ID: 944615395

View in Genome Browser
Species Human (GRCh38)
Location 2:201453798-201453820
Sequence GGAGTTTGCTGTGCTGCAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 190
Summary {0: 1, 1: 0, 2: 3, 3: 20, 4: 166}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944615395_944615398 5 Left 944615395 2:201453798-201453820 CCTTTTGCAGCACAGCAAACTCC 0: 1
1: 0
2: 3
3: 20
4: 166
Right 944615398 2:201453826-201453848 TTTAAATTGACGGTAATGAATGG 0: 1
1: 0
2: 0
3: 8
4: 150
944615395_944615399 9 Left 944615395 2:201453798-201453820 CCTTTTGCAGCACAGCAAACTCC 0: 1
1: 0
2: 3
3: 20
4: 166
Right 944615399 2:201453830-201453852 AATTGACGGTAATGAATGGTAGG 0: 1
1: 0
2: 0
3: 1
4: 71
944615395_944615396 -5 Left 944615395 2:201453798-201453820 CCTTTTGCAGCACAGCAAACTCC 0: 1
1: 0
2: 3
3: 20
4: 166
Right 944615396 2:201453816-201453838 ACTCCAGTGCTTTAAATTGACGG 0: 1
1: 0
2: 0
3: 7
4: 150
944615395_944615400 12 Left 944615395 2:201453798-201453820 CCTTTTGCAGCACAGCAAACTCC 0: 1
1: 0
2: 3
3: 20
4: 166
Right 944615400 2:201453833-201453855 TGACGGTAATGAATGGTAGGTGG 0: 1
1: 0
2: 0
3: 5
4: 88

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944615395 Original CRISPR GGAGTTTGCTGTGCTGCAAA AGG (reversed) Intronic
901300713 1:8198266-8198288 GGAGTTTTCTGAGAGGCAAACGG + Intergenic
902717864 1:18284937-18284959 GGAATTTGCTCTCCTGGAAATGG - Intronic
906776478 1:48534281-48534303 GGATTTTTCTTTCCTGCAAAGGG + Exonic
906824898 1:48968871-48968893 GGACTTTGATGTGCTCCAATTGG + Intronic
908288805 1:62640675-62640697 TGAGTTTGCTGTTGTACAAAGGG - Intronic
910356037 1:86356489-86356511 AGAGTCTGCAGTGCTGCAAGGGG - Exonic
911443188 1:97955573-97955595 GGAGTTTGTTCTGCTGCAGGAGG - Intergenic
912457957 1:109811442-109811464 GGAATCTGCTGTGCTGCAAGAGG - Intergenic
912506508 1:110160526-110160548 GGAGATTGCTGTTCAGAAAAGGG + Intronic
913262321 1:117010725-117010747 GGAGTTTGTTAAGCTGAAAAGGG - Intronic
914224190 1:145707005-145707027 GGGGTTTGATGTGCAGCCAAAGG - Intronic
915989711 1:160501860-160501882 GGAGTTTGTGGTGAAGCAAAGGG + Intronic
916504507 1:165415910-165415932 GGAGTTTCCTGAGGTGCCAAAGG - Intronic
916825056 1:168435140-168435162 GTAGGGGGCTGTGCTGCAAAGGG + Intergenic
920041638 1:203101611-203101633 GAAATTTGCTGTGGTGCAATTGG + Intronic
921560838 1:216656316-216656338 GAAGTGTGCTCTGCTGCAGAGGG + Intronic
922545866 1:226456302-226456324 GAGGTTTCCTGTGCTGCAGAAGG - Intergenic
922740280 1:228010548-228010570 GGAGCTTGCTGTGCTCCACTAGG - Intronic
1063256914 10:4338433-4338455 TGTTTTTCCTGTGCTGCAAAAGG - Intergenic
1063303885 10:4878708-4878730 AGAGGTTTCTGTGCTGCAGAAGG + Intergenic
1065121838 10:22538061-22538083 CCAGTTTCCTGAGCTGCAAAGGG + Intronic
1066382180 10:34911254-34911276 AGAGTGGGCTGTGCTGCAACTGG - Intergenic
1068776565 10:60873982-60874004 GGAGATTGCTCTGGTGCAAAAGG - Intronic
1068897875 10:62227612-62227634 GGAGTGAGATGTGCAGCAAATGG + Intronic
1071823094 10:89297673-89297695 AGAGTTTGTGGTGCTGCTAAGGG - Intronic
1073280083 10:102347552-102347574 GGAGTTTCCTGTGGTGGGAAAGG + Intronic
1076299315 10:129412779-129412801 GGAGTTTTGGGTGCAGCAAAAGG - Intergenic
1076441142 10:130482118-130482140 GGAGCTGGCTTTGCTCCAAAGGG + Intergenic
1077022360 11:423472-423494 GGAATTTGTTTTGCTGCAAGGGG - Intronic
1077096901 11:802847-802869 GGAGGTTGCTGTGCAGGACAAGG + Exonic
1081007048 11:37757536-37757558 GGAGTTTGGTGTGGTGTTAATGG - Intergenic
1083714724 11:64568689-64568711 GGTCTTTGCTGTGCTGGGAAAGG + Exonic
1083740983 11:64711681-64711703 GGAGATTGCTGGGCTGGACAGGG - Intronic
1084949218 11:72655383-72655405 GGAGAATGCTGGGCTGCAGAGGG - Intronic
1090947204 11:131441462-131441484 GGTTTTTGCTGTGCAGCATATGG - Intronic
1091359317 11:134962389-134962411 GGAATTTAATCTGCTGCAAATGG + Intergenic
1095082141 12:38015172-38015194 GGGGTTCACTGTGCTCCAAAAGG - Intergenic
1095756511 12:45772957-45772979 GGATTTTTCTGTAGTGCAAACGG + Intronic
1096017250 12:48288023-48288045 GGAGTTTGCTGTGTGGTATATGG - Intergenic
1096817642 12:54211354-54211376 GGAGTTTACTGTTATCCAAAGGG + Intergenic
1099953301 12:89327696-89327718 TAAGTTTGCAGTGCTGGAAATGG + Intergenic
1102951412 12:117033900-117033922 GAACTCTGCTGTGCTGGAAACGG - Intergenic
1103127126 12:118433377-118433399 GCTGTTTGCTTTGCTGCCAAAGG - Intergenic
1103572542 12:121854702-121854724 GAAGTTTGCTGTGCTGCAGACGG - Exonic
1104210212 12:126681770-126681792 AGAGATTGCTGAGCTGCAAAAGG - Intergenic
1104477890 12:129085177-129085199 GGAGCTGGCTGTGCTGCACCTGG + Intronic
1104656015 12:130574622-130574644 GAACTTTGATGTGCTGCAGATGG - Intronic
1105897343 13:24727360-24727382 GAAGTTTGCTGATCTACAAAAGG + Intergenic
1106999959 13:35531734-35531756 AGACTTTGATGTGCTGCAGAAGG + Intronic
1108586556 13:51875056-51875078 GGTCTTTGCTCTGCAGCAAAGGG - Intergenic
1108677375 13:52748878-52748900 GGAGCTTGCTGTCTTACAAAGGG - Intergenic
1112468129 13:99663092-99663114 GGAATATGCTGTGATGAAAACGG + Intronic
1113764030 13:112869735-112869757 GGAGGCTGCTGTGCTGTAACTGG - Intronic
1113776147 13:112946557-112946579 AGATTTTGCTGTGATGAAAATGG + Intronic
1113846186 13:113393198-113393220 TGGGTTTGCTGTGCTCCACAGGG - Intergenic
1117988508 14:61411653-61411675 GGAGTCTGCTGGGCTCCACATGG - Intronic
1118716218 14:68561857-68561879 GTAGTTTCCTCTGCTGGAAAAGG + Intronic
1118733056 14:68682812-68682834 GGAGTTTGCAGCCCTGGAAATGG + Intronic
1119638793 14:76298248-76298270 GGAGTTTGCTGGGGTGGAAGGGG - Intergenic
1119966842 14:78926021-78926043 GGAGTTTCCTCAGCTGTAAAAGG - Intronic
1120207148 14:81599184-81599206 AGAGGTAGCTGTGCTGCATAAGG + Intergenic
1121276155 14:92669342-92669364 GGAGTTTGCTGTCCTGGGACTGG + Intronic
1121333159 14:93060558-93060580 GGACCCTGCTCTGCTGCAAAAGG + Intronic
1122218202 14:100218267-100218289 GGGCTTTGCTGGGCTGCAACAGG - Intergenic
1128080378 15:64853701-64853723 GGAGTGTGCTGTGCTGGAAAGGG + Intronic
1129206892 15:74042575-74042597 TGAGTGTGCTGTGCTGCTTATGG - Intronic
1130615478 15:85402746-85402768 GGAGTTAGCTCTGCCGTAAATGG + Intronic
1130895636 15:88168587-88168609 GAAGGTTTCTGAGCTGCAAATGG + Intronic
1132911339 16:2314171-2314193 TGAGTGTGCTGTGCTGGACATGG - Intronic
1137264051 16:46854200-46854222 GGCTTTTGCTGGACTGCAAATGG - Intergenic
1137445331 16:48528058-48528080 TTAGTTTTCTGTGCTGCATAAGG + Intergenic
1142973042 17:3625729-3625751 GTAGTTTGTTGTGCCGCAATAGG + Intronic
1143335627 17:6169633-6169655 GGCGATTGCTCTTCTGCAAAGGG - Intergenic
1143379694 17:6488309-6488331 GGAGTTTGCCAGTCTGCAAAGGG - Intronic
1143500241 17:7334699-7334721 GGAGATTGCTCTGCAGCACAAGG + Intergenic
1143966043 17:10757125-10757147 GGAGTTTCCTATGCTGGGAAGGG + Intergenic
1144702827 17:17349944-17349966 GGAGCTTGCTGAGGTGGAAATGG + Intergenic
1147533629 17:41303074-41303096 GGAGTTTTCTGCGCTGCATTTGG + Intergenic
1150284991 17:63949472-63949494 GTAGTCAGCTGTGCTGCAGACGG + Exonic
1154086854 18:11313927-11313949 GGAGTTTGCTCTTCTCCATAGGG + Intergenic
1156513331 18:37659961-37659983 GGAGTGGGAAGTGCTGCAAAGGG + Intergenic
1157113731 18:44844156-44844178 GCTTTTTGATGTGCTGCAAAAGG + Intronic
1157563560 18:48664622-48664644 GGAGGCTGCTCTGCTGCACAGGG + Intronic
1157836726 18:50910602-50910624 GGAGTTTGCTGGGCTGGCAAAGG + Intronic
1158172908 18:54619349-54619371 GGATTTTTCTGTCCTGAAAAGGG + Intergenic
1161889524 19:7024520-7024542 GGAGTTTGCTGAGGTGCTGAGGG + Intergenic
1161891928 19:7046227-7046249 GGAGTTTGCTGAGGTGCTGAGGG - Intergenic
1163231059 19:16002548-16002570 TGAGTGTGCTGCGCTGTAAAGGG - Intergenic
1163293153 19:16393959-16393981 GTTGTCTGCTGTTCTGCAAAGGG + Exonic
1164750276 19:30648523-30648545 GGAAGTTGCTGTCCTGCAGAAGG - Intronic
1165318514 19:35072280-35072302 GGGGTTTGCTGTCCTACAGAGGG + Intergenic
1166002651 19:39887002-39887024 GGAGTCTGCAGAGCTGGAAAGGG + Intronic
1166005437 19:39903254-39903276 GGAGTCTGCAGAGCTGGAAAGGG + Intronic
1168253411 19:55154241-55154263 GGAGTTGGGTGTGCGGGAAATGG - Intronic
1168583424 19:57574266-57574288 GTAGTTTGCTTTGGGGCAAAGGG - Intronic
927517800 2:23682229-23682251 GGAGTGTGCAGTGCTGCTGATGG - Intronic
928097178 2:28411971-28411993 GGAGATTGCTGAGCTGCAGAAGG + Exonic
929920483 2:46167904-46167926 GGAGCCTGCTGTGCTGGAACAGG - Intronic
931055177 2:58461469-58461491 GGATTTTGCTCTGCTTCAAAAGG - Intergenic
931345321 2:61440439-61440461 GGAACTTGCTCTGCTGCAGAGGG + Intronic
936999954 2:118457017-118457039 GGGCTTTGCTGAGCTGCAATGGG + Intergenic
937122642 2:119451538-119451560 GGACTTTGCAGTGCTGCGAGTGG - Intronic
938577964 2:132621229-132621251 GGAATTGGCTGTGCTGAAAACGG + Intronic
940966001 2:159837793-159837815 GGAGTTTGCAGTGATACAAGGGG - Intronic
942611590 2:177747469-177747491 GGAGTTTGCTGTGGAGCATCTGG + Intronic
944615395 2:201453798-201453820 GGAGTTTGCTGTGCTGCAAAAGG - Intronic
945083967 2:206112699-206112721 GTAGTTTGTTGTGCAGCAATAGG + Intergenic
947774008 2:232693490-232693512 GGATCTTGCTGTGCTGCCCAGGG + Intergenic
948359923 2:237412866-237412888 GGAGTCTGCTGTGCTGGATGGGG - Intronic
948535839 2:238646136-238646158 GGGTTTTGCTGTGCAGCAATGGG - Intergenic
1170617352 20:17964835-17964857 TGAGTTTCTTGTGCTGCAGAGGG - Intronic
1179654515 21:42837164-42837186 GGTGCTGGCTGAGCTGCAAATGG - Intergenic
1180094932 21:45552046-45552068 GGAATTTGCTTTTCTACAAAAGG + Intergenic
1182447644 22:30398730-30398752 GGAGTTTGCTGGGGAGCAGAGGG - Intronic
1184007101 22:41718362-41718384 GAAGTTTGCTGTTTTGCAAAAGG + Intronic
950525365 3:13519852-13519874 TGAGTTTGCTGGGCTGCTCAAGG - Intergenic
951990343 3:28669648-28669670 GGAGCTTGGTGAGCTGCAAGTGG + Intergenic
952389223 3:32865527-32865549 GGCGTTTGCTGTGCTGCCCAGGG + Intronic
955914835 3:63896447-63896469 GCAGTTTGGTGTACTGGAAAGGG + Intronic
957129227 3:76201742-76201764 GAAGTTTGCTGGGCTGCACAGGG + Intronic
958042050 3:88238459-88238481 TGACTTTGGTCTGCTGCAAATGG + Intergenic
958919507 3:100088182-100088204 GGAGCTTGCTGGGATGGAAAAGG + Intronic
963861327 3:150313468-150313490 GGAGTTTTATGTGCTCCAAGAGG - Intergenic
965406428 3:168274912-168274934 TGAGATTGCAGTGCTGGAAATGG + Intergenic
966268187 3:178071904-178071926 GGAGTGTACAGTGCAGCAAAGGG - Intergenic
967137153 3:186522064-186522086 GGAGCATGATGTGCTGGAAAGGG - Intergenic
969133700 4:5012434-5012456 GGAGCTTGTTGAGCTGAAAAGGG - Intergenic
969155225 4:5204287-5204309 GGACTGTGCTGGGCTGCAGATGG + Intronic
971264220 4:25083928-25083950 TGAGTTTTCTGGGCTGCAGAAGG + Intergenic
975651662 4:76599369-76599391 GGATTTTGCTGTGCTTGAATGGG - Intronic
975803800 4:78091454-78091476 GGAACTTACTGTGCTGTAAAAGG + Intronic
976164518 4:82240070-82240092 GCACATTGCTGTGCTGCAAATGG - Intergenic
982062596 4:151619850-151619872 GGAGTTTTCTGTAATGTAAAGGG - Intronic
982438631 4:155407036-155407058 TGATATTGCTATGCTGCAAAGGG + Intergenic
984396212 4:179203058-179203080 GGATATTGCTGTGCTGCACAGGG - Intergenic
984659151 4:182354132-182354154 GCAGTTTGCTATGCTTCACATGG + Intronic
986135804 5:4976625-4976647 GGCCTTTGCTGTTCTGCAAAGGG - Intergenic
986766908 5:10936475-10936497 GGAATTTGCTGAGCTGCGATGGG + Intergenic
987619375 5:20320669-20320691 GAAGTTTGCTGTATAGCAAAGGG + Intronic
992493929 5:77272824-77272846 GGAGGTTTCTGTGCTGGGAAGGG + Intronic
994217223 5:97151404-97151426 TGTGTTTGCTGTGCTGTAATTGG - Intronic
995263764 5:110135692-110135714 TGAGTTTGCTGTGCTGCAGTGGG + Intergenic
995555429 5:113323318-113323340 GTAATTTGCTGTGCTGTAATAGG + Intronic
996333429 5:122356972-122356994 GGAATTTACTGTGATGCACAGGG - Intronic
997728507 5:136143874-136143896 GGAATTAACTGTGTTGCAAATGG - Intronic
998264093 5:140654031-140654053 GGATTTTGCTCTGCTTCAAAAGG + Exonic
999216209 5:149937568-149937590 GGATTTTGCTGTGTTGCCCAGGG + Intronic
999349114 5:150850129-150850151 AGAGTTTTCTGTGCTGCTGAAGG + Intronic
999910115 5:156188498-156188520 GGAGTTTCCTGTGTTGCAAAAGG + Intronic
1000620812 5:163484507-163484529 GGAGTTTGCAGTTTTGCAAATGG - Intronic
1001131473 5:169067586-169067608 GGAGGTTTATGAGCTGCAAAAGG - Intronic
1005969871 6:30752498-30752520 GGGGTTTGGTGGGCTGCCAAGGG + Intergenic
1006940569 6:37749268-37749290 GGTGTTGGCTGTGGTGCAAAGGG - Intergenic
1007370758 6:41425718-41425740 GGAGTGTGCTGTCCTGCCCAGGG + Intergenic
1012032436 6:94088747-94088769 GGAAATTGGTGTGCTACAAATGG - Intergenic
1012127916 6:95453984-95454006 TGGCTTTGCTGTGCTGCAATGGG + Intergenic
1013859839 6:114622609-114622631 GGGGCTTGCTGTGCTGCATAGGG + Intergenic
1014392866 6:120885592-120885614 AGAGTTTGTTGTGTTGGAAAGGG + Intergenic
1017130167 6:151101669-151101691 GGAGTATGGTGTTCGGCAAAAGG + Exonic
1017329920 6:153184773-153184795 GGAGTTTGTTGTACTGGAAGGGG - Intergenic
1019116908 6:169772343-169772365 GGAGTGTGCTGGGCAGAAAACGG - Intronic
1020368804 7:7410962-7410984 GCAATTTTCTGTGCTGTAAAAGG + Intronic
1021424511 7:20484811-20484833 TGAGTTTTCTGTGCAGCAATGGG - Intergenic
1021461692 7:20894562-20894584 GTAGTTTGTTATGCAGCAAAGGG + Intergenic
1022515378 7:30971893-30971915 GGATTCTGGTGTGCTGCAACTGG - Intronic
1028145385 7:87314932-87314954 GTAGTTTGTTATGCAGCAAAAGG + Intergenic
1029199789 7:98831233-98831255 GGAATTTGCTGGCCTGAAAAGGG + Intergenic
1030712482 7:112766716-112766738 AGAGTTTGCAGTTCTTCAAATGG + Exonic
1032519478 7:132533151-132533173 GGGGTTTCCTTAGCTGCAAAGGG - Intronic
1034776372 7:153830680-153830702 GGAGTGTGCTGTGTTACACATGG + Intergenic
1035049911 7:155992719-155992741 GGGGTTTCCTGTGATGCACATGG + Intergenic
1035324069 7:158053375-158053397 GGAGTTCGCTGTGCTGTGAGAGG - Intronic
1036781317 8:11649874-11649896 GGAGTTTGATGGGCAGGAAAGGG + Intergenic
1038356547 8:26834600-26834622 GGAGATTGCTGTGCTCTACAAGG - Intronic
1038730547 8:30122881-30122903 GTGGTTTGCTATGCTGCAATAGG - Intronic
1039399742 8:37259723-37259745 TCAGTTTGCTGAGTTGCAAATGG + Intergenic
1040006786 8:42627887-42627909 GGTCTCTTCTGTGCTGCAAAGGG - Intergenic
1041171857 8:55150606-55150628 GGAGTTTGCTGAGCAGAAAAAGG - Intronic
1041571370 8:59340697-59340719 AGAGTTTAATCTGCTGCAAATGG - Intergenic
1045154684 8:99454360-99454382 GGGTCTTGCTGTGTTGCAAAGGG + Intronic
1045574644 8:103407200-103407222 GGAGTTGGCTGTTTTTCAAATGG + Intronic
1051530643 9:18099301-18099323 TGTTTTTGCTTTGCTGCAAATGG + Intergenic
1053053569 9:34980365-34980387 GAAGTTTGCTGTTCTGGAATAGG - Exonic
1055322397 9:75095502-75095524 AGAGTTTGCTGGGCAGCAAAGGG + Intronic
1056577250 9:87865687-87865709 TGATTTTGCAGTTCTGCAAAAGG + Intergenic
1058151598 9:101469514-101469536 GAAGCTTGCTGATCTGCAAATGG - Intergenic
1060784657 9:126441108-126441130 TAAGTTTTCTGTGCTCCAAACGG - Intronic
1187122329 X:16421501-16421523 GGAGTTTGATTTGATGCAAGAGG - Intergenic
1190291691 X:48997267-48997289 TTAGTGTGCTGTTCTGCAAACGG + Exonic
1197974428 X:132151490-132151512 GGAGTTTGATGTTCTTCAGAAGG - Intergenic