:96894405-96894427 GTGGGTGAGTGGGTGGGGGGTGG - Intronic
935135342 2:100295625-100295647 GTGAACAAGGAGGTGGTGGGTGG + Intronic
935920221 2:108004662-108004684 GTGAGTGAGGGAGTGGTTGGAGG - Intronic
936321101 2:111467755-111467777 GTGTGTGGGGGGGGGGGGGGTGG + Intergenic
936339326 2:111617474-111617496 GTGTGTATGGGGGGGAGGGGAGG - Intergenic
936610266 2:113995813-113995835 GTCTGTCATGGGGTGGGGGGAGG - Intergenic
937000867 2:118466486-118466508 GTGTGTGTGTGTGTGGTGGGGGG - Intergenic
937087774 2:119182606-119182628 GTGTGTAAGTGTGTGTTGGGGGG - Intergenic
937145986 2:119644994-119645016 GGGTGGGAGGGGGTGGGGGGGGG - Intronic
937248947 2:120511381-120511403 GTGTGTGTTGGGGGGGTGGGGGG - Intergenic
937458033 2:122060816-122060838 TTGAGTAAGGGGGTGGGGGAAGG - Intergenic
937914436 2:127092093-127092115 GGGTGTAGGGGTGTGGTGGAGGG - Intronic
938119984 2:128626443-128626465 GTGTGCAAGGGGGAGATGTGGGG - Intergenic
938403375 2:131012572-131012594 GTGTGTTGGGGGGTGGGGGAGGG + Intronic
938546550 2:132337902-132337924 GTGGGGATGGGGGTGGGGGGTGG + Intergenic
938789740 2:134666168-134666190 TGGTGGAAGGTGGTGGTGGGTGG - Intronic
938841503 2:135169020-135169042 GTATATGGGGGGGTGGTGGGGGG + Exonic
938995731 2:136675492-136675514 GTGTGTAGTGGGGAGGGGGGTGG - Intergenic
939019280 2:136939862-136939884 GTGTGTCGGGGGGTGGTGGTAGG - Intronic
939064694 2:137468616-137468638 GTGTGTGGAGGGGTGGGGGGTGG + Intronic
939231568 2:139432789-139432811 GTGTGTTAGGGGGTGGGGGTTGG - Intergenic
939630681 2:144523733-144523755 GTGTGTGTGGAGGAGGTGGGGGG + Intronic
939816212 2:146900352-146900374 GTGTGTATATGGGTGGGGGGTGG + Intergenic
939939320 2:148330037-148330059 GTGTGTGTGGGGGGGGCGGGGGG - Intronic
940036533 2:149318065-149318087 CTGTGTAATGGTGTTGTGGGAGG + Intergenic
940214936 2:151295204-151295226 GTGTGTGTGGGGGGGGGGGGCGG - Intergenic
940447962 2:153800084-153800106 GTGTGTGTGGTGGTGGGGGGTGG - Intergenic
941391616 2:164921943-164921965 GTGTTTATGGGGGTTGTGGTTGG + Intronic
941937585 2:170997368-170997390 GTGTGTGTGGGTGGGGTGGGGGG + Intronic
942413812 2:175737677-175737699 GTGTGGATGTGGGGGGTGGGGGG - Intergenic
942662556 2:178281795-178281817 GTGGTGAGGGGGGTGGTGGGTGG + Intronic
942837055 2:180313372-180313394 GTGTGTGAGTGTGTGGTGTGGGG - Intergenic
942889133 2:180965537-180965559 CTGTGTCAGGGGGTGGGGGTAGG + Intergenic
943287124 2:186016267-186016289 GTGTGTATGGTGGCGGTGGGGGG - Intergenic
943848229 2:192679419-192679441 GTGTGTAGTGGCCTGGTGGGAGG + Intergenic
943950434 2:194127997-194128019 GTGTGTGAGTGTGTGGTGGGGGG - Intergenic
944068710 2:195646629-195646651 GTCTGTAGGGGGTTGGTGGTGGG - Intronic
944077631 2:195749831-195749853 GTGGGGAAGGGGGAGGGGGGAGG + Intronic
944163034 2:196686764-196686786 GTGTGTCAGAGGGTGGAGGGTGG - Intronic
944498190 2:200329696-200329718 GTGGGGAAGGGGGATGTGGGTGG - Intronic
944501114 2:200361070-200361092 GTGTGTGGGGGGGTGGGGTGGGG - Intronic
944605542 2:201348625-201348647 GTGTGTAAGGGGGTGGTGGGGGG - Intronic
944906436 2:204266343-204266365 GAATGTATGGGGGCGGTGGGGGG - Intergenic
944932344 2:204532639-204532661 GTGTGGAAAAGGGTGGAGGGTGG - Intergenic
945094062 2:206202685-206202707 GTGGGGATGGGGGAGGTGGGTGG + Intronic
945133058 2:206595474-206595496 GGGTGTGGGGGTGTGGTGGGGGG + Intronic
945343010 2:208680500-208680522 GCGTGTCATGGGGTGGGGGGAGG - Intronic
946066944 2:216996070-216996092 GTTTTTAAAGTGGTGGTGGGGGG + Intergenic
946076025 2:217074379-217074401 GTGTGTGTGTGTGTGGTGGGGGG - Intergenic
946139785 2:217680483-217680505 GTGTGTCAGGGGGAGGTGAGAGG + Intronic
946144412 2:217718129-217718151 GTGTGTGTGTGTGTGGTGGGGGG - Intronic
946186609 2:217984253-217984275 GTGTCTCAGGGGATGGTCGGGGG + Intronic
946322272 2:218960949-218960971 GTGTGTCAGGGGCTGGGGCGGGG - Exonic
946996018 2:225392313-225392335 GTCTGTCAGGGGGTGGGGGTAGG + Intergenic
947020280 2:225666850-225666872 GTGTGTGTTGGGGGGGTGGGGGG - Intergenic
947044876 2:225970460-225970482 GTGTGTGCGGCGGGGGTGGGGGG + Intergenic
947107853 2:226686277-226686299 GTGTGTATGGAGGTGGTGGCGGG + Intergenic
947333451 2:229054712-229054734 GTGTGTGTGGGGGGGGGGGGGGG + Intronic
947411718 2:229848320-229848342 GTGTGTGTGGGGGGGGCGGGGGG - Intronic
947510725 2:230752031-230752053 GTGTGTATGTGGGGGGGGGGGGG - Intronic
948190193 2:236052308-236052330 GTGTGTTTGGGGGTGGGGGCAGG - Intronic
948367246 2:237464946-237464968 GTGTGTGCGGGGGTGTGGGGGGG + Intergenic
948630768 2:239301159-239301181 CTGAGTAAGGGGGTGGTGCCCGG - Intronic
948720838 2:239899082-239899104 GTGTGGAGGGGTGTGGTGGAGGG + Intronic
948720875 2:239899209-239899231 GTGTGGAGGGGTGTGGTGGAGGG + Intronic
948968642 2:241406157-241406179 GGGTGTAGGGGCATGGTGGGGGG + Intronic
1168901583 20:1369490-1369512 GGGTTTAAGGGGAGGGTGGGTGG + Exonic
1169065102 20:2690750-2690772 GTGTGTGTGGGGTTGGGGGGTGG + Intergenic
1169141374 20:3229063-3229085 GTGGGTGAGGGTGGGGTGGGCGG - Intronic
1169218472 20:3806866-3806888 GTGTGTGGGGGGCTGGGGGGAGG - Intergenic
1169331682 20:4721443-4721465 GTGTGTGTGGTGGTGGGGGGGGG - Intergenic
1169425152 20:5491005-5491027 GTGTGTAGGGATGTGGTTGGGGG - Intergenic
1169831782 20:9833448-9833470 GTATGGATGGGGGTGGTGGGTGG - Intronic
1170081432 20:12480956-12480978 GCCTGTCATGGGGTGGTGGGAGG + Intergenic
1170417387 20:16159053-16159075 GTGTGCTTGGGGGTTGTGGGAGG - Intergenic
1170549397 20:17463659-17463681 GTGTGTGTGTGGGGGGTGGGGGG - Intronic
1170989331 20:21287543-21287565 GTGTGGGCGGGGGGGGTGGGGGG + Intergenic
1171236124 20:23526532-23526554 GGGGGTAGGGGGGTGGTGGCGGG - Intergenic
1171325977 20:24293219-24293241 GAGTGTAAGGCGGTGGGTGGGGG + Intergenic
1171429253 20:25070443-25070465 GTGTGCAGGGGGTTGGGGGGGGG - Intergenic
1171875414 20:30570634-30570656 GTGGGGATGGGGGTGGGGGGTGG + Intergenic
1172033944 20:31999027-31999049 GTGTGTGGGGGGGTGGGGGGTGG - Exonic
1172283744 20:33726309-33726331 GTGTGTGTGGGGGTGGTGGTGGG + Intergenic
1172444078 20:34984236-34984258 GTGTGTAAGGTCATAGTGGGAGG + Intronic
1172771180 20:37383537-37383559 GTGACTCAGGGGGAGGTGGGTGG + Intronic
1172841723 20:37906039-37906061 CTGTGTCTGGGGGTGGGGGGTGG + Intronic
1172883573 20:38217093-38217115 CTGTGCAAGTGGGTGGGGGGGGG + Intronic
1172937188 20:38628828-38628850 CTGTGAAAAGGGGTTGTGGGTGG + Intronic
1173635105 20:44548847-44548869 GTGTGTGTGTGTGTGGTGGGAGG - Intronic
1173656731 20:44704695-44704717 GTGTGTTAGGGGGAGGGTGGGGG - Intergenic
1173675931 20:44835775-44835797 GTGTGTATGTGGGGGGTGGGGGG - Intergenic
1173743016 20:45415970-45415992 GGGTCTAAGGGGGTACTGGGAGG - Intergenic
1174080548 20:47968379-47968401 GTGTGTGGGGGGGGGGGGGGAGG - Intergenic
1174142348 20:48424685-48424707 GTGTGCTAGGGGGCAGTGGGAGG - Intergenic
1174339624 20:49887720-49887742 GTGTCTAGGGAGGAGGTGGGAGG - Intronic
1174568376 20:51483608-51483630 GTGTGTGTGTGTGTGGTGGGGGG - Intronic
1175133250 20:56805372-56805394 GTGTGTGAGTGTGTGGGGGGAGG - Intergenic
1175164272 20:57032092-57032114 GTGTGTATGTGTGTGGTGTGTGG + Intergenic
1175669161 20:60886996-60887018 AGGTGGAAGTGGGTGGTGGGTGG - Intergenic
1176303732 21:5112847-5112869 GTGGTTACGGGGGTGGAGGGTGG + Intergenic
1176366840 21:6038325-6038347 GTGTGTAGGGTGGTGGGAGGTGG + Intergenic
1176372868 21:6073139-6073161 GTGTGTTGGGGGGGGGTGGGGGG - Intergenic
1177408599 21:20701612-20701634 GTGTGTTCGGGGGGGGTGGGGGG - Intergenic
1177610904 21:23447006-23447028 GTGTGTACGGGGTTGGAGGTGGG + Intergenic
1177823409 21:26056545-26056567 GGGGGCAGGGGGGTGGTGGGTGG - Intronic
1178220488 21:30652188-30652210 GCGTGTCATGGGGTGGGGGGAGG + Intergenic
1178494482 21:33075428-33075450 GTGTGTGGGGGGGTGGGGGTGGG + Intergenic
1178837861 21:36113662-36113684 GTGTGTGTGGGGGGGGGGGGGGG - Intergenic
1179165715 21:38933732-38933754 GTGTGTGTGTGGGTGGAGGGGGG - Intergenic
1179750609 21:43465104-43465126 GTGTGTTGGGGGGGGGTGGGGGG + Intergenic
1179756678 21:43500219-43500241 GTGTGTAGGGTGGTGGGAGGTGG - Intergenic
1179853300 21:44149103-44149125 GTGGTTACGGGGGTGGAGGGTGG - Intergenic
1179907045 21:44427810-44427832 TTGAGTAAGGAGGTGGTAGGAGG + Intronic
1179937835 21:44616371-44616393 GTGTGGAAGGTGGTGTGGGGTGG - Intronic
1180068637 21:45425157-45425179 GTGAGGAAGGAGGCGGTGGGTGG - Intronic
1180487536 22:15816606-15816628 ATGTGGATGGGGGTGGGGGGTGG + Intergenic
1180600001 22:17009348-17009370 GTGGGGATGGGGGTGCTGGGTGG + Intergenic
1180760651 22:18200285-18200307 GTTTGGAAGGTGGAGGTGGGTGG + Intergenic
1180770965 22:18384582-18384604 GTTTGGAAGGTGGAGGTGGGTGG + Intergenic
1180775017 22:18424411-18424433 GTTTGGAAGGTGGAGGTGGGTGG - Intergenic
1180808092 22:18735466-18735488 GTTTGGAAGGTGGAGGTGGGTGG - Intergenic
1180914553 22:19476571-19476593 GTGGATATGGGGGTGGGGGGTGG - Intronic
1181071016 22:20340431-20340453 GTTTGGAAGGTGGAGGTGGGTGG - Intergenic
1181182519 22:21078025-21078047 GTGTGAGCTGGGGTGGTGGGAGG - Intergenic
1181194088 22:21169380-21169402 GTTTGGAAGGTGGAGGTGGGTGG - Intergenic
1181215354 22:21323398-21323420 GTTTGGAAGGTGGAGGTGGGTGG + Intergenic
1181283233 22:21734833-21734855 GAGTGTCAGGGGCTGGTGGGTGG + Intronic
1181296796 22:21846959-21846981 GTGTGTTTGGCGGGGGTGGGGGG - Intronic
1181458675 22:23073570-23073592 GTGTGGCAGGGGCTGGTGTGGGG - Intronic
1181997158 22:26892046-26892068 GTGTGTGTGGGGGTGGGGGTGGG + Intergenic
1182786919 22:32915677-32915699 GTGGGTAAGGGGCAGGAGGGTGG + Intronic
1182941564 22:34282133-34282155 TTGTGTAACTGGGTGGAGGGTGG - Intergenic
1183131480 22:35840652-35840674 GTGTGTAGGGGGGAGGAGGTAGG + Intronic
1183267498 22:36838190-36838212 GTGTGTGTGGGGGGGGGGGGTGG + Intergenic
1183297896 22:37043018-37043040 GTGGGTCAGGGGGTGGTCGTAGG - Intergenic
1183299323 22:37051312-37051334 GTGTGTATAGGGGTGGGGGCGGG - Intergenic
1184035770 22:41917421-41917443 GTGTGGTGGGGGGTGGGGGGTGG - Intergenic
1184244555 22:43229222-43229244 GAGTTTGAGGGAGTGGTGGGTGG + Intronic
1184259159 22:43304845-43304867 GTGTGCAAAGGGATGGTGTGGGG - Intronic
1184268893 22:43366283-43366305 GTGTGTCTGGGGTGGGTGGGCGG - Intergenic
1184478984 22:44736353-44736375 GTGTCCAAGGGGATGGTGGGAGG - Intronic
1184533689 22:45072255-45072277 GTGTGTACGGGGGGCGAGGGTGG - Intergenic
1184852460 22:47128297-47128319 GGGTGGAGGGGGGTGATGGGTGG - Intronic
1185068019 22:48641635-48641657 GTGTGTGAGGGGAGGGTGTGCGG - Intronic
1203232799 22_KI270731v1_random:125754-125776 GTTTGGAAGGTGGAGGTGGGTGG + Intergenic
950097263 3:10337498-10337520 GTGTGTGGGGGGGTCGGGGGAGG + Intronic
950138503 3:10599794-10599816 TTCTATAAGGGGGTGGGGGGTGG + Intronic
950482068 3:13250503-13250525 GGGTGGAGGGTGGTGGTGGGGGG - Intergenic
950726901 3:14922574-14922596 GTGTGCATGGGGGTGGGGTGGGG + Intronic
950903586 3:16517633-16517655 GTGTGTGTGGGGGGGGGGGGGGG + Intergenic
951771157 3:26259100-26259122 ATGTGGAAGCGGGTGGTGGGGGG - Intergenic
951938597 3:28051971-28051993 GTGTGTGTGGTGGTGGAGGGTGG - Intergenic
952152952 3:30612385-30612407 GTGTGTATGCGTGTGTTGGGAGG + Intronic
952196421 3:31080336-31080358 ATATGTAAGTGGGAGGTGGGTGG - Intergenic
952424374 3:33159690-33159712 GTGTGTATGGGTGTGTTTGGTGG - Intronic
952643354 3:35625204-35625226 GTGTGTGTGTGTGTGGTGGGGGG - Intergenic
952647693 3:35681507-35681529 GTGTGTAAAGGGGGTGTGGATGG + Intronic
952653766 3:35758880-35758902 ATGTGTGTGTGGGTGGTGGGTGG + Intronic
953030700 3:39177967-39177989 GGTGGGAAGGGGGTGGTGGGCGG + Intergenic
953046874 3:39301357-39301379 GTGTGTTGGGGGGTGGAGGAAGG + Intergenic
953241753 3:41155758-41155780 GTGTGTAGGGTCGGGGTGGGGGG + Intergenic
953380939 3:42472723-42472745 GTGGGGGAAGGGGTGGTGGGTGG - Intergenic
953444661 3:42952822-42952844 GTGTGTGTGGGGGGGGGGGGGGG - Intronic
953506478 3:43490789-43490811 GTGTGTGTGGGGGTGGTGCTGGG - Intronic
953535730 3:43775307-43775329 GTGTGTGTCAGGGTGGTGGGGGG + Intergenic
953585827 3:44200194-44200216 GTGTGGGATGGGGGGGTGGGGGG - Intergenic
954134125 3:48574356-48574378 CTGTCTAGGGGGATGGTGGGTGG - Intronic
954757362 3:52848586-52848608 CTGTTTGTGGGGGTGGTGGGAGG + Intronic
954759806 3:52865890-52865912 GTGTGTGTAGGGGCGGTGGGGGG + Intronic
955042698 3:55332768-55332790 GTGTGGCACGGGGTGGTGGGGGG + Intergenic
955512346 3:59694086-59694108 GTGTATCAGAGGGTGGCGGGGGG + Intergenic
956121352 3:65969341-65969363 CTGTGTTAGGGGCTGGGGGGTGG + Intronic
956167718 3:66408948-66408970 GTGTGTGTGTGTGTGGTGGGGGG + Intronic
956276217 3:67504247-67504269 GTGGGTAGGGGGGTTGGGGGAGG + Intronic
956312525 3:67897030-67897052 GTGTGTGTGGGGGGGGGGGGGGG + Intergenic
956369198 3:68539706-68539728 GTGTGCATGTGTGTGGTGGGGGG + Intronic
956388233 3:68743777-68743799 GTTAGTAAAGGGGTGGAGGGTGG + Intronic
956596594 3:70973840-70973862 ATGTGTTGGGGGGTGGGGGGGGG - Intronic
957387972 3:79521730-79521752 GTGTGTGTGTGGGTGGGGGGTGG - Intronic
957426126 3:80041394-80041416 ATGTGTGTGGGGTTGGTGGGGGG + Intergenic
957803272 3:85114191-85114213 GTGTGTTAGGGGCTGGATGGGGG + Intronic
958019100 3:87977081-87977103 ATATGTAAGGGGATGGTGGGAGG - Intergenic
958111478 3:89152388-89152410 ATGTGAAAGGAGGTTGTGGGTGG - Intronic
958476333 3:94588397-94588419 GTGTGTAGGAGGGTAGTTGGGGG + Intergenic
958502795 3:94936370-94936392 GAGTGTAAGGGGATGGTAGCAGG - Intergenic
958592754 3:96180039-96180061 GTGGGGTAGGGGGAGGTGGGAGG - Intergenic
958645036 3:96859161-96859183 GTGTGTGAGTGTGTGTTGGGGGG - Intronic
958734089 3:97989343-97989365 GTGGGTGAGTGGGTGGTGTGTGG + Intronic
958875665 3:99613790-99613812 GTGTGTGGGGGGGGGGCGGGTGG - Intergenic
958883348 3:99697957-99697979 GTGGGTGAGGGGGTGGGGGAGGG - Intronic
959203240 3:103274753-103274775 GTGTGGTTGGGGGTTGTGGGGGG - Intergenic
959604564 3:108227884-108227906 CTATTTAAGGGGGTGGGGGGTGG + Intergenic
959837059 3:110931609-110931631 GTGTGTATGTGTGTGTTGGGGGG - Intergenic
959839742 3:110960388-110960410 GTGTGGAGGGGGGTGGTGGTTGG - Intergenic
960173108 3:114486130-114486152 GTGTGTGTGGGGGGGGGGGGCGG + Intronic
960291080 3:115885625-115885647 GTGTGTGTGGGGGTGGGTGGGGG + Intronic
960571286 3:119187711-119187733 TTGGGAAAGGGGGTGGAGGGTGG - Intronic
960702018 3:120448792-120448814 GTGTGGAAGGGGGTTGGGAGGGG + Intronic
960717114 3:120586768-120586790 GTGTGTGTGTGTGTGGTGGGGGG + Intergenic
961041948 3:123683798-123683820 GTATGTGACGGGGTGTTGGGGGG + Intronic
961386290 3:126525053-126525075 GTGTGAAATGGGTTGATGGGAGG - Intronic
961575871 3:127835771-127835793 GTGTGTTGGGCGGGGGTGGGTGG + Intergenic
961594563 3:128006514-128006536 GGGGGGAAGGGGGTGGTGGCGGG - Intergenic
961705199 3:128779578-128779600 GTGTGTTGGGGTGGGGTGGGGGG + Intronic
961739288 3:129022658-129022680 GGGTGTGAGGGGAGGGTGGGTGG + Intronic
962170242 3:133094227-133094249 GTGTGTGTGGGGGGGGTGGGGGG - Intronic
962180529 3:133201449-133201471 GCCTGTCAGGAGGTGGTGGGGGG - Intronic
962755551 3:138463096-138463118 GTGTGAAGGGAGGTGGTGGCGGG + Intronic
962949588 3:140205616-140205638 GTGTGTGTGTGGGTGGGGGGCGG - Intronic
963049351 3:141128129-141128151 GTGGGGAAGGGGGTGGAGTGTGG + Intronic
963303977 3:143629589-143629611 GTGTGTATGTGTGTAGTGGGGGG + Intronic
963350909 3:144149905-144149927 GTGTGTATGTGTGTTGTGGGGGG - Intergenic
963416289 3:144999965-144999987 GAGTTTTAGGGGGTGGGGGGTGG - Intergenic
963431856 3:145216806-145216828 GTGTGTGTGGGGGTGGGAGGGGG + Intergenic
963603740 3:147397358-147397380 GTGTGTGAGGGGGTGGCGGTTGG - Intronic
963842456 3:150121542-150121564 TTGTGTCAAGGGGTGGTGTGAGG + Intergenic
964225261 3:154391302-154391324 GTGTGTGGGGGGTTTGTGGGGGG + Intronic
964315199 3:155436228-155436250 ATGTGTAAGGTGGGGGTAGGAGG - Intronic
964389123 3:156179419-156179441 GGGGGTGAGGGGGTGGGGGGGGG - Intronic
964557349 3:157954157-157954179 GTGTGGAGGGGGGGGGCGGGGGG - Intergenic
964939464 3:162138092-162138114 GTGTGTTGGGGTGTGGTGGTGGG + Intergenic
966278648 3:178205377-178205399 GTGTGTATGGATGTGGTGTGGGG + Intergenic
966318074 3:178671099-178671121 GTGTGTTTTGGGGTGGGGGGTGG - Intronic
966417141 3:179701201-179701223 GTGTGTGCGGGGGTGGGGTGGGG + Intronic
966880116 3:184345316-184345338 CTGTGTGAGGGTGGGGTGGGAGG + Intronic
967467759 3:189827355-189827377 GTCTGTAAGGGGGAGCTGGTGGG - Intronic
967560297 3:190910051-190910073 GTGTGTGTGGGGGTGTGGGGTGG + Intergenic
967635153 3:191792076-191792098 GTGTGAAAGGACCTGGTGGGAGG - Intergenic
967746570 3:193062490-193062512 TGGGGTAAGGGGGTGTTGGGGGG - Intergenic
967815151 3:193792166-193792188 GTGTGGCGGGGTGTGGTGGGGGG + Intergenic
967988045 3:195110331-195110353 GTGTGTATGTGTGTGGTGTGTGG + Intronic
968367494 3:198197893-198197915 CTTTGGGAGGGGGTGGTGGGGGG - Intergenic
968612303 4:1562842-1562864 GTCTGGAAGGGGCTGCTGGGGGG + Intergenic
968626192 4:1627737-1627759 GAGGGCAAGGGGGTGGTGGAGGG - Intronic
968647983 4:1749410-1749432 GTGGGGAAGGGGGAGGTGGGGGG - Intergenic
968716706 4:2165403-2165425 GGCTGTCAGGGGCTGGTGGGAGG + Intronic
968719603 4:2191330-2191352 AAGGGTAAGGGGGCGGTGGGTGG + Intronic
968889813 4:3362516-3362538 GTGTGTGAGGGTGTGTTGTGAGG + Intronic
969413935 4:7046701-7046723 GTGTGGAAGGAGATGGTGTGGGG + Intronic
969575631 4:8034540-8034562 GGGTGCAGGTGGGTGGTGGGTGG + Intronic
969575661 4:8034626-8034648 GGGTGCAGGTGGGTGGTGGGTGG + Intronic
969575712 4:8034779-8034801 GGGTGCAGGTGGGTGGTGGGTGG + Intronic
969575723 4:8034811-8034833 GGGTGCAGGTGGGTGGTGGGTGG + Intronic
969575734 4:8034843-8034865 GGGTGCAGGTGGGTGGTGGGTGG + Intronic
969680290 4:8639618-8639640 GTGGGTAAGGGGGAGGGGAGAGG + Intergenic
969802715 4:9582015-9582037 TTTTGTGGGGGGGTGGTGGGTGG - Intergenic
970038176 4:11763781-11763803 GTGTGGAGGTGGGGGGTGGGGGG + Intergenic
970043447 4:11822728-11822750 GTGTGCAAGGTGGAGGTGGTTGG + Intergenic
970231318 4:13913965-13913987 GAATGTAAGGTGGTGGTTGGTGG + Intergenic
970346987 4:15161930-15161952 GTGTGGCAGGGGGTGGGGGAAGG + Intergenic
970897302 4:21118646-21118668 CAGTGCAAGTGGGTGGTGGGGGG + Intronic
971114655 4:23630749-23630771 GTGTGTGTGGTGGTGGTGGACGG - Intergenic
971215945 4:24662264-24662286 GTGTGTGTGGGGGCGGGGGGGGG - Intergenic
971303720 4:25462788-25462810 GTTTGAAAGGGAGTGGTGTGGGG - Intergenic
971589808 4:28453042-28453064 GTGTGTATGTGTGTGTTGGGTGG - Intergenic
971598149 4:28558241-28558263 GTGTGTGTGGGGGGGGGGGGGGG - Intergenic
971917816 4:32896617-32896639 GTGTGTTGTGGGGTGGGGGGAGG - Intergenic
972304142 4:37815757-37815779 GTGTGTGTGGGGGCGGGGGGGGG - Intergenic
972574618 4:40340210-40340232 CTGTGTAAAGGGGTGGAGAGTGG - Intronic
972893948 4:43595674-43595696 ATGTGTTTGGGGGTGGGGGGTGG - Intergenic
972989653 4:44808939-44808961 GCCTGTCAGAGGGTGGTGGGTGG - Intergenic
973811237 4:54572220-54572242 GGGTGTATGGGGGAGGAGGGAGG + Intergenic
974066368 4:57081378-57081400 GAGTGGGAGGGGCTGGTGGGGGG - Intronic
974145789 4:57945765-57945787 GTGTGTTTGGGGTTGGTGTGGGG - Intergenic
974586303 4:63883084-63883106 GTGAGGAAGGGGATGGGGGGTGG - Intergenic
974693440 4:65332602-65332624 GCTGGTAATGGGGTGGTGGGGGG + Intronic
974827086 4:67144906-67144928 GCCTGTTAGGGGGTGGGGGGAGG + Intergenic
974920447 4:68232851-68232873 ATTTGTAAGGGGGAGGGGGGAGG - Intronic
975121449 4:70732758-70732780 GTGGGTAGGGGGCTGGGGGGAGG + Intronic
975241979 4:72070553-72070575 GTGTGTGTGGGGGGGGGGGGTGG + Intronic
975977477 4:80115763-80115785 GTGTGTGGGGGGGTGGCTGGAGG - Intronic
976269071 4:83212435-83212457 GTGTGGGTGGGGGTGGTGGAGGG + Intergenic
976280339 4:83320791-83320813 GTGTCTAGGGGGATGGTCGGTGG - Intronic
976492110 4:85683104-85683126 GTGTGTGGGGGGGTGGGGGGGGG + Intronic
976659298 4:87522624-87522646 GTGTGTTTGGTGGTGGTGGCTGG - Intronic
977047857 4:92090142-92090164 GTGTGTTGGGGGGGGGGGGGGGG - Intergenic
977151203 4:93514406-93514428 GTGTGTACTGTGGAGGTGGGGGG - Intronic
977291655 4:95171382-95171404 GTGGGGTAGGGGGAGGTGGGAGG - Intronic
978052280 4:104216486-104216508 GTGAGCAAGTGGGTGGTGGGGGG - Intergenic
978493589 4:109334759-109334781 GTGTGTGGAGGGGTGGGGGGTGG - Intergenic
978576959 4:110197824-110197846 GTGTGAAAGGCAGTGGAGGGAGG - Intronic
978911574 4:114069871-114069893 GTGGGGTGGGGGGTGGTGGGAGG + Intergenic
978940906 4:114434967-114434989 GTGAGGAAGGTTGTGGTGGGGGG + Intergenic
979108628 4:116720634-116720656 GTGTGTCGGGGCGGGGTGGGGGG - Intergenic
980238668 4:130143214-130143236 GTGTGGAGGGGGGTGGTCGGGGG + Intergenic
980503447 4:133685326-133685348 GCCTGTCATGGGGTGGTGGGAGG - Intergenic
980580961 4:134749671-134749693 GTGGGGTAGGGGGAGGTGGGAGG - Intergenic
981041759 4:140229765-140229787 GTTGGTCAGGGGGTGGTGAGGGG - Intergenic
981183391 4:141772352-141772374 CTGTGTGTGGGGGTGGGGGGAGG - Intergenic
981546484 4:145899293-145899315 GTGTGGAAGGTGGGGGAGGGAGG + Intronic
981616802 4:146650926-146650948 ATATGTGAGGGGGTGATGGGCGG + Intergenic
981653249 4:147082640-147082662 CTGTGTAAGGGGGTAGAGTGAGG + Intergenic
981782699 4:148444966-148444988 GTGTGTGAGGGGGCGGTCGCAGG + Intergenic
981874944 4:149530797-149530819 GTATGTGGGGGGGGGGTGGGGGG - Intergenic
981874948 4:149530801-149530823 GTGTGTATGTGGGGGGGGGGTGG - Intergenic
981937313 4:150251081-150251103 GGGTGTGTGGGGGTGTTGGGGGG - Intronic
982062784 4:151621543-151621565 GTGTGGCAGGGGGTGGTGGGGGG + Intronic
982277791 4:153654585-153654607 GTGGGTAAGGGGGAGGCGGGGGG - Intergenic
982380432 4:154743127-154743149 GTGTGTAGGGCGGGGGGGGGGGG - Intronic
982705118 4:158700549-158700571 GTGTGTGTGTGTGTGGTGGGGGG - Intronic
982792494 4:159609561-159609583 GTCTGTCATGGGGTGGGGGGAGG - Intergenic
982831059 4:160061318-160061340 GCCTGTCAGGGGGTGGTGGGTGG - Intergenic
982895169 4:160911446-160911468 GTCTGCAGTGGGGTGGTGGGGGG + Intergenic
982998763 4:162384907-162384929 GTGTGCTTGGGGGTGTTGGGGGG + Intergenic
983074782 4:163312737-163312759 GTGTGTATGGGGGTGGCAAGGGG - Intergenic
983272289 4:165576389-165576411 GTGGGTAAAGGGCTGGTAGGTGG - Intergenic
983379676 4:166976106-166976128 GTGTGTGTGTGTGTGGTGGGTGG - Intronic
983457366 4:167982171-167982193 GCCTGTCAGGGGGTGGGGGGAGG - Intergenic
983622710 4:169776687-169776709 GTGTGTGTGGGCGGGGTGGGGGG - Intergenic
983917850 4:173311634-173311656 GTGGGCATGGGGGTGGGGGGTGG + Intronic
983946043 4:173586352-173586374 GTGTCTGAGGAGGTGCTGGGAGG + Intergenic
984199383 4:176698584-176698606 GTGTGTGTGGGGGAGTTGGGGGG + Intronic
984708359 4:182864108-182864130 TTGTGGAAGGGGGTGGGGAGGGG - Intergenic
985161261 4:187047253-187047275 GTGTGTGCGGGGGTGGGTGGGGG + Intergenic
985544738 5:503969-503991 GTGAGGAAGGTGGGGGTGGGTGG - Intronic
985560192 5:581732-581754 GTGTGTTAGAAGGTGGTGAGGGG + Intergenic
985640145 5:1059752-1059774 CTGTGTCGGGGGGTGGGGGGTGG + Intronic
985986540 5:3521206-3521228 GTGTGTGTGGGGGGGGGGGGGGG - Intergenic
986433041 5:7700695-7700717 GGGTGCGAGGGGGTGGGGGGTGG - Intronic
986799735 5:11246719-11246741 GTGGGTGGGGGGGTGGGGGGTGG + Intronic
986818846 5:11443396-11443418 GTGTGTGTGGGGGGGGTGTGTGG + Intronic
986835834 5:11636028-11636050 GTGTGTGTGGCGGGGGTGGGGGG - Intronic
986866904 5:11999953-11999975 GTGTGTGTGGTGGGGGTGGGGGG - Intergenic
987061382 5:14247063-14247085 GTGGGGAAGGGGGAGGTGGGGGG - Intronic
987095555 5:14546262-14546284 GTGTGTGTGTGTGTGGTGGGGGG + Intergenic
987264952 5:16243675-16243697 GTGTGTGTGGGGGTGGGGGCAGG - Intergenic
987544347 5:19293199-19293221 GTGTGTGTGTGTGTGGTGGGGGG + Intergenic
988610267 5:32717002-32717024 GCCTGTCAGGGGGTGGGGGGTGG - Intronic
988694292 5:33604542-33604564 CTAAGTAGGGGGGTGGTGGGGGG - Intronic
988945916 5:36199050-36199072 GTGGGGTAGGGGGTGGGGGGAGG + Intronic
989052722 5:37337098-37337120 GTGTATAAGGAGGTGAGGGGAGG - Intronic
989155488 5:38340841-38340863 GTGTTTGGGGGGGTGGGGGGTGG + Intronic
989672215 5:43932072-43932094 GCCTGTCAGGGGGTGGGGGGAGG - Intergenic
990109240 5:52303735-52303757 GTGTGTCAGGGAGTGGGGGGTGG + Intergenic
990588093 5:57232009-57232031 GTGTGTATCAGGGTGGGGGGTGG + Intronic
991038628 5:62153563-62153585 GTGTGTGTGGGGGGGGGGGGGGG - Intergenic
991246914 5:64518348-64518370 GTGTGTGTGGTGGTGGTGGCGGG + Intronic
992383134 5:76258152-76258174 GTGTGTAAGGAGTTTGTTGGAGG + Intronic
992476537 5:77107930-77107952 GTGTGTGGGGTAGTGGTGGGAGG - Intergenic
992597935 5:78364876-78364898 GTCTGTCATGGGGTGGGGGGAGG + Intronic
992849941 5:80797044-80797066 GTGTGTGAGGCGGGAGTGGGTGG - Intronic
992939047 5:81743800-81743822 GTGTGTAAGGGAGTGATGCTGGG + Intronic
993022860 5:82612582-82612604 GTGTGTAGGGGGTGGGAGGGTGG + Intergenic
993343340 5:86752432-86752454 GTGGGGTAGGGGGAGGTGGGAGG - Intergenic
993463648 5:88217570-88217592 GTGGGCGAGGGGGTGGTGGGGGG + Intronic
993807746 5:92433489-92433511 GTGTGTGTGGTGGTGGTGGGTGG - Intergenic
993828351 5:92721961-92721983 GTGTGTGTGTGGGGGGTGGGGGG - Intergenic
993855564 5:93070435-93070457 GTGTGTGCGGGGGCGGGGGGCGG + Intergenic
994340084 5:98616974-98616996 GTGTGTGGGGGGGTGGGAGGTGG - Intergenic
994639515 5:102389443-102389465 GTGTGTGTGGGGGTGGGGGGCGG - Intronic
994640068 5:102396652-102396674 GTGTGTAGGGGGTGGGTGAGTGG + Intronic
994682064 5:102900249-102900271 GTGTGTGGGGGGGGGGCGGGGGG + Intronic
994729638 5:103476723-103476745 CTGGGGAAGGGGGTGGTGGGGGG - Intergenic
994946955 5:106406863-106406885 GTGTGTTAGGGGTTGGGGAGTGG + Intergenic
995039361 5:107570643-107570665 GTGTGTGTGGGGGTGGGGGCGGG + Intronic
995188764 5:109298600-109298622 ATGGGTCAGGGGGTGGAGGGAGG - Intergenic
995191120 5:109319908-109319930 GTGTGTATGCGGGTGGGGGTGGG + Intergenic
995208095 5:109505072-109505094 GTCTGTCATGGGGTGGGGGGAGG + Intergenic
995219562 5:109632810-109632832 GTGTGTGTGTGGTTGGTGGGCGG - Intergenic
995277801 5:110296881-110296903 GTGTGTATGGGGGCTGTTGGGGG + Intronic
995841329 5:116446278-116446300 GTGTGTGTGGGGGTGGGGGATGG + Exonic
995871763 5:116750575-116750597 GTGTGTTTTGGGGTGGGGGGAGG - Intergenic
996198887 5:120645376-120645398 GTGTGTGGGGGGGGGATGGGTGG - Intronic
996210072 5:120798070-120798092 GTGTGTGTGTGTGTGGTGGGGGG + Intergenic
996283181 5:121757068-121757090 GTGTGTGTGTGTGTGGTGGGGGG - Intergenic
996443157 5:123513086-123513108 GTGTTTAAGGGGTTGGGTGGGGG + Intronic
996772125 5:127097008-127097030 GTGTGTGGGGGGGGGGGGGGCGG + Intergenic
996978047 5:129459225-129459247 GTGTGTAATGGGGTGGGGTAGGG + Intergenic
997201620 5:132013226-132013248 GAGTGTATGGGTGGGGTGGGGGG - Intergenic
997426815 5:133808862-133808884 TTGTGTGCGGGGGCGGTGGGGGG - Intergenic
997510471 5:134450388-134450410 GTGTGTAAGGGGGATGTAGTGGG + Intergenic
997554931 5:134787895-134787917 GTGTGTGGGGTGGTGGGGGGAGG + Intronic
997692604 5:135836964-135836986 GTGTGGGGGGGGGGGGTGGGGGG - Intronic
997692608 5:135836968-135836990 GTGTGTGTGGGGGGGGGGGGTGG - Intronic
998005100 5:138651525-138651547 GTGTGTGTGGGGGTGGGGGCAGG - Intronic
998132381 5:139657926-139657948 GAGTGAGAGTGGGTGGTGGGGGG - Intronic
998256847 5:140594617-140594639 GTGTGTGTTGGGGTGGGGGGTGG - Intergenic
998298241 5:140992672-140992694 GTGTGTTAGGGGTTGAGGGGTGG + Intronic
998350296 5:141496080-141496102 GGGTGTTGGTGGGTGGTGGGTGG - Intronic
998400368 5:141845707-141845729 GTGTGAAGGGGGAGGGTGGGTGG - Intergenic
998401397 5:141850749-141850771 GTGTGTAGGGGGGTGGGGGTCGG - Intergenic
998903619 5:146880211-146880233 GTGTGTGTGTGTGTGGTGGGGGG + Intronic
999166075 5:149550771-149550793 GGGTGCACGGTGGTGGTGGGGGG + Intronic
999510866 5:152250475-152250497 CAGGGTAAGCGGGTGGTGGGAGG - Intergenic
999588170 5:153114512-153114534 GTGTGTAGTGGGGCGGTGAGGGG + Intergenic
999652091 5:153777677-153777699 GTGTGTGAGGGGGATGAGGGTGG - Intronic
999652216 5:153778644-153778666 GTGTGTGTGTGTGTGGTGGGGGG - Intronic
999726612 5:154443539-154443561 GTGTGTGTGGTGGTGGTGGTGGG - Intergenic
1000107353 5:158072887-158072909 CTGTGTGTGGGTGTGGTGGGGGG + Intergenic
1000122623 5:158211648-158211670 GTCTGTCATGGGGTGGGGGGAGG + Intergenic
1000227858 5:159285189-159285211 GTGTGTGTGTGTGTGGTGGGAGG - Exonic
1000343368 5:160294619-160294641 TTGTGTATGGGGGTGTTTGGAGG - Intronic
1000795894 5:165663916-165663938 GTGTGTGGAGGGGTGCTGGGTGG + Intergenic
1000928507 5:167223332-167223354 GGGTGTATGGGGGTGGGGGTCGG - Intergenic
1001010155 5:168090211-168090233 GTGTGTGTGTGTGTGGTGGGGGG - Intronic
1001051194 5:168415791-168415813 GTGTGTGTGGGGGGGGGGGGGGG + Intronic
1001110690 5:168893712-168893734 GTGAGTGAGGGGGAGGTGGCAGG + Intronic
1001200514 5:169711864-169711886 GTGTGTAGGGGGGTGCAGTGGGG + Intronic
1001388571 5:171359969-171359991 GAGTGAAAGGGGGTCCTGGGTGG - Intergenic
1001663463 5:173413474-173413496 CTGGGTGAGGGGATGGTGGGGGG + Intergenic
1001675089 5:173505383-173505405 GTGTGTGTGGGAGGGGTGGGTGG + Intergenic
1001757964 5:174185501-174185523 GTGTATGTGGGGGTGGTGGGTGG + Intronic
1001823823 5:174730219-174730241 GTGTGTGGTGGGGCGGTGGGGGG - Exonic
1001961832 5:175884290-175884312 GTGTGTGTGCGGGGGGTGGGGGG - Intergenic
1001969105 5:175939472-175939494 GTGGGGAGGGAGGTGGTGGGAGG - Intronic
1001975680 5:175996760-175996782 GTGGGGAGGGAGGTGGTGGGAGG - Intronic
1002130479 5:177078457-177078479 GGGTGCCAGTGGGTGGTGGGGGG + Intronic
1002187201 5:177459892-177459914 GTGTGTCTGGGGCTGGTGTGAGG - Intronic
1002241748 5:177847012-177847034 GTGGGGAGGGAGGTGGTGGGAGG + Intergenic
1002248335 5:177904271-177904293 GTGGGGAGGGAGGTGGTGGGAGG + Intergenic
1002346090 5:178548060-178548082 GTGTGTGTGGGGGTGAGGGGGGG - Intronic
1002419729 5:179139326-179139348 GTGTGTGGGGGTGAGGTGGGAGG + Intronic
1002654854 5:180737832-180737854 CTGTGGAAGGCAGTGGTGGGAGG - Intergenic
1002654861 5:180737897-180737919 CTGTGGAAGGCAGTGGTGGGAGG - Intergenic
1002654868 5:180737962-180737984 CTGTGGAAGGCAGTGGTGGGAGG - Intergenic
1002663147 5:180804313-180804335 ATGTGTGCGGGGGTGTTGGGGGG - Intronic
1002726718 5:181303120-181303142 CTTTGGGAGGGGGTGGTGGGGGG - Intergenic
1202772758 5_GL000208v1_random:26871-26893 GTGTGGTGGGGGGAGGTGGGAGG + Intergenic
1002987582 6:2205769-2205791 GTGTGTGTGGGGGGGGAGGGGGG + Intronic
1003062865 6:2876181-2876203 GGGGGTAAGGGGGGGATGGGGGG - Intergenic
1003338108 6:5194065-5194087 GTGTGTGGGGGGGTGGGGGGTGG + Intronic
1003350484 6:5313094-5313116 CTGTGTTAGGGGGTGTTGGTTGG - Intronic
1003476025 6:6483838-6483860 GTGTGTGTGGGGGTGGGGGGAGG - Intergenic
1003627757 6:7758787-7758809 ATGTGGAAGGGGGTGGAGAGAGG - Intronic
1003715611 6:8642914-8642936 AAGTGTAATGGGGTGGTGGGGGG + Intergenic
1004020160 6:11769996-11770018 GTTTGTAAAATGGTGGTGGGCGG - Intronic
1004080389 6:12386756-12386778 GTGTGTGTGGGGGGGGTGGTGGG + Intergenic
1004103588 6:12641786-12641808 GCTTGTCAGGGGGTGGGGGGTGG - Intergenic
1004351954 6:14897995-14898017 GTGTGTGTGGTGGTGGGGGGAGG - Intergenic
1005150019 6:22737872-22737894 GTGTGTGGTGGGGTGGGGGGTGG + Intergenic
1005188198 6:23186549-23186571 GTGTGTGTGTGTGTGGTGGGGGG - Intergenic
1005194251 6:23264664-23264686 GTGTGTGTGGTGGGGGTGGGTGG + Intergenic
1005199252 6:23324703-23324725 GTGTGTATGTGTGTGTTGGGGGG - Intergenic
1005227134 6:23655979-23656001 GTGTGTGTGGGGGGGGGGGGGGG + Intergenic
1005463298 6:26089101-26089123 GTGTGTGTGGGGGGGGGGGGCGG + Intronic
1005574366 6:27178166-27178188 GAGTGTATGTGTGTGGTGGGGGG - Intergenic
1005985592 6:30872561-30872583 GTGTGTTAGGGGGTGTTGTCTGG + Intergenic
1006181459 6:32155610-32155632 GTGTGTGTGGTGGGGGTGGGGGG + Intronic
1006273706 6:32984108-32984130 GTTTGTAAGGGGTGGATGGGTGG + Intergenic
1006575578 6:35042919-35042941 GTCTGTGATGGGGTTGTGGGTGG + Intronic
1006723242 6:36174258-36174280 GTGTATATGCGTGTGGTGGGGGG + Intergenic
1006804176 6:36777759-36777781 GTGTGTGTGTGTGTGGTGGGGGG - Intronic
1007067626 6:39007932-39007954 GTGTGTGGGTGGGTGGGGGGTGG - Intronic
1007077408 6:39076672-39076694 GTGTGTGAGGGTGTGGTGGGTGG - Intronic
1007097635 6:39223691-39223713 GTGTGGTTGGTGGTGGTGGGAGG - Intronic
1007394539 6:41570063-41570085 GTGTGTCAGGGGGTGGTGGGGGG - Intronic
1007556618 6:42771486-42771508 GGGTGGCGGGGGGTGGTGGGGGG + Intronic
1008009304 6:46446300-46446322 GTGTGGGTGGGGGTGCTGGGGGG + Intronic
1008194993 6:48507876-48507898 GACTGTTAGGGGGTGGGGGGAGG - Intergenic
1008370312 6:50723824-50723846 GTGTGTATGGCGGGGGTTGGGGG - Intronic
1008812447 6:55520090-55520112 GCCTGTCAGGGGGTGGGGGGCGG + Intronic
1008936493 6:56997961-56997983 GTGTGTGTGGGGGTGGGGGGCGG + Intronic
1009437649 6:63636195-63636217 GTGTGGAAGGGGATGGGGGAGGG - Intronic
1009438101 6:63641404-63641426 GTGTGTAGGGGGGTGGTGTGAGG - Intronic
1009787912 6:68362278-68362300 GTGTGTCAGGGGATGGGGGCAGG + Intergenic
1009951570 6:70402936-70402958 CTGTGTGTGGGGGGGGTGGGGGG - Intergenic
1009960088 6:70509188-70509210 CTGTGGAAGGTGGAGGTGGGAGG + Intronic
1010717231 6:79243701-79243723 ATGTGTGAGTGGGAGGTGGGAGG + Intergenic
1010900723 6:81424044-81424066 GTGTGTGGGGAGGTGTTGGGGGG + Intergenic
1010958569 6:82119476-82119498 GTGTGTACTGGAGTGGTGTGCGG - Intergenic
1011369578 6:86620338-86620360 ATGTGTGTGGTGGTGGTGGGAGG - Intergenic
1011415907 6:87120056-87120078 GTGGGGAGGGGGTTGGTGGGGGG - Intergenic
1011525470 6:88259601-88259623 GTCTGTCATGGGGTGGGGGGAGG + Intergenic
1011669693 6:89671227-89671249 GTGTGTATTGGGGTGGGTGGAGG - Intronic
1012790101 6:103682408-103682430 GTGTGTAGGGGGGTGGGGGAAGG - Intergenic
1013317603 6:108957261-108957283 CTGTGTAAGGGGAAGGTGGAGGG - Intronic
1013322312 6:109006440-109006462 GTGGGGTAGGGGGTGGGGGGAGG - Intronic
1013547628 6:111174360-111174382 GTGTGTTGGGGGGTGGGGGGCGG - Intronic
1013594690 6:111649897-111649919 GTGGGCATGGGGGTGGGGGGAGG + Intergenic
1013634380 6:112015292-112015314 GTGTGCATGGGGGTTGGGGGTGG + Intergenic
1013760666 6:113513645-113513667 GTGTGTCGGGGGGTGGGTGGGGG - Intergenic
1014054629 6:116999550-116999572 GTGTGTGTTGGGGTGGGGGGAGG + Intergenic
1014370721 6:120604029-120604051 GTGTGTGGGGGGGTGGGGGTGGG + Intergenic
1014510856 6:122320405-122320427 GTGTATCAGAGGGTGGAGGGTGG - Intergenic
1014965157 6:127739133-127739155 GTTTGTCATGGAGTGGTGGGTGG - Intronic
1015180091 6:130352062-130352084 GTGTGTTGGGGGGAGGGGGGAGG + Intronic
1015319245 6:131853668-131853690 GTGTGTGAGGGTAAGGTGGGAGG + Intronic
1015380471 6:132561511-132561533 GTGTGTATGTGGGTGGAGGAGGG + Intergenic
1015429151 6:133110066-133110088 GTGGGGAAGTGGGGGGTGGGGGG + Intergenic
1015752940 6:136579231-136579253 GTGTGTGTTGGGGTGGTGGGTGG - Intronic
1015807943 6:137131483-137131505 GTGTGTGATGGGGTGGGAGGTGG + Intergenic
1016075327 6:139788727-139788749 CAGTGGGAGGGGGTGGTGGGGGG + Intergenic
1016693045 6:146961372-146961394 AAGGGTAAGGGGTTGGTGGGAGG + Intergenic
1016814099 6:148287689-148287711 GTGTGTGGGGGGGTGGGGGGTGG + Intronic
1016862947 6:148739729-148739751 GTGTGGGAGGTGGAGGTGGGTGG - Intergenic
1017048898 6:150372311-150372333 GTGTGTGTGGGTGGGGTGGGGGG + Intronic
1017048912 6:150372372-150372394 GTGTGTGTGGGGGTGGGGTGGGG + Intronic
1017048926 6:150372437-150372459 GTGTGTGTGGGTGGGGTGGGGGG + Intronic
1017048942 6:150372498-150372520 GTGTGTGGGGGGGTGGGGTGGGG + Intronic
1017068670 6:150552443-150552465 GTGTGTGGGGGGGTGGGGGGTGG + Intergenic
1017509761 6:155104043-155104065 GTGTGTGGGGGTGTGGGGGGGGG - Intronic
1017515550 6:155152805-155152827 GTGTGTGTGGTGGTGGTGGGTGG + Intronic
1017705979 6:157123232-157123254 GTGTGTGGGGGGGGGGCGGGGGG - Intronic
1017918923 6:158854891-158854913 TGGTGGTAGGGGGTGGTGGGTGG + Intergenic
1017992230 6:159501065-159501087 GTGTGAAGTGGGGTGGTGGGTGG - Intergenic
1018096684 6:160393431-160393453 GTGTGGTAGGGGGAGGGGGGAGG - Intronic
1018620834 6:165728053-165728075 GTGTGTATGTTGGGGGTGGGTGG - Intronic
1018968338 6:168506652-168506674 AGGTGTAAGGAAGTGGTGGGGGG - Intronic
1018980725 6:168599761-168599783 GTGTGTGGGGGGGTGTTTGGGGG - Intronic
1019036750 6:169067311-169067333 GTGTGTGGGGGGGGGGGGGGGGG - Intergenic
1019036752 6:169067313-169067335 GTGTGTGTGGGGGGGGGGGGGGG - Intergenic
1019105424 6:169663671-169663693 GTGAGTACGAGGGTGCTGGGCGG + Intronic
1019328361 7:450783-450805 GTGGGTTGGGGGGTGGGGGGAGG - Intergenic
1019467313 7:1196617-1196639 GTGATGAAGGGGGGGGTGGGGGG + Intergenic
1019467351 7:1196726-1196748 GTGATGAAGGGGGGGGTGGGGGG + Intergenic
1019487786 7:1297197-1297219 GTGTGGGAGGGGGTGGTGGCAGG + Intergenic
1019892011 7:3954526-3954548 GGTTGTAAAGGGGAGGTGGGAGG - Intronic
1019994853 7:4717414-4717436 GGATGGAAGGTGGTGGTGGGAGG + Intronic
1020021397 7:4871664-4871686 GTGTGTGGGAGGGTGGTGTGGGG - Intronic
1020353024 7:7244205-7244227 GTGTGTGTGGGTGTGGTAGGGGG - Exonic
1020409669 7:7877047-7877069 GTGTTTAAGGGGTCTGTGGGTGG + Intronic
1020418147 7:7969233-7969255 GTGTGTAAGGGGGAGGGGCGGGG - Exonic
1020579904 7:9983945-9983967 GTGTGTGGGGGGGGGGGGGGCGG + Intergenic
1020642729 7:10776720-10776742 GTGTGTGTGGGGGGGGGGGGGGG + Intergenic
1021157995 7:17235793-17235815 GTGTGTGTGTGTGTGGTGGGGGG - Intergenic
1021665727 7:22977045-22977067 GCGGGCAGGGGGGTGGTGGGTGG - Intronic
1021724259 7:23534290-23534312 ATGTGAGAGGGTGTGGTGGGAGG - Intergenic
1021726263 7:23550629-23550651 GTGTGGCAGGGTGTGGTGGGAGG - Intergenic
1021817782 7:24465056-24465078 GAGGGTAAGGGGGTGATGTGAGG + Intergenic
1022220652 7:28310182-28310204 GAGTGGAAGGGAGTAGTGGGGGG + Intronic
1022230049 7:28405850-28405872 GTGTGTGTGGTGGTGGTAGGTGG + Intronic
1022248068 7:28580422-28580444 GTGTGTGTGTGTGTGGTGGGGGG - Intronic
1022978757 7:35582700-35582722 GTCTTTAAGAGGGTGGAGGGTGG - Intergenic
1023535192 7:41201194-41201216 GTGTGTAGGTGGGTGGAGGGCGG + Intergenic
1024055399 7:45657214-45657236 GTGTGTCAGGAAGGGGTGGGAGG + Intronic
1024071608 7:45790746-45790768 CTTTGGGAGGGGGTGGTGGGGGG - Intergenic
1024317169 7:48031873-48031895 GGGTGTGTGGTGGTGGTGGGGGG + Intergenic
1024317956 7:48038858-48038880 GTGTGTATGTGGGTGGGGGGTGG + Intronic
1025144717 7:56493398-56493420 GAGGGGAAGGGTGTGGTGGGGGG + Intergenic
1025260301 7:57413855-57413877 GAGTGGAAGGGTGTGGTGGGGGG + Intergenic
1025594599 7:62909024-62909046 GAGTGTTGTGGGGTGGTGGGTGG - Intergenic
1025615320 7:63112822-63112844 GTGTGTTTGGGGGGGTTGGGGGG + Intergenic
1025960892 7:66220662-66220684 GAGTGTGTGGGGGTGGTGGGTGG + Intronic
1025972342 7:66339099-66339121 AAGTGTTGGGGGGTGGTGGGTGG + Intronic
1026043952 7:66892343-66892365 CTTTGGGAGGGGGTGGTGGGAGG - Intergenic
1026053815 7:66967923-66967945 GTGTGTGTGTGTGTGGTGGGGGG - Intergenic
1026236913 7:68535084-68535106 GTGGGTGGGGGGGTGGTGGGTGG + Intergenic
1026236920 7:68535099-68535121 GTGGGTGGCGGGGTGGTGGGTGG + Intergenic
1026490237 7:70856782-70856804 GTTTGTGAGGCGGAGGTGGGAGG + Intergenic
1027137857 7:75637979-75638001 GTGTGTGTGGGGGGGGGGGGGGG - Intronic
1027211341 7:76151084-76151106 GTTTGGAAGGCCGTGGTGGGTGG - Intergenic
1027634018 7:80646280-80646302 GTGTGGAAGGTTGTGTTGGGTGG + Intronic
1027698880 7:81443952-81443974 GAGTGTATGGAGGTGGCGGGGGG + Intergenic
1027909244 7:84227917-84227939 GTGTGTCAGGGAGTGGGGGGCGG + Intronic
1028033160 7:85944400-85944422 GTGTGTGGTGGGGTGGGGGGTGG - Intergenic
1028091696 7:86710560-86710582 GTGTGGTGGGGGGTGGGGGGAGG + Intronic
1028849467 7:95520640-95520662 GTGTGGATGGGGATGGGGGGTGG - Intronic
1028903057 7:96122554-96122576 GTGTGTTGGGGGGTGGGAGGTGG + Intronic
1029225623 7:99026212-99026234 CTGTGGAAGGTGGAGGTGGGTGG + Intergenic
1029274617 7:99396780-99396802 GTGTGTTGGGAGGGGGTGGGGGG - Intronic
1029657650 7:101937447-101937469 GGGTGTGAGGAGGTTGTGGGGGG + Intronic
1029792161 7:102855634-102855656 GTGGGTTGGGGGGTGGTGGGGGG - Intronic
1030820816 7:114088124-114088146 GTGTGTATGTGTGTGGAGGGGGG - Intronic
1031052771 7:116961580-116961602 GTGTGTGTGTGTGTGGTGGGGGG + Intronic
1031440152 7:121784659-121784681 GTCTGTCTGGGGGAGGTGGGGGG + Intergenic
1031701496 7:124931630-124931652 AAGTGTAATGGGGTGGTGGGGGG - Intergenic
1031898274 7:127379846-127379868 GTGTGTGTGGGGGGGGTGGGGGG - Intronic
1031968322 7:128044627-128044649 GTGTGTGTGGCGGGGGTGGGGGG - Intronic
1032168786 7:129566908-129566930 CTGTGGTAGGGGATGGTGGGGGG - Intergenic
1032283917 7:130526940-130526962 GTGGGAATGGGGGTGGGGGGAGG + Intronic
1032485696 7:132285920-132285942 TTGTGGGTGGGGGTGGTGGGTGG - Intronic
1032613964 7:133445766-133445788 GTTTGGAAGGCGGAGGTGGGAGG + Intronic
1032739149 7:134721583-134721605 GTGTGTTTAGGGGAGGTGGGGGG + Intergenic
1032902325 7:136323759-136323781 GTGTGTGGTGGGGTGGTGGGGGG + Intergenic
1033036276 7:137878907-137878929 GTGTGGGGGTGGGTGGTGGGGGG + Exonic
1033611804 7:142970468-142970490 GTGTGTGTGTGTGTGGTGGGAGG - Intergenic
1033618559 7:143041023-143041045 GTGTGTGTGTGTGTGGTGGGGGG - Intergenic
1034026729 7:147712736-147712758 GCCTGTCATGGGGTGGTGGGAGG + Intronic
1034299007 7:149998894-149998916 GTGACTGAGGGAGTGGTGGGAGG - Intergenic
1034340018 7:150346863-150346885 GTGGGGAAGGGGATGTTGGGAGG + Intergenic
1034352638 7:150427413-150427435 GTGTGTGGGGGGGGCGTGGGGGG + Intergenic
1034748739 7:153548295-153548317 GTGTGTGTGCGGGAGGTGGGTGG + Intergenic
1034807009 7:154097879-154097901 GTGACTGAGGGAGTGGTGGGAGG + Intronic
1035074418 7:156168912-156168934 GTGGGTAGGGGGGCAGTGGGTGG + Intergenic
1035122473 7:156579744-156579766 GTGTGTCTGTGAGTGGTGGGGGG + Intergenic
1035205126 7:157289979-157290001 GTGTGTTTGGGGGTGGGGGGGGG + Intergenic
1035228636 7:157447489-157447511 GGGTGCCAGGGGCTGGTGGGAGG - Intergenic
1035636685 8:1152561-1152583 GTGAGTAAGGTGGTGGTTGATGG + Intergenic
1035651942 8:1273203-1273225 GTGTGTTTGTGGCTGGTGGGAGG - Intergenic
1036032102 8:4985202-4985224 GCCTGTCAGAGGGTGGTGGGTGG + Intronic
1036040695 8:5077090-5077112 CTGTGTGTGGGGGGGGTGGGGGG - Intergenic
1036184138 8:6609813-6609835 GTGTGTGGGGGGGGGGCGGGGGG - Intronic
1036463295 8:8973355-8973377 GTGGGGAGGGGGGTGGTGCGAGG + Intergenic
1036638205 8:10565609-10565631 GTGTGTCGGGGGCAGGTGGGAGG - Intergenic
1036775789 8:11612478-11612500 CTGGGGAGGGGGGTGGTGGGCGG - Intergenic
1036788212 8:11701848-11701870 GGGTGGTGGGGGGTGGTGGGAGG + Intronic
1037110545 8:15159746-15159768 GTGTGTGTGGCGGGGGTGGGGGG - Intronic
1037207029 8:16335777-16335799 GTGGGTTGGGGGGAGGTGGGAGG - Intronic
1037275863 8:17177778-17177800 GTGTGTGTGGGGGTGGGGGGCGG + Intronic
1037288958 8:17330655-17330677 GTGTGTGTGGAGGTGGCGGGAGG + Intronic
1037436954 8:18872861-18872883 GTGTGTTACAGGGTGGTGGGAGG - Intronic
1037458034 8:19083169-19083191 GTGAGGAAGGGTGTGGAGGGTGG - Intronic
1037612376 8:20487040-20487062 GCCTGTCAGGGGGTGGGGGGGGG + Intergenic
1037670722 8:21013134-21013156 GTGTGTGGGGGGGGGGGGGGGGG - Intergenic
1037670724 8:21013136-21013158 GTGTGTGTGGGGGGGGGGGGGGG - Intergenic
1037947975 8:23000991-23001013 GTGTGTAGGGGTGTGGGGGTGGG + Intronic
1038586192 8:28791201-28791223 GTTTGTTGGGAGGTGGTGGGAGG - Intronic
1038672337 8:29592288-29592310 GTGTGTATAAGGGTGGTGGTAGG + Intergenic
1038869875 8:31482152-31482174 GTGTGTATGGGGGGGTTGGGAGG + Intergenic
1039457490 8:37717244-37717266 GTGGGGAGGGTGGTGGTGGGAGG - Intergenic
1039467767 8:37796621-37796643 TTGTGGAAGGTGGTGGTGGTCGG + Intronic
1039518682 8:38153318-38153340 GACAGTAAGGGTGTGGTGGGAGG - Intergenic
1039639072 8:39199763-39199785 GTGGGGTGGGGGGTGGTGGGGGG - Intronic
1039911101 8:41827967-41827989 GTGTGTCGGGGGTTGGGGGGCGG - Intronic
1040471090 8:47736772-47736794 GTGTGTGTGGGGGGGGCGGGGGG - Intergenic
1040652216 8:49462076-49462098 TTGTGGAAGATGGTGGTGGGAGG - Intergenic
1040713693 8:50221496-50221518 GTGTGTATGTGTGTGTTGGGAGG - Intronic
1040902930 8:52435721-52435743 GTGTGTGTGTGGGTGGGGGGTGG + Intronic
1040975481 8:53189696-53189718 GTAGGTGTGGGGGTGGTGGGAGG + Intergenic
1041342302 8:56858680-56858702 GTGTATGAGGGGATGGTGTGGGG - Intergenic
1041474341 8:58247419-58247441 GTGTGTCAGGGGGGGCGGGGTGG - Intergenic
1042041366 8:64594101-64594123 GTGTGTATGTGGGGGGTGGGTGG + Intronic
1042192266 8:66198916-66198938 ATGTGTGAGGTGGGGGTGGGTGG - Intergenic
1042660589 8:71150147-71150169 GTGGGCAACGTGGTGGTGGGGGG - Intergenic
1042882781 8:73512647-73512669 GTGTGTATGTGTGTGGGGGGTGG + Intronic
1043420450 8:80092306-80092328 ATGTGTCAGTGGGTGGGGGGAGG - Intronic
1044116560 8:88343169-88343191 CTGTCAAGGGGGGTGGTGGGGGG - Intergenic
1044715134 8:95093116-95093138 GAGTGTAAGGGGTGGGTGGGAGG + Intronic
1044727932 8:95208176-95208198 GTGTGTGTGGGGGAGGGGGGGGG + Intergenic
1045319333 8:101069920-101069942 GTGTGCGAGGGGGTGGGGGAAGG + Intergenic
1045323105 8:101096767-101096789 GAGTGTGTGGGGGTGGGGGGTGG + Intergenic
1045514449 8:102845126-102845148 GGGTGGAGGGGGGTGGTGGGAGG - Intronic
1045674482 8:104591747-104591769 GTTTTTCTGGGGGTGGTGGGGGG - Intronic
1045739141 8:105334146-105334168 GTGTGTGTGTGTGTGGTGGGGGG + Intronic
1046276036 8:111961268-111961290 GTCTGTCAGGAGTTGGTGGGAGG + Intergenic
1046588916 8:116182087-116182109 GTGAGTCAGTGGGTGGTGAGTGG - Intergenic
1046708313 8:117480131-117480153 GTGGTGAAGGGGGAGGTGGGAGG + Intergenic
1047005918 8:120620649-120620671 GTGTGTGTGGGGGTGGGGGTGGG - Intronic
1047523597 8:125614554-125614576 GTGTGTAAGGGTCAGGTGTGAGG + Intergenic
1048008833 8:130440662-130440684 GAGTGTAAGGGAGAGATGGGGGG - Intronic
1048184411 8:132226429-132226451 GTGTGTAGGGGAGTGGAGGCAGG + Intronic
1048254194 8:132893418-132893440 GTGTGTATGTGTGTGGTGTGTGG + Intronic
1048292975 8:133194467-133194489 GTGTGTGTGTGTGTGGTGGGGGG + Intronic
1048483060 8:134819500-134819522 GTGTGTTGGGGGGCGGGGGGGGG - Intergenic
1048832134 8:138487627-138487649 GTGTGTGTGGGGGTGGGGGCGGG + Intronic
1048843742 8:138587136-138587158 GTGTGTATGTGGGTGGTTGGGGG + Intergenic
1049039609 8:140102466-140102488 GTGTGTGTGTGTGTGGTGGGGGG - Intronic
1049074958 8:140388227-140388249 GTGGGGAGGGGGGAGGTGGGAGG + Intronic
1049582275 8:143418196-143418218 GTGGGTAGGGGGTTGGAGGGTGG - Intergenic
1049725492 8:144143759-144143781 GGGTGGTAGGGGGTGCTGGGTGG + Intergenic
1049908668 9:244269-244291 GTGTGTGTGTGTGTGGTGGGGGG - Intronic
1049958666 9:716980-717002 CTGTGGGTGGGGGTGGTGGGGGG + Intronic
1050170423 9:2810088-2810110 GAGAGTGAGGGGGCGGTGGGGGG + Intronic
1050230805 9:3524972-3524994 GTGTGCAAGGGGTGTGTGGGGGG + Intronic
1050439599 9:5647922-5647944 GTGTGTGTGGGGGTGGGTGGTGG + Intronic
1050620018 9:7442541-7442563 GTGTGTCAGGGCGGGGGGGGGGG - Intergenic
1050818396 9:9845486-9845508 GTGTTTGAGGGTGAGGTGGGGGG + Intronic
1051191659 9:14519082-14519104 GTGTGTATGGTGGTGATGGTGGG + Intergenic
1051332718 9:16039854-16039876 GTGTGTAATGGGGTGGGGGGTGG + Intronic
1051782335 9:20703174-20703196 GAGGCTATGGGGGTGGTGGGGGG + Intronic
1051833610 9:21309723-21309745 GTGAGTGAGGTGGTGCTGGGGGG - Intergenic
1052041050 9:23739542-23739564 GTGTGTGTGGGGGTGGGGGTAGG - Intronic
1052206608 9:25848714-25848736 GTGTGTGTGGGGTTGGGGGGTGG - Intergenic
1052880119 9:33596605-33596627 GGGTGAAAAGTGGTGGTGGGGGG + Intergenic
1053089350 9:35259781-35259803 GTGTGTAGGGGGATGCGGGGGGG + Intronic
1053495856 9:38547612-38547634 GGGTGAAAAGTGGTGGTGGGAGG - Intronic
1054246889 9:62675590-62675612 GTGTGTGGGGGGGGGGGGGGTGG + Intergenic
1054854677 9:69885667-69885689 GTGTTTAATGGGGTGGAGGTTGG + Intronic
1054880191 9:70136518-70136540 GTGTGGGAGGGGGTGGAAGGTGG - Intronic
1054946904 9:70805224-70805246 GTGGGGGAGGTGGTGGTGGGGGG + Intronic
1054953497 9:70881374-70881396 TTTTGTATGGGGGTGGTGGTAGG - Intronic
1055011119 9:71566601-71566623 GTGTTTAGGGGGGTGGTGGGGGG - Intergenic
1055124642 9:72704939-72704961 GTGTGTAGGGAGTTGGAGGGGGG + Intronic
1055562158 9:77531778-77531800 GTGTGTTTGGGGCTGGTGGTGGG - Intronic
1055564707 9:77556725-77556747 GTGTGTCTGGGGGTGGTGGTAGG - Intronic
1055567998 9:77588250-77588272 GGGTGTCAGGGTGTGGTGGATGG - Intronic
1055923729 9:81488900-81488922 GTGTGGTAGGGGGTGGGGGTGGG - Intergenic
1055986002 9:82056861-82056883 ATGTGTAGGTGGGGGGTGGGGGG - Intergenic
1056053055 9:82789821-82789843 GTTTGTGAGTGGGTGGTGAGTGG - Intergenic
1056066141 9:82937036-82937058 GGGGGTGAGGGGGTGGGGGGTGG - Intergenic
1056423992 9:86457837-86457859 GTGTGGAATTGGGTGGTGGACGG + Intergenic
1056541003 9:87571420-87571442 GTGTGTTGGGGGGTGGGGGATGG - Intronic
1056753818 9:89370076-89370098 GTGTGTATGGGGGTGGTTTTAGG + Intronic
1056881204 9:90395722-90395744 GTAGGTGAGGGTGTGGTGGGGGG - Intergenic
1057036708 9:91816690-91816712 GTGTGTGTTGGGGGGGTGGGGGG - Intronic
1057074884 9:92133417-92133439 GTGTGTGTGTGTGTGGTGGGGGG + Intergenic
1057220715 9:93256398-93256420 GTGGGCATGGGGGTGCTGGGCGG - Exonic
1057233471 9:93339704-93339726 GTGTGAAAGGTGGTGGTTCGTGG - Intronic
1057360904 9:94373240-94373262 GTGTGTTTGGGGGTAGTGGGTGG + Intergenic
1057548927 9:96038020-96038042 GTGGGTAGGTGGGTGGTGGTGGG + Intergenic
1057662434 9:97014872-97014894 GTGTGTTTGGGGGTGGTGGGTGG - Intergenic
1057702061 9:97370511-97370533 GGGTGTGTGGGGGTGATGGGTGG - Intronic
1057801769 9:98195401-98195423 GTGTGTGTGGTGGGGGTGGGGGG + Intergenic
1057850405 9:98562589-98562611 GTGTGTGTGGGGGTGGTGCAGGG + Intronic
1058214594 9:102218051-102218073 GTGGGTTGGGGGGAGGTGGGAGG - Intergenic
1058650433 9:107170818-107170840 GTGGGGCGGGGGGTGGTGGGGGG + Intergenic
1058657838 9:107240570-107240592 CTTTGTGAGGGGGAGGTGGGTGG + Intergenic
1058991173 9:110256314-110256336 GTGGGGAAGGCGGTGGCGGGAGG - Intronic
1059248073 9:112865156-112865178 GTGTGTGGGGGGGTTGTGTGTGG - Intronic
1059621540 9:116011181-116011203 GTGTGTGTGGGGGTGGGGGTGGG + Intergenic
1059703631 9:116799693-116799715 GTGGGTAAGAGAGTGGGGGGGGG + Intronic
1059780216 9:117518286-117518308 GTGTGTGTGGGCGGGGTGGGGGG - Intergenic
1059935172 9:119303265-119303287 GTGTGTGTGGTGGGGGTGGGGGG - Intronic
1060052273 9:120385905-120385927 GCTTGTAAGTGGGTGGTGGAAGG - Intergenic
1060346501 9:122821397-122821419 GTGTGTTTGGGGATGGTGTGGGG - Intronic
1060431006 9:123551564-123551586 GTGTGTAAAGGGCTAGTGAGGGG + Intronic
1060508793 9:124217242-124217264 GTGTGTGTGTGTGTGGTGGGTGG - Intergenic
1060811125 9:126612045-126612067 GTGTGTTTGTGTGTGGTGGGGGG - Intergenic
1060972255 9:127744943-127744965 GTGTGGGAGGGGCTGGTGTGGGG + Exonic
1061103662 9:128512218-128512240 GTGTGACATGGGGTGGTTGGTGG + Intronic
1061342681 9:129995761-129995783 GAGTGCAAGGTGGAGGTGGGTGG + Intronic
1061372983 9:130208214-130208236 GTGTGTGAGGTGGGGGTGGGGGG + Intronic
1061448164 9:130653593-130653615 GTGTGCCAGGGGCTGGTGGTGGG - Intergenic
1061732287 9:132625040-132625062 CTGAGTAAGGGGGTGGGGTGGGG + Intronic
1061802939 9:133121951-133121973 GTCTGTAAGGGGATAGTGTGGGG - Intronic
1061807263 9:133143409-133143431 GTGAGCGAGGAGGTGGTGGGAGG + Intronic
1061839202 9:133347901-133347923 GGGTATGAGGGTGTGGTGGGGGG - Intronic
1061940252 9:133880155-133880177 GTGGGCAAGGGGCTGGTGGAGGG - Intronic
1062032749 9:134369363-134369385 GTGTGTGCGGGGGTTGTGTGTGG + Intronic
1062108551 9:134768970-134768992 GTGTGGAGGGGGGAGGTGTGAGG + Intronic
1062286374 9:135774838-135774860 GTGTGGAAGGGGGTGGCGGTGGG - Intronic
1062325556 9:136010913-136010935 GTGTGCAGGGGTGTGGTGAGGGG - Exonic
1062559141 9:137131698-137131720 GTGTGTGTGGGGGGGGGGGGCGG - Intergenic
1062736445 9:138140189-138140211 ATGTGTGAGTGTGTGGTGGGTGG + Intergenic
1062751835 9:138260598-138260620 CTTTGGGAGGGGGTGGTGGGGGG - Intergenic
1185461079 X:333040-333062 GTGTGTTGGGGGGTGGTGTCCGG + Intergenic
1185471393 X:386206-386228 GTCTGTATGTGTGTGGTGGGGGG + Intronic
1185683170 X:1905935-1905957 GTGGGGAAGGAGGTGATGGGAGG - Intergenic
1185736549 X:2500656-2500678 GTGTGGCCGGGGGTGGGGGGGGG - Intronic
1186112089 X:6269200-6269222 GTGTGTGAGGGGAAGGTGAGCGG - Intergenic
1186147399 X:6638645-6638667 GCCTGTCATGGGGTGGTGGGAGG + Intergenic
1186552246 X:10518471-10518493 GTGGGGAAGGGGGTAGTAGGGGG - Intronic
1186708868 X:12171959-12171981 GTGTGTTAAGGGCTGATGGGAGG - Intronic
1187141285 X:16596333-16596355 GTGGGTTAGGGGGAGGGGGGAGG - Intronic
1187235119 X:17459832-17459854 TTTTGGAAGGGGGTGTTGGGAGG - Intronic
1187634672 X:21213517-21213539 GTGTGTCAGGGGATAGTGGTGGG + Intergenic
1188170469 X:26918193-26918215 GTGTGGAGGGGGGTGGGTGGGGG + Intergenic
1188295535 X:28443337-28443359 AACTATAAGGGGGTGGTGGGGGG + Intergenic
1188421946 X:30000770-30000792 GTGTGTGTGGTGGTGGTGGTGGG + Intergenic
1189074926 X:37905433-37905455 GTGTGTGGGGGGGGCGTGGGGGG + Intronic
1189195851 X:39151933-39151955 GTGTGGGAGTGGGTGGTGGGGGG - Intergenic
1189377945 X:40480456-40480478 GTGGGTCAGAGGGTGGTTGGGGG + Intergenic
1189551428 X:42097618-42097640 GTGTGTAATGGGGTAGCGGGTGG + Intergenic
1189696326 X:43666985-43667007 GTCTGTCATGGGGTGGGGGGCGG + Intronic
1190052488 X:47161062-47161084 GTGTGTGAGGCTGAGGTGGGAGG - Intronic
1190385911 X:49881932-49881954 GGGGGGAGGGGGGTGGTGGGGGG + Exonic
1190561634 X:51691654-51691676 GTGTGTGTGGTGGGGGTGGGAGG + Intergenic
1190562657 X:51701661-51701683 GTGTGTGTGGTGGGGGTGGGAGG - Intergenic
1190732364 X:53234344-53234366 GGGTGTGAGGGGAGGGTGGGGGG + Exonic
1190828799 X:54042860-54042882 TGGTGCAAGGGGGTGGGGGGCGG - Intronic
1191029338 X:55951230-55951252 GTTTGGAAGGGTGAGGTGGGTGG + Intergenic
1191565557 X:62522962-62522984 GTGTGGTGGGGGGTGGCGGGAGG + Intergenic
1191605975 X:63063163-63063185 GTGGGTTGGGGGGAGGTGGGAGG + Intergenic
1191629519 X:63306856-63306878 GCCTGTCATGGGGTGGTGGGAGG + Intergenic
1191794535 X:65006551-65006573 GTCTGTCATGGGGTGGTGGGAGG + Intronic
1191908148 X:66117937-66117959 GTGTGTAAGGGAGTGCGGGGTGG - Intergenic
1191908552 X:66122410-66122432 GGGGGTGAGGGGGTGGGGGGGGG + Intergenic
1191910111 X:66141060-66141082 GTGTCACAGGGGTTGGTGGGGGG + Intergenic
1192233423 X:69281251-69281273 GTGTGTAAGGGGTGGGAGAGAGG + Intergenic
1192529022 X:71870571-71870593 GTGTGGAAGGTGGAGGCGGGGGG + Intergenic
1192553342 X:72070738-72070760 GTGTGTGTGGTGGTGGTGGTGGG - Intergenic
1192605776 X:72515582-72515604 GTGTGTGGGGGGGGGGTGGGGGG + Intronic
1192783982 X:74320437-74320459 CTATGTATGGGGGTGGTGGTGGG - Intergenic
1193683283 X:84548177-84548199 GTCTGTTGTGGGGTGGTGGGTGG - Intergenic
1193685098 X:84568156-84568178 GTGTGTGTGGGAGGGGTGGGGGG - Intergenic
1193926318 X:87489721-87489743 GTGTGTCTGGGGGTGGGGTGGGG + Intergenic
1194424518 X:93720034-93720056 GTGTGTGTGTGTGTGGTGGGTGG + Intergenic
1194427843 X:93762158-93762180 GGGGGCAGGGGGGTGGTGGGGGG - Intergenic
1195030663 X:100924471-100924493 ATTTGTATGGGGGAGGTGGGAGG - Intronic
1195405570 X:104509215-104509237 GTGTGGGAGGGGGTTGGGGGGGG + Intergenic
1195660825 X:107376196-107376218 GCCTGTCAGGGGGTGGGGGGAGG - Intergenic
1195666208 X:107433518-107433540 GTCTGTCATGGGGTGGGGGGAGG - Intergenic
1195869333 X:109469790-109469812 CTGTGTAAGAGGAAGGTGGGAGG + Intronic
1195978309 X:110551638-110551660 GTCTGTTGGGGGGTGGGGGGCGG + Intergenic
1195992115 X:110693149-110693171 GTGTGTGTGGGGGTGGGGGCAGG + Intronic
1196005778 X:110835601-110835623 ATGTGTCGGGGGGTGGGGGGGGG + Intergenic
1196050651 X:111300018-111300040 GTGTGTGTGGTGGTGGTGGGAGG - Exonic
1196189951 X:112783707-112783729 GTGTGTGTGTGTGTGGTGGGCGG + Intronic
1196262917 X:113606392-113606414 GTGGGTATGTGGGTTGTGGGGGG + Intergenic
1196481589 X:116156648-116156670 GTGTGGAGAAGGGTGGTGGGTGG + Intergenic
1196624518 X:117863182-117863204 ATGTGTGGGGGGGTGGTGGGAGG - Intergenic
1196669276 X:118348049-118348071 GTGTGTATTGGGGTGGGGGAGGG + Intronic
1196760648 X:119197947-119197969 GTGTGTGTGAGGGTGGGGGGTGG - Intergenic
1196794445 X:119490947-119490969 GGGAGTTTGGGGGTGGTGGGGGG - Intergenic
1197254146 X:124244838-124244860 GTATGTGTGGGGGTGGTGGCAGG + Intronic
1197807469 X:130411613-130411635 GTGTGAAAGGGGAAGGTGTGGGG + Intronic
1197879145 X:131146591-131146613 GTGTGGAGGCGGGTGGTGAGCGG + Intergenic
1197903783 X:131401449-131401471 GTGTGTAGGGGGTGTGTGGGAGG - Intergenic
1197912079 X:131493469-131493491 GTGTGTGAGGTGGTGGCGGTTGG - Intergenic
1198122879 X:133611223-133611245 GTGGGTGGGGGTGTGGTGGGGGG + Intronic
1198414391 X:136405292-136405314 AGGTGTAAGGTGGTGGCGGGGGG + Intronic
1198495056 X:137183950-137183972 GTGTATAGAGGGGTGGTGGTGGG - Intergenic
1198652409 X:138877106-138877128 GCCTGTCAGGGGGTGGTGGGGGG + Intronic
1198703364 X:139420479-139420501 GTGTGTGTGGGGGTGGGGGGTGG + Intergenic
1198771907 X:140139209-140139231 GTGTGTCAGGGGGTGCTGAGAGG + Intergenic
1199036641 X:143058400-143058422 GTGTGTGTGTGGGTGGTGGTGGG + Intergenic
1199435098 X:147804244-147804266 GTGTGTGAGTGAGGGGTGGGTGG + Intergenic
1199642816 X:149880950-149880972 GGGGGGAAGGGTGTGGTGGGGGG - Intergenic
1199719131 X:150529604-150529626 GTGTTTCAGAGGGTGGAGGGTGG - Intergenic
1199808859 X:151329161-151329183 GGGTGTCAGGGGCTGGTGGAGGG + Intergenic
1199965731 X:152819103-152819125 GTGTGTTTGGGGGTGGGGGCTGG - Intergenic
1200101481 X:153690899-153690921 GTGTTGATGGTGGTGGTGGGGGG - Intronic
1200362861 X:155629155-155629177 GTCTGTCATGGGGTGGGGGGAGG - Intronic
1200398683 X:156006278-156006300 ATGTGTGAGTGTGTGGTGGGTGG + Intronic
1200403233 X:156030827-156030849 GTGTGTGTGGGTGTGGTGTGTGG + Intergenic
1200574748 Y:4874324-4874346 GTGGGGTAGGGGGAGGTGGGAGG + Intergenic
1200682150 Y:6225422-6225444 GTGTGTGTGGGGGGGGGGGGTGG + Intergenic
1200767786 Y:7095049-7095071 GGGTGTAAGGGTGAGGTGGTGGG - Intergenic
1201157136 Y:11141387-11141409 GTGTGGTAGGTGGTGGTGGTTGG + Intergenic
1201490879 Y:14540110-14540132 GTGTGTGTGTGTGTGGTGGGGGG + Intronic
1202593925 Y:26516373-26516395 GAGAGTAAGGAGGTGGTGGAGGG + Intergenic