ID: 944606331

View in Genome Browser
Species Human (GRCh38)
Location 2:201354818-201354840
Sequence CTGGCCTTCAAGAAGAGAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 400
Summary {0: 1, 1: 0, 2: 3, 3: 39, 4: 357}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944606331_944606333 -10 Left 944606331 2:201354818-201354840 CCTTCTCTCTTCTTGAAGGCCAG 0: 1
1: 0
2: 3
3: 39
4: 357
Right 944606333 2:201354831-201354853 TGAAGGCCAGGACTCCACTATGG 0: 1
1: 0
2: 0
3: 6
4: 135

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944606331 Original CRISPR CTGGCCTTCAAGAAGAGAGA AGG (reversed) Intronic
901972470 1:12918898-12918920 GTGGCCTTCGAGGAAAGAGACGG - Exonic
902012709 1:13282864-13282886 GTGGCCTTCGAGGAAAGAGACGG + Exonic
903953237 1:27008517-27008539 CTGGCCATCAGGAACACAGAGGG + Intronic
904598642 1:31662019-31662041 CTGGGCTTCAGGAAGAATGAGGG - Intronic
907242310 1:53087600-53087622 CTGTCCTCCAAGAGGAGAGGCGG + Exonic
908360977 1:63367943-63367965 CTGGCCCTCAAGAGGAGGGGCGG + Intronic
908465328 1:64387926-64387948 CTGGACTTGAAGAAGGGAGTAGG + Intergenic
909526329 1:76626765-76626787 CTGGCCTTCACAAAGACAGAAGG + Intronic
909600689 1:77458234-77458256 CTGGCCTTAAAGATGACAGAAGG - Intronic
909889370 1:80984536-80984558 CTGGCCTTCCAGATGTGAAATGG + Intergenic
911123885 1:94322582-94322604 CTGGCCCTGAAGAACAGAGCCGG + Intergenic
912477949 1:109953543-109953565 TTGGTCTTCAAGAAAAAAGATGG + Intergenic
913217541 1:116633123-116633145 CTGGCCTTCAAAGGGACAGATGG - Intronic
913347628 1:117824443-117824465 CTGGAAGACAAGAAGAGAGAAGG - Intergenic
915737254 1:158092981-158093003 CTGACCTCAAAGAAGAGCGAGGG + Intronic
916438880 1:164802479-164802501 CTGGCCCTCAGGAAGAAAGCAGG - Intronic
916796331 1:168170897-168170919 CTGGTCTGCAAAAAGAGAGAAGG + Intergenic
917279657 1:173368836-173368858 CTAGCCTTGGAGAAGAGAGGTGG - Intergenic
917880976 1:179335615-179335637 CTCTCCTTCAAGAACAGAAAAGG - Exonic
918465314 1:184815818-184815840 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
918514013 1:185342431-185342453 CTGTGCTTCAAGAATAGAAAAGG - Intergenic
918719914 1:187839848-187839870 CTGGTCTTCAGGAAAGGAGAGGG - Intergenic
919118775 1:193313703-193313725 CGGGACTCCAGGAAGAGAGAGGG + Intergenic
921118830 1:212119218-212119240 CTGACCCTGAGGAAGAGAGATGG + Intergenic
921367353 1:214386051-214386073 CTGCATTTCAAAAAGAGAGATGG - Intronic
922158347 1:223058325-223058347 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
924368544 1:243322172-243322194 CTGGCTTTTAAGAAAAGAAAAGG + Intronic
1062859098 10:796065-796087 CTGCCATTCAAGAAGAGATATGG - Intergenic
1063249334 10:4256532-4256554 CTGGCCTTCATGAAGCCAGGCGG + Intergenic
1063938365 10:11102665-11102687 CTGGCATTCAAGAAAAAAGCAGG - Intronic
1064297440 10:14091092-14091114 CAGGATTTCAAGAAAAGAGATGG + Intronic
1065401795 10:25311950-25311972 CTGGCCTAATAGAAGACAGATGG + Intronic
1068360050 10:55966323-55966345 CAGTCCTTCAAGAAAAGAGAAGG + Intergenic
1068853599 10:61773313-61773335 CTGGCCCTCAGGAAAAGTGAGGG - Intergenic
1071598576 10:86945025-86945047 CTGGCCTTCAAGGTGGGAGGTGG + Intronic
1072754205 10:98007651-98007673 CTGCCCTGGAAGAAGAGATAGGG + Intronic
1073285522 10:102385275-102385297 CTGGACTTCAGGAAGAAGGAAGG - Intergenic
1073726950 10:106243820-106243842 CTGGCTTTGAAGGAGAGGGAAGG + Intergenic
1074426984 10:113359972-113359994 GTGGTGTTCATGAAGAGAGATGG + Intergenic
1074888787 10:117717626-117717648 CTGGTCTTTAAGAAGTAAGAGGG + Intergenic
1074937266 10:118193846-118193868 CAGGCCTTCAAGATGGGAGTAGG - Intergenic
1075074629 10:119342703-119342725 CTGGCCTGGAAGAAGGAAGAGGG - Intronic
1075145077 10:119875759-119875781 CTGTCCTCCAGGAAGAGGGAGGG + Intronic
1076144035 10:128102838-128102860 CTGCCCTTCAAGAGGGGAGGTGG - Exonic
1077391456 11:2302407-2302429 CTGCCCCTCAGGAGGAGAGACGG - Intronic
1077746295 11:4910209-4910231 CTGGCTTTGAAGATGAAAGAGGG - Intronic
1078106219 11:8359700-8359722 CTGCCCTGCAATCAGAGAGAGGG + Intergenic
1078311813 11:10251260-10251282 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
1078719805 11:13873842-13873864 CAGACCTTAAAGAATAGAGAAGG + Intergenic
1080601717 11:33827510-33827532 CTTGACTTCAAAAAGACAGATGG - Intergenic
1081178839 11:39962685-39962707 CTGGCTTTGTAGAAGAGAGGTGG + Intergenic
1082698362 11:56398723-56398745 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1083011851 11:59408939-59408961 ATGCCCTTCTAGAAGAGTGAAGG - Intergenic
1083397500 11:62401718-62401740 AGGGCCTGCAGGAAGAGAGAGGG + Intergenic
1084883709 11:72189846-72189868 CTGGCCTTCAGGCAAACAGAGGG - Intronic
1085479843 11:76812207-76812229 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
1085731974 11:79007724-79007746 CTATCCTTCAAGAAGAAAAAGGG - Intronic
1085828982 11:79879324-79879346 CTGGCCTGGAGGAAGAGGGATGG + Intergenic
1087226903 11:95611422-95611444 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1087374917 11:97327702-97327724 CTGGCTTTCAATAAGGAAGAAGG - Intergenic
1087408357 11:97757690-97757712 CAGAGCTTCAAGAAGATAGAGGG + Intergenic
1087874900 11:103343330-103343352 CTAGCCTTGGAGAAGAGAGGTGG - Intronic
1088465843 11:110137560-110137582 GTGCCCTGAAAGAAGAGAGACGG - Intronic
1089118598 11:116115514-116115536 CTGGCCTAGAAGCAGGGAGATGG + Intergenic
1089781734 11:120877942-120877964 CTGTCCTTCAAGTGGAGAGTGGG - Intronic
1089902255 11:121999384-121999406 ATGCCTTTCAAGAAAAGAGAAGG + Intergenic
1089905787 11:122036942-122036964 CTGGCAATCAACAAGTGAGAGGG + Intergenic
1089924167 11:122239840-122239862 CTGGGCCTCAAGAACAGGGAAGG - Intergenic
1090185695 11:124737978-124738000 GTGTCCTTCAGGAAGAGGGAAGG + Intergenic
1090292885 11:125561329-125561351 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1090794456 11:130122851-130122873 CTGGCCTCCTAGAATAGAAATGG + Intronic
1092073683 12:5655252-5655274 CTGGCAGTCAACAAGAGGGAGGG - Intronic
1095478079 12:42606383-42606405 CTGGGCTTCAGGAAATGAGAGGG - Intergenic
1095975457 12:47938108-47938130 CTGGCCTTCCTGGAGGGAGAAGG + Intronic
1097254578 12:57663910-57663932 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1097677579 12:62619602-62619624 CTGGCTTTCAAGATGAAGGAAGG + Intergenic
1097685414 12:62686505-62686527 ATGGCATTCAAAAAGAGAGTTGG + Intronic
1097833049 12:64245739-64245761 ATGGTCTAGAAGAAGAGAGATGG + Intergenic
1098294417 12:68989988-68990010 ATGCCCTTCTAGAAGAGTGAAGG - Intergenic
1098796231 12:74891653-74891675 CTGGCCTTGAAAAGGAAAGATGG - Intergenic
1099048450 12:77753511-77753533 ATTGTCTTTAAGAAGAGAGATGG - Intergenic
1099110088 12:78547838-78547860 CTTGGCTTCAAGCAGAGAGAAGG - Intergenic
1100258140 12:92904969-92904991 CTGACCTTCAGGCATAGAGAGGG - Intronic
1100875668 12:98959295-98959317 CTCACCTTCCAGAACAGAGATGG - Intronic
1101189409 12:102315861-102315883 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1101443977 12:104724168-104724190 GTGGCCTTCAAGTGGTGAGAAGG + Intronic
1102001001 12:109558122-109558144 CTGGCTCTCAGGAAGAGCGAAGG + Intronic
1102430505 12:112879436-112879458 CTGGGCTTCAAGAGCAGAGTTGG + Intronic
1102560138 12:113756076-113756098 CTGACCTTGAAGAAGGAAGAAGG + Intergenic
1102729364 12:115094457-115094479 GTGACCTTCAAGAGGAAAGAGGG + Intergenic
1103722597 12:122982641-122982663 CTGGCCTTCCAGATGCGAGCTGG + Exonic
1104358076 12:128105985-128106007 CTGGCATTAAAGAGTAGAGATGG - Intergenic
1105968605 13:25406718-25406740 CTGGCCTTCCGGAAGTGAGGTGG - Intronic
1107260871 13:38489543-38489565 CTGGCTTTGAAGAGGAGAGAAGG + Intergenic
1107631858 13:42350862-42350884 CTGGCCTCCAGTAAGAGAGCAGG + Intergenic
1109424106 13:62149895-62149917 CTAGCCTTGGAGAAGAGAGGTGG - Intergenic
1112050130 13:95636917-95636939 CTAGGCTTCAAGCAGAAAGAAGG + Intronic
1112191356 13:97181024-97181046 CTGGCTTTCAAGATGGAAGAAGG - Intergenic
1113345987 13:109479075-109479097 CTGGCCTTGAGGAAAAGACAAGG - Intergenic
1113380712 13:109803158-109803180 CTGCCCTTCAAAGGGAGAGAAGG - Intergenic
1113968453 13:114168849-114168871 ATGCCCTTCCAGAAGAGTGAAGG + Intergenic
1114498216 14:23148694-23148716 CTGGCTTTGAAGATGAAAGATGG + Intronic
1114713139 14:24798448-24798470 CTGGTCATGAAGAAGAAAGAAGG - Intergenic
1115069642 14:29305182-29305204 CTGGCTTACAAGGAGGGAGATGG + Intergenic
1115174227 14:30544175-30544197 CTGGCTTTAAAGATGAAAGAAGG + Intergenic
1115543767 14:34446647-34446669 ATGCCCTTCTAGAAGAGGGAAGG - Intronic
1115760905 14:36579230-36579252 GTGGCCTTCAGGAAGACAAAGGG - Intergenic
1117413034 14:55467991-55468013 CTGGGCTTCTAGAAGGGCGACGG + Intergenic
1119024779 14:71143862-71143884 CTGACCTTCAAGGAGAGGAAAGG + Intergenic
1120139802 14:80916086-80916108 CTGGCTTTGAAGATGAGGGAAGG + Intronic
1120515722 14:85467669-85467691 CTGGCTTTCAAGATGAATGAGGG - Intergenic
1121268139 14:92617970-92617992 ATGCCCTTCTAGAAGAGTGAAGG + Intronic
1121740740 14:96250680-96250702 CAGGGCTTCCAGAAGAGAGCAGG - Intronic
1121885777 14:97541477-97541499 TTGGGCATGAAGAAGAGAGAGGG + Intergenic
1122014588 14:98783612-98783634 CTGGCCTTGAAGATGGAAGAAGG + Intergenic
1122329221 14:100901740-100901762 CTGGCCCTCAAGAGGGGAGTTGG + Intergenic
1124185736 15:27527017-27527039 CGGGTCTTCAAGAATAGTGAGGG + Intronic
1124691743 15:31829187-31829209 CTGTCCTCCAAGGAGAGGGAGGG - Intronic
1126085917 15:45011221-45011243 CTAGTCTTGAAGAAGAGAGGTGG - Intergenic
1126097289 15:45098602-45098624 CTTGCCTTCAAGAAGGAAGCTGG - Intronic
1130893754 15:88154437-88154459 TTGGCCTTCAAGAAGAATGTTGG - Intronic
1131000771 15:88938147-88938169 ATGGTCTTGAAGAAGACAGAAGG - Intergenic
1132326393 15:100973673-100973695 GGGGGCTTCAGGAAGAGAGAGGG - Intronic
1132417541 15:101633553-101633575 CAGTCCTTGAAGAAGAAAGATGG - Intronic
1132472685 16:114840-114862 CTTGCCTTGAAATAGAGAGAGGG + Intronic
1132552953 16:560781-560803 CTGGACTTCGAGAAGAGGGTGGG - Intronic
1134390372 16:13814452-13814474 CTGGGCTACAAGAGAAGAGATGG - Intergenic
1135192546 16:20366788-20366810 CTGGCAATCAAGATGAGAGATGG - Intronic
1135543409 16:23349595-23349617 CTGGCCTGCCTGAAGACAGAGGG - Intronic
1135845931 16:25918604-25918626 CAGGTCTCCAGGAAGAGAGAAGG + Intronic
1135910080 16:26552329-26552351 CTGGCCTTCAAGCAGTGAGCAGG - Intergenic
1136240278 16:28939044-28939066 CTGGCTTTCAGGGAGGGAGAGGG + Intronic
1137680156 16:50335313-50335335 CTGGGCTACCAGAACAGAGAGGG - Intronic
1138380771 16:56600812-56600834 GGGGGCTTTAAGAAGAGAGATGG + Intergenic
1138515632 16:57534218-57534240 CTGTACTGCCAGAAGAGAGATGG - Intronic
1139531980 16:67546932-67546954 CTGGGCTTGGAGAAGAGAGCAGG + Intergenic
1140987915 16:80176724-80176746 CTGGCTTTGAAGATGAAAGAGGG + Intergenic
1141037492 16:80640990-80641012 CTGGCCTTAAAGAGGAGGTAGGG + Intronic
1141148284 16:81547217-81547239 CTGGCCTCCAGAAAGAGAGACGG + Intronic
1143168551 17:4911989-4912011 CTTGCCTTCAGAAAGAGAGAAGG + Intergenic
1144731426 17:17528546-17528568 CTGGGCTCCATGAAGAGAGGAGG + Intronic
1147306495 17:39567947-39567969 CTGGACTTCAGGGAAAGAGATGG + Intergenic
1148240998 17:45999207-45999229 AGGGGCTTTAAGAAGAGAGAGGG - Intronic
1150305840 17:64084692-64084714 CTGGCCTTCACTGAGTGAGATGG - Intronic
1152080604 17:78185161-78185183 CTGTGCTGCAAGAGGAGAGAGGG + Exonic
1152658072 17:81529186-81529208 CTGGCCTTCAAGGACTGCGACGG + Exonic
1153261193 18:3226005-3226027 TTGCACTTCGAGAAGAGAGATGG + Intergenic
1153262587 18:3238836-3238858 CTGGCCTTAAAGATGGAAGAAGG - Intergenic
1154199610 18:12290169-12290191 CTGGCCTGCAAGGCAAGAGAAGG + Intergenic
1154365682 18:13706581-13706603 TTGCCCTTCTAGAAGAGTGAAGG - Intronic
1156078219 18:33305930-33305952 CTGGCCTTCAAGAAGACACCAGG + Intronic
1156852631 18:41746008-41746030 CTGGGCTCCAAGAAGTGAGAAGG - Intergenic
1157427974 18:47600396-47600418 CTGGCCTTTAAGGGGAGAGCAGG - Intergenic
1158787822 18:60738282-60738304 CTGGCCCTTTAGAAGATAGATGG + Intergenic
1159531396 18:69660149-69660171 GTGGCCTTCAGGAAGAAAGTCGG - Intronic
1160184829 18:76667816-76667838 CTGGACTTCACGCAGAGAGTGGG + Intergenic
1160264601 18:77329400-77329422 CTGGCGTTAAAGCAGACAGATGG + Intergenic
1165419031 19:35713662-35713684 TTGGCTTTTAAGAAGAGAGCTGG - Intronic
1166210290 19:41302561-41302583 GTGGCCTTCCAGAAGGGAGAAGG - Intronic
1166388080 19:42393121-42393143 CTGGCCTTCAAGGAAACAGCAGG - Intergenic
1167582749 19:50356055-50356077 CTGGCTTTGAAGAAGGGAGAAGG - Intronic
1168557656 19:57356573-57356595 CTGGCTGTCAAGAAGAGTAAAGG - Exonic
925244066 2:2363958-2363980 CTGCACTCCAAGAAGAAAGAGGG - Intergenic
925687317 2:6486068-6486090 CTGGCATTGAAGGAGAGTGAAGG - Intergenic
926156197 2:10455228-10455250 CTGTCCTACAAGAAGGCAGAAGG - Intergenic
926280160 2:11439738-11439760 CTGGCCTAATAGAAGACAGATGG + Intergenic
926443108 2:12910648-12910670 CTGGCTTTGAAGATGAAAGAAGG - Intergenic
926663196 2:15491413-15491435 CTAGCTTTGAAGAAGAGAAATGG - Intronic
927260234 2:21081201-21081223 CTACCTTTCAAGAACAGAGAAGG + Intergenic
928847087 2:35689267-35689289 ATGGTCTTCTGGAAGAGAGAGGG - Intergenic
929782555 2:44966400-44966422 CTTGTCTGCAAAAAGAGAGAGGG - Intergenic
929869765 2:45748861-45748883 CAGGACTTCAAAAACAGAGAGGG + Intronic
930868751 2:56148823-56148845 CTGGCCTTCAAATAGAGATGAGG - Intergenic
933077739 2:77950907-77950929 GTGCCCTTCTAGAAGAGTGAAGG + Intergenic
934766338 2:96882202-96882224 CTGACCTTCACACAGAGAGAGGG - Intronic
935352086 2:102159775-102159797 CAGGCTTGCAAGAAGAGAGAGGG - Intronic
936554415 2:113481471-113481493 TTTGCCTTGAAGAAGAGTGAGGG - Intronic
937092928 2:119218446-119218468 TTGGCCTTCAAGGGGAGGGAAGG - Intergenic
940048497 2:149435738-149435760 CTGGCATTCAGGAAGAGAATGGG - Intronic
940442698 2:153736973-153736995 CTGCCCTCCCAGAAGAGTGATGG - Intergenic
940563843 2:155335674-155335696 TTGGTATTCAAGATGAGAGAGGG - Intergenic
941016490 2:160363442-160363464 CTGGCCTTGCTGAATAGAGATGG + Intronic
941371585 2:164672361-164672383 CTAGACTTCAAGAAAGGAGAGGG + Intronic
942120239 2:172769545-172769567 CTGGCCTTTAAGTAGATAGGGGG + Intronic
942856042 2:180549837-180549859 CTGGCTTTGAAGAAGGAAGATGG - Intergenic
944606331 2:201354818-201354840 CTGGCCTTCAAGAAGAGAGAAGG - Intronic
945571481 2:211473295-211473317 CAGGGCTTCTAGAAGAGAGTAGG + Intronic
945811826 2:214558266-214558288 ATGTCCTGCAAGAAGAAAGAGGG - Intronic
946765188 2:223033917-223033939 GGGGACTACAAGAAGAGAGAGGG - Intergenic
947004971 2:225500754-225500776 TTGACCTTCTAGCAGAGAGATGG - Intronic
947909778 2:233793442-233793464 CTCTCCTTCAAGGACAGAGACGG - Intronic
1168893960 20:1311142-1311164 CTGGCCTTCAAGCTGAGGGTGGG - Intronic
1169055889 20:2620712-2620734 CTATCCTTCAAGAAGAAGGAAGG + Intronic
1170768166 20:19309697-19309719 GTGGCCTTCAAAAAGAGAGTTGG + Intronic
1170829465 20:19827480-19827502 CTTGGCTTCAAAAACAGAGAAGG - Intergenic
1171209381 20:23304947-23304969 GTGGTCTTAAAGAAGGGAGATGG - Intergenic
1172027596 20:31959753-31959775 CTGGCGTTCAAGAAGAGTGGAGG - Intergenic
1172571878 20:35976918-35976940 CTGGGCTCCAAGAAGAGAAAGGG - Intronic
1172780106 20:37431531-37431553 CTGCCCTTCAAGATGGGTGATGG + Intergenic
1172981145 20:38942890-38942912 CAGGCCTTCAACAAGGGAGCTGG - Intronic
1173007207 20:39149352-39149374 CTGGGCTCCAGGAAGAGAAATGG - Intergenic
1174961803 20:55166152-55166174 CTGCCCTTCAAGATGAGAGAAGG - Intergenic
1175352781 20:58337287-58337309 CGGGCCTTGAAGATGAAAGAAGG - Intronic
1175936189 20:62515184-62515206 CTGAACTTCAAGATGGGAGAGGG + Intergenic
1176420125 21:6507447-6507469 GTGGCCTTCAAGAAGACAACAGG + Intergenic
1177486722 21:21767781-21767803 CCAGCCTTCAAGAGGAAAGAGGG + Intergenic
1178027796 21:28488068-28488090 CTGGGCATCAAGCAGTGAGAAGG - Intergenic
1179224223 21:39439195-39439217 CTGGCTTTCAAGATGGAAGAAGG + Intronic
1179226056 21:39454535-39454557 GTGGCCTTCTGGAAGAGAGGAGG - Intronic
1179410044 21:41155479-41155501 CCAGCCTTCAAGAAGAGATAAGG + Intergenic
1179695617 21:43115767-43115789 GTGGCCTTCAAGAAGACAACAGG + Intergenic
1180631397 22:17232611-17232633 CTGGCCTTCGTGAAGCGGGAAGG - Intergenic
1180818852 22:18811193-18811215 CTGGCCTTCAAAGGGACAGATGG - Intergenic
1181205076 22:21245648-21245670 CTGGCCTTCAAAGGGACAGATGG - Intergenic
1181327481 22:22060993-22061015 CTAGCCTTAGAGGAGAGAGATGG - Intergenic
1182436569 22:30334607-30334629 CTGGCCCTCAAGGAGAGAGGCGG - Exonic
1184076628 22:42183501-42183523 CTGGCCTGGAAGATGGGAGAAGG + Intronic
1184411943 22:44331034-44331056 CTGGCTTCCAAGAACAGAGTCGG - Intergenic
1185322797 22:50209635-50209657 GTGGCCTTGAAGGAGAGAGGTGG + Intronic
1203221849 22_KI270731v1_random:49767-49789 CTGGCCTTCAAAGGGACAGATGG + Intergenic
1203268977 22_KI270734v1_random:37046-37068 CTGGCCTTCAAAGGGACAGATGG - Intergenic
950083231 3:10238662-10238684 CTGGCCTCCCAGCAGAGAGGGGG - Intronic
950083657 3:10241053-10241075 CTGGCCTTCCAGAAAGGAGAGGG - Intronic
951250336 3:20386953-20386975 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
951366894 3:21794354-21794376 CTAGCTTTCAAGAGGAGAGGTGG - Intronic
952710784 3:36429999-36430021 ATGGGGTTCAAGATGAGAGAAGG + Intronic
952937824 3:38413830-38413852 GTGGACTGCAAGAAGAGAGAGGG - Exonic
960339111 3:116453701-116453723 CTGGACTTCAAGAAAAGAAAAGG - Intronic
962528548 3:136257290-136257312 CTGGCTTTGAAGATGGGAGAAGG + Intronic
963268462 3:143262092-143262114 CCTGCCTTCAAGATGGGAGAGGG - Intergenic
963962553 3:151325293-151325315 ATAACCTTCAAGAAAAGAGAGGG - Intronic
964562792 3:158016760-158016782 CTGGCTTTAAAGATGAGAGGGGG - Intergenic
965096069 3:164227733-164227755 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
965309496 3:167111893-167111915 CTGGCCCTGATGAAGGGAGAGGG - Intergenic
966225114 3:177589971-177589993 CTAGCCTTGAAGTAGAGAGGGGG - Intergenic
966536207 3:181037152-181037174 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
967479386 3:189956554-189956576 CTGCTCTTGAAGAACAGAGATGG - Intergenic
968705934 4:2077506-2077528 CTGCCCTTCCAGAAGTCAGAGGG + Intronic
969478104 4:7432642-7432664 CTGGGGTGCAAGGAGAGAGAGGG + Exonic
970364447 4:15344025-15344047 CTGGCCTTAAAGAATAGATAAGG + Intronic
972955075 4:44378981-44379003 CTGGCTTTGAAGATGAAAGATGG - Intronic
973611330 4:52638283-52638305 CTGGCCTTGAAGAGGGAAGAAGG + Intronic
976149949 4:82081615-82081637 GTTGCCTTCAAAAAGAGAGTTGG - Intergenic
977166761 4:93709685-93709707 TTGGCCTTAAAGAGGAGACACGG - Intronic
977271247 4:94919668-94919690 CTGGCATGCAGGAAGAAAGAAGG - Intronic
978950729 4:114555918-114555940 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
979026172 4:115579152-115579174 CTGGCCTTGAAGATGGAAGAAGG + Intergenic
979475378 4:121150742-121150764 CATGCCTCCAACAAGAGAGAGGG + Intronic
980651974 4:135728368-135728390 CTGGCTCTGAAGAAAAGAGAGGG + Intergenic
982507735 4:156241142-156241164 CTTGCCGTCAGGAAGGGAGATGG + Intergenic
983771729 4:171558266-171558288 CTGTCTCTCAAGAAGAGAGTAGG + Intergenic
983873982 4:172854659-172854681 TTGGCCTTGAAGAATGGAGAGGG - Intronic
985735383 5:1577124-1577146 CAGGTCTTCAAGGAGAGGGAGGG + Intergenic
986130259 5:4923542-4923564 CTGGCCTCGGAGGAGAGAGAAGG + Intergenic
986429042 5:7663655-7663677 CTGGTCTTCCAGAAGAAACAAGG - Intronic
986667356 5:10115143-10115165 CTGGCCTTGAAGACCAAAGAAGG + Intergenic
986859999 5:11915898-11915920 CTGGCTTTGAAGATGAGAGGAGG + Intergenic
987017677 5:13836923-13836945 CTGGCTTTGAAGATGAGGGAAGG + Intronic
987495829 5:18643384-18643406 CTGGCCTCCATGGAGAGAAATGG + Intergenic
988216180 5:28276169-28276191 CTGGCCTTGAAGACAAGTGATGG - Intergenic
989336791 5:40327096-40327118 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
989711499 5:44402993-44403015 ATGGTCTTCAAGAGGAGAGTTGG - Intergenic
990290870 5:54350119-54350141 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
990374308 5:55154064-55154086 CTGTTCTTCAAGAAGGGAGATGG + Intronic
990662863 5:58037927-58037949 CTGGCCTTGAAGATGGAAGAAGG + Intergenic
991114011 5:62932984-62933006 ATGTCCTTCAAAAAGAGACAAGG + Intergenic
991425508 5:66487890-66487912 CTGGCATTCAAGAAGCAAGGTGG - Intergenic
992323338 5:75635938-75635960 ATGGCTTTCAAGAAAAGAGTGGG + Intronic
992570859 5:78055717-78055739 CTCTCCTTCAAGGAGAGAGGTGG + Intronic
992578502 5:78145870-78145892 CTCTCCTTCCAGAAGAAAGATGG + Intronic
993248789 5:85487644-85487666 ATGCCCTTCCAGAAGAGTGAAGG - Intergenic
993468312 5:88274725-88274747 ATGTCCTTCAAGAAGAAATAAGG - Intergenic
993946807 5:94124767-94124789 CTGCCCTTGAAGAAGAGGGATGG + Intergenic
994003339 5:94807380-94807402 TTGGCCTTAAAGAAGAGAGCTGG + Intronic
994099571 5:95878526-95878548 CTGGCCTCCAGGAAGACGGAGGG + Intergenic
994301786 5:98156315-98156337 CTGGCCTTCAAGGAGATATCAGG + Intergenic
996242472 5:121220964-121220986 CTGGGTTTCAAGAAGAAAGATGG + Intergenic
996446229 5:123554677-123554699 CTGGCCTACAACATGAGAAAAGG - Intronic
997203004 5:132024073-132024095 ATGGCCTGGAAGAAGAGAGCAGG - Intergenic
997799310 5:136843866-136843888 ATGGAGTTCAAGAGGAGAGATGG + Intergenic
999018085 5:148131203-148131225 ATGGCATTCAAGAAGAGGGGTGG - Intronic
999722444 5:154408990-154409012 ATGGCCTCCAAGGAGAGACAAGG - Intronic
1000166944 5:158659210-158659232 CTGGGCTTTAAGAAGAGAAGTGG + Intergenic
1003224213 6:4189956-4189978 CTGGTCTTCCAGAAGAGGGGAGG - Intergenic
1003495221 6:6657828-6657850 CTGGCTTTTAAGAAAAGAAAAGG - Intergenic
1006013725 6:31063991-31064013 CTGGACTTCATAAAGAGAAAAGG - Intergenic
1007029778 6:38617386-38617408 CTAGCCTTGGAGAAGAGAGGTGG - Intronic
1007726173 6:43917156-43917178 CTGCCTCTCAAGAATAGAGATGG + Intergenic
1008523697 6:52386656-52386678 CAGGACTACAAGAAGGGAGAAGG + Intronic
1009039175 6:58156924-58156946 CTGGCCTTAAACAAGAGGTAGGG - Intergenic
1009215069 6:60911764-60911786 CTGGCCTTAAACAAGAGGTAGGG - Intergenic
1010189828 6:73183718-73183740 CTGTCCTGAAAGAAGTGAGAGGG + Intronic
1011123734 6:83983861-83983883 ATGCCCTTCTAGAAGAGTGAAGG - Intergenic
1012593730 6:101015974-101015996 CGGGCATTCAAGAACAGAAAAGG - Intergenic
1013183628 6:107738680-107738702 CTTCCCTTGAAGAAGAGGGAGGG - Intronic
1013600109 6:111695820-111695842 CTGACGTTTAAGAAGAGAGCTGG + Intronic
1013720399 6:113019303-113019325 CTAGCCTTCCACAGGAGAGAAGG + Intergenic
1013757404 6:113477692-113477714 CTGGCCAGCAACAAGGGAGAAGG - Intergenic
1014266131 6:119279760-119279782 GTGGCATTCACGAAGACAGATGG - Intronic
1014281143 6:119443616-119443638 CTGGCCTTGAAGAACATGGAAGG - Intergenic
1014798928 6:125756262-125756284 ATGGCCTTCAAGAAGGGAGCTGG + Intronic
1015124021 6:129732220-129732242 CTGGCCTCCAAGATAACAGAGGG - Intergenic
1015794030 6:136992966-136992988 ATGGCCATGAAGAAGGGAGAGGG + Intergenic
1016016855 6:139195149-139195171 CTGGCATTCAAGATGGGGGAAGG - Intergenic
1016914258 6:149230096-149230118 TTGGCCTGGAAGAAGAGAGAGGG - Intronic
1017298139 6:152823310-152823332 ATGGCCTTCATTAACAGAGAAGG + Intergenic
1017528034 6:155259917-155259939 GTGTCCTTAAAGAAGAGATAGGG + Intronic
1017817103 6:158023659-158023681 GTGAGCTTCCAGAAGAGAGAAGG - Intronic
1019270802 7:147277-147299 ATGCCCTTCTAGAAGAGGGAAGG + Intergenic
1019556472 7:1633950-1633972 CTGACATTCATGCAGAGAGAGGG + Intergenic
1020223489 7:6260678-6260700 GTGGCATTGCAGAAGAGAGAAGG - Intronic
1020332946 7:7038771-7038793 CTGGCTTTCAAGATGAAAGTGGG + Intergenic
1020544530 7:9507702-9507724 CTGGCCCTCAGTAAAAGAGAAGG + Intergenic
1020647225 7:10829519-10829541 ATGGCCTTCTAGAAGAGTGAAGG - Intergenic
1020962801 7:14827077-14827099 ATGGTCTACAAGAAGAAAGAAGG + Intronic
1021325573 7:19262962-19262984 CTCTCCTTCAAGATGAAAGATGG - Intergenic
1022097125 7:27148025-27148047 CTGGCGTTCGGGAAGAGAGCCGG - Intronic
1022445882 7:30470336-30470358 CTGGCCTTGAAGATGACAGATGG - Intronic
1023114911 7:36853286-36853308 CTGGAGTGCCAGAAGAGAGAGGG + Intergenic
1023732976 7:43209808-43209830 CGGGCATTCCAGAAGAGTGAAGG + Intronic
1024724125 7:52172904-52172926 CTGGATTTCATGAGGAGAGAGGG - Intergenic
1024765429 7:52652351-52652373 CTTGCCTCCATGAAGACAGAGGG - Intergenic
1024791005 7:52964810-52964832 CTGGCCTCCAAGATGGAAGAAGG + Intergenic
1026621178 7:71951070-71951092 CTGGCCGTGAATGAGAGAGATGG - Intronic
1026725858 7:72869434-72869456 TTGTCCTTCAAGAAGAGACAGGG + Intergenic
1027707634 7:81554292-81554314 ATGCCCTTCTAGAAGAGTGAAGG - Intergenic
1028140771 7:87272807-87272829 CTGGCCTTGTAGAAGAGTAAAGG + Intergenic
1028905811 7:96152801-96152823 CAGGGCTTCCAGAAGTGAGAAGG + Intronic
1029810797 7:103046421-103046443 ATGTCCTTCTAGAAGAGTGAAGG + Intronic
1030521524 7:110603897-110603919 CTGTGCTTTAAGAAGAGAGTAGG + Intergenic
1030749637 7:113215645-113215667 CTGAGCTTCCAGCAGAGAGAAGG + Intergenic
1031121814 7:117730490-117730512 CTGCCACTCAAGAAGAGACAAGG + Intronic
1031353532 7:120763486-120763508 CCTGTCCTCAAGAAGAGAGAAGG + Intergenic
1031572739 7:123379130-123379152 CTGGGAATTAAGAAGAGAGATGG + Intergenic
1033072369 7:138215865-138215887 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
1033233968 7:139623733-139623755 CTGGCCTACAGGAAGTGAGTGGG - Intronic
1033251907 7:139767938-139767960 CTGGTCTTGAAGAAGAGGGTGGG - Intronic
1033483372 7:141763553-141763575 CTGGCTTACATGCAGAGAGATGG - Intronic
1033962884 7:146935501-146935523 ATGCCCTTCTAGAAGAGTGAAGG - Intronic
1034292795 7:149945978-149946000 CTGGCCTTTAAGAGGAGAATGGG + Intergenic
1034527626 7:151675708-151675730 CTGGTCTCCAGGAAGGGAGATGG + Intronic
1034704582 7:153128924-153128946 CTGGGCCTCAAGAAAAGAGTAGG - Intergenic
1034813274 7:154150894-154150916 CTGGCCTTTAAGAGGAGAGTGGG - Intronic
1034980974 7:155476104-155476126 CTGTCCTGAGAGAAGAGAGATGG + Intronic
1035386021 7:158473554-158473576 CTAGACTCCAAGAAAAGAGAAGG + Intronic
1037297226 8:17413639-17413661 GTGGCCTCCTGGAAGAGAGATGG + Intergenic
1038052963 8:23830738-23830760 CTGGCATATAAGAAGAAAGAGGG + Intergenic
1038213783 8:25543127-25543149 CAGGACTTCAAGAAGGGAGTGGG - Intergenic
1038475567 8:27864224-27864246 CTGCCCTTCCAGAAAAGAGCTGG + Intergenic
1038577705 8:28718969-28718991 TTGGCATTCTAGGAGAGAGATGG + Intronic
1039259166 8:35751731-35751753 TTGGCATTCAAGAAGAGAGAAGG + Intronic
1039268852 8:35858453-35858475 CTGGCCTTTGAGAAGATGGATGG + Intergenic
1040089391 8:43381475-43381497 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
1041520342 8:58748916-58748938 CTGTCCATCAAGAAAACAGATGG + Intergenic
1044855023 8:96466977-96466999 CTGGCCTTGAAGAAGGGAGAAGG + Intergenic
1045306810 8:100964759-100964781 CTGGCCATCAAGAAGGGGAAGGG - Intergenic
1045311589 8:101007948-101007970 GTGGCCATAAAGAAGACAGATGG - Intergenic
1045840313 8:106572145-106572167 CTATTCTTCAAGAAAAGAGAAGG - Intronic
1046142420 8:110111361-110111383 ATTACCTTCAAGAAGAGAAAGGG - Intergenic
1046185268 8:110706190-110706212 GTGGCTTTGGAGAAGAGAGATGG + Intergenic
1047064735 8:121268308-121268330 CTGGCCTTGAAGAAGGGATGTGG + Intergenic
1048614596 8:136059449-136059471 CTGCCCTTCAGCAAGACAGAGGG + Intergenic
1048937205 8:139367227-139367249 GTGGCCTTGAAGAATAGATATGG + Intergenic
1049399719 8:142419536-142419558 CGGGCCTTCATGGAGAGGGATGG - Intergenic
1049958080 9:711641-711663 CTGTCTTGCAAGAAGAGAAAAGG + Exonic
1050658085 9:7851524-7851546 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
1051032731 9:12701655-12701677 GGAGCCTTAAAGAAGAGAGATGG - Intronic
1051498439 9:17750965-17750987 CAGGCTTCCTAGAAGAGAGAGGG + Intronic
1052593233 9:30526075-30526097 ATGGCCATCAAGAAGAGAGCGGG - Intergenic
1055465517 9:76561618-76561640 ATGACCTCCAGGAAGAGAGATGG + Intergenic
1055970596 9:81908193-81908215 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1056836649 9:89961142-89961164 TTGGTCCTCAAGAAGGGAGATGG - Intergenic
1056860658 9:90177957-90177979 CTGGCCATCTGGGAGAGAGAGGG + Intergenic
1056939487 9:90942788-90942810 CTGGCCTGCTGGGAGAGAGACGG - Intergenic
1060144862 9:121243209-121243231 CTGGCCTTGAAGATGAAGGAAGG - Intronic
1060643563 9:125259491-125259513 CTGGATTTCAAGACAAGAGATGG - Intergenic
1061589277 9:131588352-131588374 GTGGCCAGCAAGAACAGAGATGG + Intronic
1061803028 9:133122329-133122351 CTGGCCTCCATGAAGACTGAAGG - Intronic
1185495635 X:552865-552887 CTGGCCGTGAAGAAGACAGTGGG - Intergenic
1185625429 X:1478029-1478051 CTGGTCTTCAGGAAGACAGATGG + Intronic
1186893395 X:13982372-13982394 ATGCCCTTCTAGAAGAGTGAAGG - Intergenic
1187576505 X:20562009-20562031 CTGCCCTTCCAGAAGCCAGAAGG + Intergenic
1188057455 X:25558071-25558093 TTGGCCTTCCAGAAAGGAGATGG + Intergenic
1188266870 X:28087750-28087772 CTGGCTTTGAAGATGAAAGAAGG - Intergenic
1188705826 X:33328630-33328652 GTGGCCTTCCAAAAGAGACAAGG + Intronic
1191710035 X:64139929-64139951 CTGGCCTTCAAGAAGGAACCAGG - Intergenic
1191834018 X:65444806-65444828 TTGGCCTTAAAGAGGAGATAGGG - Intronic
1192495180 X:71611711-71611733 CTGCCCTCCAGGAACAGAGATGG - Intronic
1193810410 X:86044047-86044069 ATGGTCTTCAAAAAGAAAGAAGG + Intronic
1193821336 X:86169492-86169514 CTGGCCTTAAAGAGAAGACAGGG - Intronic
1194698711 X:97087888-97087910 CTGGGATCAAAGAAGAGAGAGGG - Intronic
1196192252 X:112807136-112807158 CTGGCCTTCCACACGAGAGAAGG + Intronic
1196831723 X:119781155-119781177 CTGGACTGGAAGAAGAGAGGGGG + Intergenic
1197015949 X:121626571-121626593 CTTGTCTTCAAGCAGAGGGATGG - Intergenic
1197534646 X:127672560-127672582 CTGGCCTTGCAGAAGACAGATGG + Intergenic
1197704072 X:129621449-129621471 GAGGCCTTCAACATGAGAGAGGG - Intergenic
1197760700 X:130025749-130025771 CTTGGGTTCAAGAAGACAGAGGG + Intronic
1199074423 X:143512480-143512502 CTGGCTTTCCAAAAGACAGACGG + Intronic
1199093428 X:143715748-143715770 CTGGCTTTCCAAAAGACAGACGG + Intronic
1201713125 Y:17013858-17013880 ATATCCTCCAAGAAGAGAGAAGG + Intergenic