ID: 944611036

View in Genome Browser
Species Human (GRCh38)
Location 2:201408058-201408080
Sequence CTGGTGTTCTTAAGCACCAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 237
Summary {0: 1, 1: 0, 2: 2, 3: 29, 4: 205}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944611036 Original CRISPR CTGGTGTTCTTAAGCACCAT AGG (reversed) Intronic
900830681 1:4963236-4963258 CTGGTGGTCTTGGGGACCATAGG - Intergenic
903666934 1:25013795-25013817 CTGGTGTTGATAAGCCTCATAGG + Intergenic
904426961 1:30433321-30433343 CTGGTGTTCTATAGCACAGTGGG + Intergenic
905638395 1:39571452-39571474 CTGGTGTACTTGACCACCATTGG - Intronic
907922088 1:58923100-58923122 CTTGTGGTATTAAGCACCCTGGG - Intergenic
908527923 1:65005465-65005487 CTAGTGTTCTATAGCACTATAGG + Intergenic
910627009 1:89317427-89317449 CTGCTGTTCTTCAGCCCCAATGG + Intergenic
910969995 1:92846348-92846370 CTAGTGTTCTATAGCACTATAGG - Intronic
912037597 1:105339842-105339864 CTGGTGTTCTATAGCACTGTAGG + Intergenic
917083419 1:171280783-171280805 CAGGTGTTCCTCAGCACCACCGG + Exonic
918295669 1:183154065-183154087 CTGGTGTTCTATAGCACAATAGG - Intergenic
918475549 1:184920459-184920481 CTGGTGTTCTATAGCACTGTAGG - Intronic
918955878 1:191206090-191206112 CTAGTGTTCTATAGCACCGTAGG - Intergenic
919295442 1:195693476-195693498 CTGGTGTTCTGTAGCACTGTAGG - Intergenic
921549422 1:216515515-216515537 CTGTTGTTCTTAAGGACAAATGG - Intronic
923622746 1:235591421-235591443 GTGGTTGTCTTCAGCACCATTGG - Intronic
923995654 1:239491259-239491281 CTAGTGTTCTACAGCACTATAGG - Intronic
1063144308 10:3283060-3283082 TTGCTGTTCTTAAGAGCCATAGG - Intergenic
1064419027 10:15174373-15174395 CTGGTGTTCTATAGCACTATAGG - Intergenic
1064797460 10:19029240-19029262 CTAGTGTTCTATAGCACTATAGG + Intergenic
1065566863 10:27020356-27020378 CCGGTGTTCTATAGCACCACAGG - Intronic
1065920693 10:30390284-30390306 CTAGTGTTCTTTAGCATTATAGG - Intergenic
1066552949 10:36579565-36579587 CTGGTGTTTTTTAGCACTGTAGG + Intergenic
1067020077 10:42788557-42788579 CTGGTGTTCAACAGCACAATAGG - Intronic
1068421115 10:56794907-56794929 TTAGTGTTCTGTAGCACCATAGG - Intergenic
1069174001 10:65267421-65267443 CAGATGTTCTTAATCACCACCGG - Intergenic
1069338135 10:67377841-67377863 CTGGTGTTCTCTAGCACTGTAGG - Intronic
1069382900 10:67858679-67858701 TTGGTGCTCTTGTGCACCATTGG - Intergenic
1073436989 10:103523517-103523539 CTAGTGTTCTATAGCACTATAGG - Intronic
1075962103 10:126577068-126577090 CTAGTGTTCTATAGCACAATAGG + Intronic
1078856344 11:15208809-15208831 CTGGTGTTCTTATCCACCAGGGG - Intronic
1079662133 11:23052220-23052242 CTAGTGTTCTGTAGCACAATAGG + Intergenic
1079728183 11:23903631-23903653 CTAGTGTTCATAAGCACAGTAGG + Intergenic
1083040959 11:59686484-59686506 CTGGTGTTCTTTTGCACAGTAGG + Intergenic
1083083452 11:60117262-60117284 CTAGTGTTCTTTAGCACTGTAGG + Intergenic
1085863783 11:80263792-80263814 CTAGTGTTCTGTAGCACAATAGG - Intergenic
1086597861 11:88595314-88595336 CTAGTGTTCTTTAGCACTGTAGG - Intronic
1087284509 11:96250467-96250489 CTAGTGTTCTTTAGCACTGTAGG - Intronic
1090132916 11:124163772-124163794 CTAGTGTTCTACAGCACAATAGG - Intergenic
1090500938 11:127260245-127260267 CTGGTGTTCTGCAGCACTGTAGG + Intergenic
1090979781 11:131709337-131709359 CTGGTGTTTTTAGGCTCCAGGGG + Intronic
1091559920 12:1604268-1604290 CTAGTGTTCTAAAGCACCGTAGG + Intronic
1094210954 12:27890997-27891019 CTGGTGTTCTATTGCACGATAGG - Intergenic
1094219213 12:27974930-27974952 CTGGGGATCTTAGGCTCCATGGG + Intergenic
1094456503 12:30640781-30640803 CTGGTGTTCTATAGCACTATGGG + Intronic
1094821006 12:34224650-34224672 CTAGTGCTCTAAAGCACTATAGG - Intergenic
1096967441 12:55639430-55639452 CTAGTGTTCTATGGCACCATAGG + Intergenic
1098682844 12:73379870-73379892 CTGGTGTTTTAAATAACCATTGG - Intergenic
1099113137 12:78587269-78587291 CTGGTGCTCTTGGACACCATAGG - Intergenic
1100204538 12:92334041-92334063 CTAGTGTTCTATAACACCATAGG - Intergenic
1100708677 12:97229809-97229831 CTGGTGTTCTTAAGCACAGAAGG - Intergenic
1101201163 12:102437691-102437713 CTGGTGTTCTATTGCACAATAGG + Intronic
1101620145 12:106378400-106378422 ATGGTGTCCTTAAGCAATATTGG + Intronic
1104271089 12:127282842-127282864 CTGGTGTTATGAAGCACAGTGGG - Intergenic
1105682008 13:22737732-22737754 CTGGTGTTCATTAGCACAATAGG + Intergenic
1105766145 13:23561433-23561455 CTGGTGTTCACAAGAACCCTCGG + Intergenic
1106328285 13:28715626-28715648 CTGGTGTTCTGTAGCACCACAGG + Intronic
1106675794 13:31956655-31956677 CTGGTGTTCTGTAGCACTGTAGG - Intergenic
1107165516 13:37278278-37278300 CTGGTGTTCTTTTGCACAATAGG - Intergenic
1108974499 13:56421502-56421524 CTGGTGTTCTGCAGCACTATAGG - Intergenic
1109991389 13:70062013-70062035 CTGGTGTTCTTCAGCACTGCAGG - Intronic
1110082537 13:71334083-71334105 CTGGTGTTCTGCAGCACTATAGG - Intergenic
1110592863 13:77285132-77285154 CTGATGTTTTTAAACACCCTAGG + Intronic
1112202168 13:97287574-97287596 CTAGTGTTCTATATCACCATAGG - Intronic
1112206423 13:97328100-97328122 CTGCTGTTCTTGGGCACCTTGGG - Intronic
1112341520 13:98556568-98556590 CTGGTGTTGTTACTCACCATTGG - Intronic
1113196201 13:107809610-107809632 CTGGTGGTCTTTATCACCTTGGG + Intronic
1113262822 13:108584539-108584561 CTGGTGTTCTATAGCACAGTAGG - Intergenic
1114679189 14:24469999-24470021 CTAGGGTTCTATAGCACCATAGG + Intergenic
1115260901 14:31452650-31452672 CTGGTGTTCTGGAGCACTGTAGG + Intronic
1115520670 14:34230157-34230179 CTAGTGTTCTATACCACCATAGG + Intronic
1117268157 14:54112655-54112677 CTAGTGTTCTATAGCACCATAGG + Intergenic
1117305931 14:54473090-54473112 CCTGTGTTCTGAAGCACCACAGG + Intergenic
1118394732 14:65326333-65326355 CTAGTGTTCTAAAGCACTGTAGG + Intergenic
1119617382 14:76107758-76107780 CTGGTGTTCCTGCCCACCATGGG + Intergenic
1120098270 14:80414275-80414297 CTGCTGCTCTTCAGCACTATGGG + Intergenic
1122437475 14:101709864-101709886 CTTGGGTTCTCAGGCACCATAGG + Intergenic
1123098714 14:105779427-105779449 CCGGTGTTCTCTAACACCATAGG - Intergenic
1124417676 15:29486961-29486983 CTGGTGTTCTATAGCACTATAGG + Intronic
1126875047 15:53032377-53032399 CTGGTTTTGTTAAGCAGCACTGG + Intergenic
1127369837 15:58329490-58329512 CTGGTGTTCTACAGCACTGTAGG + Intronic
1128859916 15:71060409-71060431 CTGGTGTTCTACAGCACTATAGG - Intergenic
1130174331 15:81552301-81552323 CTAGTGTTCTATAGCACCAGAGG + Intergenic
1130680312 15:85990705-85990727 CTGGTGATCTAAAGCACCATTGG - Intergenic
1130726359 15:86443518-86443540 CTGGTGTTCTGTAGCACTGTAGG - Intronic
1131239459 15:90726210-90726232 CTGGTGTTCTGTAGCACTACAGG - Intronic
1139196090 16:64920208-64920230 CTGGTGTTCTTGATCTGCATTGG + Intergenic
1144379097 17:14675298-14675320 ATAGTGTTCTTAAGCAACACAGG - Intergenic
1146138869 17:30347420-30347442 CTGGTGTTCATTAGTACCCTTGG + Intergenic
1149427074 17:56565536-56565558 CTGATACTTTTAAGCACCATTGG - Intergenic
1151034395 17:70781273-70781295 CTAATGTTCTATAGCACCATAGG + Intergenic
1153946183 18:10019731-10019753 CTGGTGTTCTGTAGCACTATAGG + Intergenic
1157732448 18:50015933-50015955 CTGGTCATCTTGAGCACTATGGG + Intronic
1158353283 18:56587458-56587480 CTAGTGTTCTATAGCACTATTGG + Intergenic
1158427075 18:57350049-57350071 CTAGTGTTCTATAGCACTATAGG - Intergenic
1159337137 18:67082975-67082997 CTAGTGTTCTATAGCACTATAGG - Intergenic
1159637214 18:70820121-70820143 CTGGTGTTCTATAGCACTGTAGG + Intergenic
1159810032 18:73007292-73007314 TTGGTGTTCTGACGAACCATGGG - Intergenic
1163581032 19:18138862-18138884 CTGGTGTGTTTAAGGACCACGGG - Intronic
1165391422 19:35541245-35541267 CAGGGGTTCTAAAGCACCCTGGG + Intronic
1166592402 19:44011646-44011668 CTAGTGTTCTAAAGCACCAAAGG - Exonic
1167526002 19:49984210-49984232 CTGGAGTTCAGAGGCACCATGGG + Intronic
1168371400 19:55837406-55837428 CTGGTGTTCAGTAGCACTATAGG - Intronic
926798922 2:16641679-16641701 CTTGTGTGCTTATGCAACATTGG - Intronic
927096948 2:19754576-19754598 ATGATGTTCTCAAACACCATGGG + Intergenic
929145064 2:38699462-38699484 CTAGTGCTCTAAAGCACTATAGG - Intronic
929239735 2:39641964-39641986 CTGGTGTTCAAAAGCAAAATTGG - Intergenic
930203808 2:48568744-48568766 CTGTTGTTCTTGAGCAACCTTGG + Intronic
932704993 2:74017305-74017327 GCGGTGTTCTATAGCACCATAGG - Intronic
933009972 2:77048834-77048856 CTAGTGTTCTATAGCACTATAGG - Intronic
935580629 2:104753156-104753178 CTGGTGTTCCATAGCACAATAGG + Intergenic
941058861 2:160822197-160822219 CTAGTGTTCTGTAGCACCACAGG - Intergenic
941946687 2:171106259-171106281 CTGGTGTTCTATAGCACTATAGG + Intronic
944611036 2:201408058-201408080 CTGGTGTTCTTAAGCACCATAGG - Intronic
944772401 2:202927753-202927775 CTAGTGTTCTATAGCACTATAGG - Intronic
945174711 2:207031033-207031055 CTAGTGTTCTAAAGCACTACAGG + Intergenic
945230846 2:207587869-207587891 CTGGTGTTCTGTAGCACCATAGG + Intronic
945477075 2:210296352-210296374 CTAGTGTTCTAAAGCACTATAGG - Intronic
945683581 2:212941611-212941633 CAGTTGTTCTTAATCAGCATTGG - Intergenic
946437689 2:219668834-219668856 AATGTGTTTTTAAGCACCATGGG + Intergenic
947463671 2:230323606-230323628 GTGGTGCTCGTCAGCACCATGGG + Intergenic
1169821191 20:9712093-9712115 CTCATGTTCCTAAGCACAATAGG - Intronic
1169901826 20:10561300-10561322 CTAGTGTTCTATAGCACTATAGG - Intronic
1170404885 20:16025690-16025712 ATGGTTTTCTTGAGCACCAGAGG - Intronic
1173206827 20:41001693-41001715 CTGGTGTTCTATTGCACAATAGG + Intergenic
1174746462 20:53068078-53068100 CTGGTGTTCTTAAAAATCAAAGG - Intronic
1174862455 20:54103902-54103924 CTAGTGTTCTGCAGCACTATAGG - Intergenic
1180569952 22:16705099-16705121 CTAGTGTTCTGTAGCACCACAGG + Intergenic
1182740117 22:32561513-32561535 CTGGTTTTCTTCAGCAGCAGAGG + Intronic
949698505 3:6727902-6727924 CTGGTGTTCTTCAGTACTATAGG + Intergenic
949949850 3:9220105-9220127 CTGGTGTTCAAAAGCACAATAGG + Intronic
951602939 3:24396966-24396988 TTGCTATTCTTAAGCACAATTGG + Intronic
952153902 3:30622233-30622255 CTGGTCATCTAAAGCAACATGGG - Intronic
953630822 3:44615313-44615335 CTGGTGTTCTGCAGCACTGTAGG + Intronic
956453564 3:69398464-69398486 CTGGTGTTCTATAGCACTGTAGG - Intronic
958439716 3:94141262-94141284 CTAGTGTTTTATAGCACCATAGG + Intergenic
960450462 3:117800621-117800643 CTGGTGTTTTTAATCCCCAAAGG - Intergenic
961080848 3:124026011-124026033 CTGGCATTCTTATGCATCATGGG + Intergenic
961953689 3:130777365-130777387 CTAGTGTTCTGTAGCACCGTAGG + Intergenic
962606435 3:137036223-137036245 CTGGGCTTCTTCAGCCCCATGGG + Intergenic
966293666 3:178391014-178391036 CTGGTGTTCATTAGCACAGTAGG + Intergenic
966572358 3:181459590-181459612 CTTGTTTTCTTAAGCAATATGGG - Intergenic
967560632 3:190914694-190914716 CTGGTGTTCTGTAGCACACTAGG - Intergenic
969432578 4:7164452-7164474 CTGGTGTTCTGCAGCACAGTAGG + Intergenic
970424146 4:15930900-15930922 ATGGGGTTCTTAAGGCCCATTGG + Intergenic
975177878 4:71308848-71308870 CTGGGGTTCCTAGGCACCACTGG - Intronic
977921718 4:102652167-102652189 CTGGTGTTCTATAGCACTTTGGG - Intronic
978434667 4:108670976-108670998 CTAGTGTTCTGTAGCACAATAGG - Intergenic
982269513 4:153572240-153572262 CTGGTGTTCTACAGCACTACAGG - Intronic
982753145 4:159187000-159187022 CTGGTGTTCTATAGCACTATAGG - Intronic
983289063 4:165778331-165778353 CTGGTGTTCTATAGTACTATAGG - Intergenic
983857052 4:172659441-172659463 CTAGTGTTCAGTAGCACCATAGG - Intronic
988230211 5:28466813-28466835 CTGGTGTTCTATAGCACAGTAGG + Intergenic
988247968 5:28713495-28713517 CTGGTGTTCTATAGCACAGTAGG + Intergenic
989167277 5:38444385-38444407 CTGGTGTTCCACAGCACTATAGG + Intronic
989210917 5:38858185-38858207 CTAGTGTTCTACAGCACCACAGG - Intronic
989211948 5:38865680-38865702 CTGATGTACATAAGCACCAGTGG + Intronic
989459187 5:41677610-41677632 GTGGTTTTCTTAAACACAATTGG - Intergenic
989998315 5:50862171-50862193 ATGATGTGCTTTAGCACCATAGG + Intergenic
991602161 5:68363965-68363987 CTGGGGTTCTGCTGCACCATAGG + Intergenic
995046087 5:107649971-107649993 CTCAAGTTCTTAAGCATCATGGG + Intronic
996450646 5:123619379-123619401 CTTGTGATCTTAATCATCATTGG - Intergenic
1000842104 5:166232942-166232964 CTGATGTTCTTTGGCAACATAGG + Intergenic
1002839694 6:895063-895085 CTAGTGTTCTGTGGCACCATAGG + Intergenic
1003028842 6:2582795-2582817 CTAGTGTTCTTCAGCACGGTAGG - Intergenic
1006083311 6:31579953-31579975 CTGGTGTTTTCAGGCACCACAGG + Intergenic
1009266814 6:61566312-61566334 CTAGTGTTCTGTAGCACAATAGG + Intergenic
1009833667 6:68970610-68970632 CTGCATTTCTTATGCACCATTGG + Intronic
1010111181 6:72235266-72235288 CTGGTGTTCTATAGCATTATAGG - Intronic
1010851016 6:80777862-80777884 CTAGTGTTCTGTAGCACTATTGG - Intergenic
1012444257 6:99292144-99292166 CAGGTGTTCTTAAGCATCACAGG - Intronic
1013550603 6:111204047-111204069 CTGGTGTTCTCAGGGAACATAGG + Intronic
1013763870 6:113551643-113551665 CTGGTGTTCTTTTGCACAGTAGG + Intergenic
1015002449 6:128234934-128234956 CTAGTGTTCAGTAGCACCATAGG + Intronic
1018016556 6:159717628-159717650 CTAGTGTTCTACAGCACCATTGG - Intronic
1018032745 6:159855594-159855616 CTGGTGTTCTGCAGCAGCATAGG - Intergenic
1020571046 7:9861877-9861899 CTAGTGTTCAGTAGCACCATAGG + Intergenic
1021548003 7:21837755-21837777 CTGGTGTTCTGTAGCACAGTAGG + Intronic
1023783072 7:43676586-43676608 CTAGTGTTCTAAAGCACAGTAGG + Intronic
1024808737 7:53182151-53182173 CTGGTCTTCTGAACCAACATAGG - Intergenic
1026372293 7:69713334-69713356 CTGGTGTTCTCTTGCACTATAGG - Intronic
1026745954 7:73013141-73013163 CTGGTGTTTTTGATCACGATGGG + Intergenic
1027090500 7:75296055-75296077 CTGGTGTTTTTGATCACGATGGG - Intergenic
1027094145 7:75323983-75324005 CTGGTGTTTTTGATCACGATGGG - Intergenic
1027097788 7:75351950-75351972 CTGGTGTTTTTGATCACGATGGG - Intergenic
1027307579 7:76917158-76917180 CTGGTGTTCCCAAGAAACATAGG + Intergenic
1028520692 7:91727185-91727207 CTAGTGTTCAAAAGCACAATAGG + Intronic
1029168288 7:98612307-98612329 CTGGTGTTCTACAGCACTGTAGG - Intergenic
1030775757 7:113532212-113532234 CTAGTGTTCTAAACCACTATAGG - Intergenic
1031086504 7:117306667-117306689 TTGGTGATATTAAGAACCATGGG - Intronic
1031441338 7:121798319-121798341 CTGTTGTGCTTAAGCACAATGGG + Intergenic
1032390971 7:131555337-131555359 CAGGTGTTCTTAAGCCCCTAGGG - Intronic
1033900142 7:146127615-146127637 CTGCTTTTCTTAAGCCACATGGG + Intronic
1034731609 7:153392035-153392057 CTTGTGTACTTAAGGAACATGGG + Intergenic
1036808037 8:11848478-11848500 GTGGTGTTTTTAAGTACCTTAGG - Intronic
1038645420 8:29357602-29357624 CTTGTGTTCTATAGCACCGTAGG - Intergenic
1038809321 8:30823871-30823893 CTGGTGTTCTGTAGCACAGTAGG - Intergenic
1039687280 8:39817408-39817430 CTAGTGTTCTATAGCACCATAGG + Intronic
1039843936 8:41312390-41312412 CTGGTGTTTTGAAGCAACAGAGG - Intergenic
1041244439 8:55877189-55877211 CTGTTGTTGCTAAGCACCAGAGG - Intergenic
1041479391 8:58300877-58300899 CTAGTGTTCCTAAGCACAAGAGG - Intergenic
1041488346 8:58404059-58404081 CTGGTGTTCCTAAGTACAAGAGG + Intergenic
1043687670 8:83107626-83107648 CTGGTGTTCTACAGCACTGTAGG + Intergenic
1047048487 8:121082025-121082047 CTAGTGTTCTATAGCACTATAGG - Intergenic
1047678670 8:127231011-127231033 CTGATGTTCTTTACCAGCATGGG - Intergenic
1047835545 8:128686508-128686530 ATGTTGTGCTTAAACACCATGGG - Intergenic
1050104794 9:2154524-2154546 TTGATGTTCTTAACCACGATGGG + Intronic
1051804424 9:20975987-20976009 CTGGTGTTCTAAAGCACTGTAGG + Intronic
1052206171 9:25843440-25843462 CCGGTGTTCTGAAGCATTATAGG + Intergenic
1052325751 9:27215272-27215294 AAGGTGTTCTTTAGCACCTTGGG + Intronic
1055928829 9:81538993-81539015 CAGGTATTCTCCAGCACCATGGG - Intergenic
1060082594 9:120665082-120665104 CTGATGTTCTGTAGCACAATAGG - Intronic
1060686808 9:125622203-125622225 CTGGTGTTCTGCAGCACTGTAGG + Intronic
1187440222 X:19311400-19311422 CTGGTGATCATAATCACCAGAGG + Intergenic
1189186708 X:39061184-39061206 CAGGTGTTCCTTGGCACCATGGG - Intergenic
1189761513 X:44326307-44326329 CTGGTGTTCTGTAGCACTGTAGG + Intronic
1189771814 X:44434599-44434621 CTAGTGTTCTGTAGCACCCTAGG - Intergenic
1190805374 X:53830925-53830947 CTAGTGTTCTATAGCACTATAGG - Intergenic
1192078135 X:68021068-68021090 CTCTGGTTCTTAAGCACCAGTGG + Intergenic
1193258465 X:79377945-79377967 CTAGTGTTCTATAGCACTATAGG - Intergenic
1194330576 X:92579571-92579593 CTTGTGTTTTTCAGCTCCATCGG + Intronic
1194816934 X:98454061-98454083 CTAGTGTTCTATAGCACTATAGG - Intergenic
1194925363 X:99817533-99817555 CTGGTGTTCTTTTGTACTATGGG - Intergenic
1195914053 X:109918386-109918408 CTGGTGTTCTACAGCACAGTGGG - Intergenic
1195944176 X:110191735-110191757 CTGGTGTTCTATAGCACTGTAGG - Intergenic
1196384715 X:115137111-115137133 CTAGTGTTCAGTAGCACCATAGG - Intronic
1197631969 X:128871592-128871614 CAGGTGTTCTTAAACATCTTGGG + Intergenic
1197841639 X:130753972-130753994 CTGGTGTTCTTCAGCAATGTAGG + Intronic
1198768541 X:140103751-140103773 ATGGTGTTCTGAAGGATCATCGG + Intergenic
1198835585 X:140801702-140801724 CTGGTGTTCTATAGCACTGTAGG - Intergenic
1199102738 X:143823454-143823476 CTGGTGTTCTTCAGAACTGTAGG + Intergenic
1199259740 X:145758313-145758335 CTGGTGTTCTATTGCACAATAGG + Intergenic
1200334850 X:155339737-155339759 CTGGTGTTCTATTGCACAATAGG - Intergenic
1200351616 X:155501484-155501506 CTGGTGTTCTATTGCACAATAGG + Intronic
1200639280 Y:5698641-5698663 CTTGTGTTTTTCAGCTCCATCGG + Intronic
1202299469 Y:23396487-23396509 CTGGTGTTCTATAGCACTAAAGG + Intergenic
1202571340 Y:26274111-26274133 CTGGTGTTCTATAGCACTAAAGG - Intergenic