ID: 944616595

View in Genome Browser
Species Human (GRCh38)
Location 2:201466189-201466211
Sequence TCCCTTTGGGTGAGGCAGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 247
Summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 221}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944616591_944616595 3 Left 944616591 2:201466163-201466185 CCAGTCTGAGTTTTAATTTAAGT 0: 1
1: 1
2: 0
3: 21
4: 290
Right 944616595 2:201466189-201466211 TCCCTTTGGGTGAGGCAGAAAGG 0: 1
1: 0
2: 2
3: 23
4: 221
944616586_944616595 14 Left 944616586 2:201466152-201466174 CCACCTCCCTCCCAGTCTGAGTT 0: 1
1: 0
2: 2
3: 47
4: 662
Right 944616595 2:201466189-201466211 TCCCTTTGGGTGAGGCAGAAAGG 0: 1
1: 0
2: 2
3: 23
4: 221
944616588_944616595 8 Left 944616588 2:201466158-201466180 CCCTCCCAGTCTGAGTTTTAATT 0: 1
1: 0
2: 2
3: 31
4: 340
Right 944616595 2:201466189-201466211 TCCCTTTGGGTGAGGCAGAAAGG 0: 1
1: 0
2: 2
3: 23
4: 221
944616587_944616595 11 Left 944616587 2:201466155-201466177 CCTCCCTCCCAGTCTGAGTTTTA 0: 1
1: 0
2: 0
3: 23
4: 275
Right 944616595 2:201466189-201466211 TCCCTTTGGGTGAGGCAGAAAGG 0: 1
1: 0
2: 2
3: 23
4: 221
944616590_944616595 4 Left 944616590 2:201466162-201466184 CCCAGTCTGAGTTTTAATTTAAG 0: 1
1: 1
2: 0
3: 30
4: 318
Right 944616595 2:201466189-201466211 TCCCTTTGGGTGAGGCAGAAAGG 0: 1
1: 0
2: 2
3: 23
4: 221
944616589_944616595 7 Left 944616589 2:201466159-201466181 CCTCCCAGTCTGAGTTTTAATTT 0: 1
1: 0
2: 0
3: 27
4: 309
Right 944616595 2:201466189-201466211 TCCCTTTGGGTGAGGCAGAAAGG 0: 1
1: 0
2: 2
3: 23
4: 221
944616585_944616595 24 Left 944616585 2:201466142-201466164 CCATCTTTATCCACCTCCCTCCC 0: 1
1: 1
2: 21
3: 152
4: 1632
Right 944616595 2:201466189-201466211 TCCCTTTGGGTGAGGCAGAAAGG 0: 1
1: 0
2: 2
3: 23
4: 221

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944616595 Original CRISPR TCCCTTTGGGTGAGGCAGAA AGG Intronic
901365259 1:8742301-8742323 TCCCTTTGGGAGTGTCAGAGAGG - Intronic
901827142 1:11869677-11869699 TCTCTTTGGGTTGGGGAGAAGGG + Intergenic
905876924 1:41437611-41437633 AGCCTTTGGGTGGGGCAGAGGGG - Intergenic
906588817 1:47004406-47004428 TTCCTTTGTATGAAGCAGAAAGG - Intergenic
907319531 1:53593974-53593996 TCCCTGTGGTTGAGGAGGAAAGG - Intronic
907390007 1:54151971-54151993 TCCCTGAGGGTGAAGCAGAAGGG + Intronic
909597655 1:77423958-77423980 TCCCTTTGGGTGGGACAGGATGG - Intronic
913016667 1:114743646-114743668 TCCCTTTGGGTGAGAAAAAGAGG - Intronic
915361760 1:155290194-155290216 TCCCTTGGGGTGGGGGAGAGGGG - Intronic
915559724 1:156679563-156679585 CCCCTTTGGGTGAGGGTGAGGGG - Intergenic
915581192 1:156814292-156814314 TCCCTGTGGGTGACGGAGAGAGG + Exonic
915785286 1:158605067-158605089 TCCTTTTGGGGAAAGCAGAAAGG - Intergenic
916015430 1:160745335-160745357 TCCCTTAGGGGGATGGAGAAGGG + Intronic
916884281 1:169052100-169052122 TCCTTTTGGTGGAGTCAGAAAGG - Intergenic
919992788 1:202720466-202720488 TCCCTGTGGGTGAGGGTGGAAGG - Intergenic
922003439 1:221504079-221504101 TGCCTTGGCGTGAAGCAGAAGGG - Intergenic
924071856 1:240288728-240288750 TCCCTTAGAGTGAGACAGAAAGG - Intronic
1063091912 10:2872927-2872949 CCCCTCTGAGTGAGGCAGGAAGG + Intergenic
1063120664 10:3103696-3103718 CCACTAGGGGTGAGGCAGAATGG - Intronic
1063240178 10:4161210-4161232 TGCCTGTGGGTCAGGCAGACGGG - Intergenic
1063832622 10:9972218-9972240 TTCCCTTAGGTGAGGTAGAAAGG - Intergenic
1064914619 10:20442306-20442328 TCACTCTGGGTGCTGCAGAATGG + Intergenic
1065256960 10:23879863-23879885 TCCCCTTAGGTGAGGAAGAAAGG + Intronic
1066024805 10:31345079-31345101 ACAATTTGGGAGAGGCAGAAGGG + Intronic
1067270680 10:44789058-44789080 TCCCTTCTGGTGAGACAGGAGGG - Intergenic
1069587082 10:69614251-69614273 TCCCCTTAGGTGAGACAGGAAGG - Intergenic
1070726528 10:78795319-78795341 TCCCTCTGGGAGAGGAGGAAGGG + Intergenic
1073065223 10:100754629-100754651 TCCCCTTGGGTCAGGCAGTGGGG + Intronic
1073205465 10:101767108-101767130 TCCATTTGGCTGAGGGAGGAAGG + Intergenic
1073338016 10:102725299-102725321 CCTCTTTAGGTGAGGCAGGAAGG + Intronic
1073829566 10:107366826-107366848 TCCCTTTGGGGAAGGTACAAAGG - Intergenic
1073829750 10:107368766-107368788 TCCCTTTGGGGAAGGTACAAAGG - Intergenic
1074977018 10:118589182-118589204 TCCCCTTCACTGAGGCAGAAGGG + Intergenic
1075300969 10:121323964-121323986 TCCCTTTGTGTTAGTCAGGAGGG - Intergenic
1075520649 10:123141758-123141780 TCTCTTTGGGTGATGCAGAAAGG - Intergenic
1076540420 10:131211028-131211050 TCCAGGTGGGTGAGACAGAAGGG - Intronic
1077887007 11:6394037-6394059 TCCTGGTGAGTGAGGCAGAAGGG + Exonic
1078732139 11:13984460-13984482 TCCCATGGGGAAAGGCAGAAGGG + Intronic
1078740838 11:14064856-14064878 TTCCTTAGGGTGAGGTAGAGGGG + Intronic
1080051761 11:27865298-27865320 TTCCTTTGGGTGGCGCTGAATGG + Intergenic
1082833697 11:57637909-57637931 CCGCCTTGGGTGAGGCTGAAAGG + Intergenic
1082883927 11:58064669-58064691 TTGCTGTGGCTGAGGCAGAAGGG - Intronic
1083607969 11:63990238-63990260 TCCGTTTGAGTGATGCAGCAGGG - Intronic
1083720027 11:64599454-64599476 TCCCTTTGGGTTTGGCTGATGGG - Intronic
1084218869 11:67665896-67665918 TCCCAGTGGGTGAGCCAGACCGG - Intronic
1085135386 11:74082683-74082705 TCCCTTTGGGGGAGGGACAGGGG - Intronic
1089203378 11:116739133-116739155 TACCTGTGGGTGATGCAGAGAGG - Intergenic
1090078579 11:123595038-123595060 CCCCTTTGGGTGTGGAAGAGAGG + Intronic
1091269068 11:134292985-134293007 GCCCTTTGGATGTGGCAGAGTGG + Intronic
1092806295 12:12226086-12226108 TCCCCTTAGGTGGGACAGAATGG - Intronic
1092916770 12:13196444-13196466 TCCTTTTTGGTGAGGAGGAATGG + Intergenic
1095792993 12:46187573-46187595 TCCCTTTAGGAGAGGGACAAGGG + Intronic
1098152162 12:67557908-67557930 TCCCTTGGGGAGAGGCAGCAAGG - Intergenic
1101410080 12:104460195-104460217 TCACCCTGGGAGAGGCAGAAGGG + Intronic
1104679089 12:130736935-130736957 TCCCCTTGGGTGAGACAGGGAGG + Intergenic
1105297069 13:19096942-19096964 TCCCTTTGGGTGAACCACATTGG - Intergenic
1106434576 13:29712419-29712441 TCCCTTTGGGAGAGCATGAATGG - Intergenic
1108763941 13:53603963-53603985 GCTCTTTGGGAGAAGCAGAAGGG - Intergenic
1112144146 13:96679381-96679403 TCTCTTGGGGTGAGGCAAACAGG - Intronic
1113056665 13:106275431-106275453 ACCTTTGGGGTGAGGCAGAGTGG - Intergenic
1113782647 13:112985539-112985561 GGCCTCTGGGTGAGGCAGCATGG + Intronic
1114740407 14:25091067-25091089 TCCATTTGGGAGATGGAGAATGG + Intergenic
1117929657 14:60827318-60827340 TATCTATGGGTGAGCCAGAAGGG + Intronic
1118806827 14:69245180-69245202 TCCCTTTGCTTGAGGAAGCAAGG + Intergenic
1119848161 14:77846378-77846400 TCCCTTTGGGTGACCCTGAGGGG + Intronic
1121135070 14:91489917-91489939 TCCCATTGGGTGATGCGTAAAGG - Intronic
1123796597 15:23778381-23778403 TTCCTTTAGGTGAAACAGAAGGG + Intergenic
1124444244 15:29714987-29715009 TCACCTTTGGTAAGGCAGAAGGG - Intronic
1124569124 15:30844110-30844132 ACTCTTGGGGTGAGGCAGAAAGG + Intergenic
1128993352 15:72278720-72278742 TCCATTTGTGTGGGGTAGAAGGG - Intronic
1132648985 16:1012049-1012071 GCCCTCTGGGTGGGGCAGCAAGG - Intergenic
1132799255 16:1743595-1743617 TCCCTTCGTGTGTGGCAGGATGG + Intronic
1134821926 16:17253917-17253939 TCCCTCTTGGGGAGGCAGAAGGG - Intronic
1136355580 16:29743335-29743357 TCCCTTTAGGAGAGGCAGGCAGG - Exonic
1136579083 16:31141260-31141282 GTCCTTTGGGTGAGGCACAGTGG + Intronic
1139328575 16:66170314-66170336 TCCTTTTGGGAGAGGGAGGATGG - Intergenic
1139480084 16:67225979-67226001 TCCCTTGGGGTGAGTCGGGAAGG + Intronic
1139541519 16:67621177-67621199 TACCTTTGGGGGAGACTGAATGG - Intronic
1140199132 16:72880200-72880222 TCACTTTGGGTGGGGCAGGAGGG - Intronic
1140472807 16:75224685-75224707 GCCCTGTGGGAGAGGGAGAAGGG - Exonic
1140736184 16:77899877-77899899 GCCATTTGGGTGAGGCTGAAAGG - Intronic
1140743571 16:77962372-77962394 TCCCTTTGGTTGAAGCCAAAGGG - Intronic
1141551854 16:84811556-84811578 CCCATTTAGGTGAGGGAGAAGGG - Intergenic
1144951602 17:18997348-18997370 TCCCTGTGGATGAGGCAAGAGGG + Intronic
1145119516 17:20245143-20245165 TCTCGTTGGCTTAGGCAGAAAGG + Intronic
1145202151 17:20955952-20955974 TCTCGTTGGCTTAGGCAGAAAGG + Intergenic
1145959636 17:28879919-28879941 GCCCTTGGGGTCAGGGAGAAAGG + Exonic
1146125629 17:30229072-30229094 TCCCGATGGGTGAGGCAGGGAGG - Intronic
1147045991 17:37752579-37752601 TCCCTTAGTGTGAGGCTGAGTGG - Intergenic
1147302590 17:39541700-39541722 TCCCTTTGGTTAAGCCAGCAAGG + Intronic
1149673216 17:58434198-58434220 TCCCTTTGGGCCAGGCACAGTGG - Intronic
1150136396 17:62697616-62697638 TCCCTGAGGGAGATGCAGAAGGG - Intergenic
1151392724 17:73798523-73798545 TCCCTTTGGGGTAGGAAGAATGG - Intergenic
1152595126 17:81234160-81234182 TCCCATTGGCTGTGACAGAAGGG - Intronic
1155228988 18:23755798-23755820 TCCCTAGGGGTGGGGCAGAGTGG + Intronic
1159047608 18:63384171-63384193 TCCCTTCGGGGAAGGCCGAAAGG + Intergenic
1159426274 18:68291459-68291481 TTCGTGTGGGTGAGGCAAAAGGG + Intergenic
1161196028 19:2987246-2987268 TCCCTGAGGGTGAGGGGGAAGGG + Intronic
1161889732 19:7026146-7026168 TGCCTTTGTGGGAGGCAGGATGG - Intergenic
1161891720 19:7044600-7044622 TGCCTTTGTGGGAGGCAGGATGG + Intergenic
1163036526 19:14572250-14572272 TCCATCTGGGCGGGGCAGAAGGG + Intergenic
1166831924 19:45644500-45644522 CCTCTCTGGGTGGGGCAGAAGGG - Intronic
1166967228 19:46536406-46536428 TGGCTGTGGGTCAGGCAGAAGGG + Intronic
1168262209 19:55202094-55202116 TCCGTGTGGGTGGGGAAGAATGG - Exonic
926933120 2:18060574-18060596 TACCTATGGGTGAAGGAGAAAGG - Intronic
927753847 2:25693066-25693088 TTGCTTTGGCTGAGGGAGAATGG + Intergenic
927933863 2:27063789-27063811 TCCCCTTGAATGAGTCAGAATGG - Intronic
928259183 2:29751194-29751216 TTGCTTTGGGTGAGTCAGTAAGG + Intronic
928713666 2:34035557-34035579 TTTCTTTGGATGTGGCAGAATGG + Intergenic
929609184 2:43257280-43257302 TCCCACTGGGAGAGGCAGAGAGG + Intronic
929995132 2:46821354-46821376 GCTCTTTGGATGGGGCAGAACGG - Intronic
931899633 2:66773066-66773088 TGCCTTTGAATAAGGCAGAAGGG + Intergenic
932401353 2:71482965-71482987 TGCCCTGGGGTGGGGCAGAAGGG + Intronic
933296506 2:80497225-80497247 TGCCATTGTGTGAGGCACAAGGG + Intronic
933557666 2:83850895-83850917 TCCCCTTGGGTGGGGGAGAGTGG + Intergenic
933780504 2:85797381-85797403 TCGCTCTGGGTGATGCAGATAGG - Intergenic
933791205 2:85885355-85885377 TCCCAGTGGGTCAGGCAGCAGGG - Intronic
934535126 2:95127135-95127157 TACCTTTGGGGAAGGCTGAAAGG + Intronic
935763854 2:106345196-106345218 TTCTTTTGGGAGAGGCAAAAGGG - Intergenic
936089661 2:109492909-109492931 TCCCTGTGGGTGTGGCTGTAGGG - Intronic
936820241 2:116511092-116511114 TACCTGTGGGTGAAGCAGAGAGG + Intergenic
937325131 2:120985755-120985777 TCCCTCTGGGTTAGGTAGAGTGG - Intronic
937682678 2:124661036-124661058 TTGCTCTGGGTGAGGCAGAGAGG + Intronic
939296544 2:140273036-140273058 TCCCTTTATGTAAGGAAGAAAGG - Intronic
939480498 2:142741814-142741836 TCCCATAGGGTGAAGCAGATTGG - Intergenic
940285276 2:152027492-152027514 TCCCTTGGTGTGAGTCAGGAGGG - Intronic
941005299 2:160241370-160241392 CCCCTTTGGGTGAGAAGGAAAGG + Intronic
941181993 2:162270592-162270614 TCCCTTTGGGTGCCCCAGAATGG - Intronic
942871683 2:180742109-180742131 TCCCTTTGGGTCAGGCATGGTGG - Intergenic
942886075 2:180925747-180925769 TGCTTTTGGCTGAGACAGAATGG + Intergenic
944310274 2:198225371-198225393 TCAGTTTGGGTGAGTCAGGAGGG + Intronic
944616595 2:201466189-201466211 TCCCTTTGGGTGAGGCAGAAAGG + Intronic
945309466 2:208294644-208294666 TCCCCTTAGGTGAGACAGAATGG + Intronic
946900752 2:224369133-224369155 TCTCTTGGGGTGAAGCAGAGGGG + Intergenic
948724180 2:239921770-239921792 TCCCTCTGGGTGAGGCCTCACGG + Intronic
948831490 2:240600536-240600558 TTCCTGTGGGTGAGTCAGGAGGG - Intronic
1168771166 20:417816-417838 TCCCATGGGGTGCGGCAGAATGG + Exonic
1171014571 20:21528572-21528594 TCCCTCTGTGGCAGGCAGAATGG - Intergenic
1172093988 20:32451833-32451855 TCGCTATGGGTGAGACAGACGGG + Intronic
1174035969 20:47668481-47668503 TCCCTGTTGGTGTGGCAGGAAGG - Intronic
1175173199 20:57093915-57093937 TCCCTTTGAGTGGAGCAGGATGG + Intergenic
1175305507 20:57973212-57973234 CCCCTGTGGGGGTGGCAGAATGG + Intergenic
1177333072 21:19685918-19685940 TTCTCTTGGGTGAGACAGAAAGG + Intergenic
1177806391 21:25879071-25879093 TCCCCTTGGGCCAGGCAAAATGG + Intergenic
1178109772 21:29358133-29358155 CCCTTTTGGGTGGGGCAGGAAGG + Intronic
1178729788 21:35090740-35090762 ACCCTTTGGGTCAGGAAAAAGGG - Intronic
1182678727 22:32061477-32061499 TCCCTTTAGAGGAGGCACAAGGG + Intronic
1183311009 22:37109500-37109522 TACCTTTGGGAGCGGCAGATAGG + Intronic
1184399504 22:44265589-44265611 ACCCTTTCTGTGAGTCAGAAAGG - Intronic
1184431161 22:44442170-44442192 TCCCTATGGGTGAGGTAGGGTGG + Intergenic
1184858363 22:47158774-47158796 TGCCTCTGGCTGAGGCAGGATGG - Intronic
950906700 3:16545340-16545362 TTCATTTGGGTCAGCCAGAAGGG - Intergenic
952069063 3:29610907-29610929 TCCCTTAAGGAAAGGCAGAAAGG - Intronic
955628975 3:60951849-60951871 TCTCTTTGAGTGGGGCAGAAAGG + Intronic
956165140 3:66392720-66392742 TCCCTCTGGGTGAGCCAGGTAGG - Intronic
958875944 3:99617405-99617427 TCCCTATGAGTCAGGCAGGAAGG + Intergenic
960323498 3:116266158-116266180 TCCCCTTGTGTGGGGAAGAAAGG - Intronic
962064310 3:131963159-131963181 TCCCTTTGGCTGAGGGAGGGGGG - Intronic
967301337 3:188017123-188017145 TCACTTTGGTTGAGATAGAATGG + Intergenic
967794029 3:193578986-193579008 ACCCTGTGTGTAAGGCAGAAGGG + Intronic
969711271 4:8845581-8845603 TCACTTTGGGGGAAGCAGACAGG - Intergenic
970814587 4:20138874-20138896 TCCCTGGGGGAAAGGCAGAACGG + Intergenic
971241698 4:24895177-24895199 TACCTCTGGGTGAGGCAGGAGGG + Intronic
971481607 4:27119676-27119698 TCCCTCTGGGAGAGGCTGGAGGG - Intergenic
973864115 4:55094633-55094655 TCACTTTTGGGGAGACAGAATGG + Intronic
975552826 4:75630719-75630741 TCCCGCTGGGGAAGGCAGAAAGG - Intergenic
978942007 4:114448026-114448048 TCCCTGTAAGTGAGACAGAAAGG - Intergenic
981065960 4:140486082-140486104 TCCCTCAGAGTGAGGCAGGAAGG - Intronic
983813799 4:172097551-172097573 TCCCTTTAGGGAAGGAAGAAAGG - Intronic
985791675 5:1931476-1931498 TCCGTTTGGCTGAGTCAAAAAGG + Intergenic
985940769 5:3133996-3134018 TCCCCTTGGGTGAGATAGAATGG + Intergenic
988636298 5:32988343-32988365 TCTCATAGGGTGAGGCAGGAAGG + Intergenic
990202026 5:53386435-53386457 TCCCCTTGGGTGGGACAGGATGG - Intergenic
991666775 5:69007124-69007146 TCCCTTAGGGTAATGGAGAAAGG - Intergenic
995062886 5:107830813-107830835 TCCCTTTGGGAAAGGCACAGGGG - Intergenic
997625511 5:135328211-135328233 GCCCTTGGGGTGAGGCAGTGAGG + Intronic
1001129830 5:169054673-169054695 TCCCTGTAGGAGAGGCAGACGGG - Intronic
1003634518 6:7820482-7820504 TCCCTTTGGTGGGGACAGAAGGG - Intronic
1004552252 6:16659839-16659861 TCGATCTGGGAGAGGCAGAATGG + Intronic
1004784999 6:18958293-18958315 TCCCCTTTTCTGAGGCAGAATGG + Intergenic
1006025628 6:31145060-31145082 TCCTTTTAGGGGAGGCAGAGCGG - Exonic
1006294697 6:33164963-33164985 TCCTGTTGGGTGAGGGAGAGGGG + Exonic
1006456079 6:34132856-34132878 TCCCTTAGAGTGAGGAAAAAAGG + Intronic
1006471154 6:34229586-34229608 TCCCTTTGGTTGGGGCAGACTGG - Intergenic
1007585985 6:42989765-42989787 TCCCAGGGGGTGAGGCAGAAGGG + Intronic
1008060023 6:46987091-46987113 TACATTTGGGGGAGGCAGAGTGG + Intergenic
1010908887 6:81528503-81528525 TCCCTTTGGTTGACTCATAAGGG + Intronic
1012359628 6:98361054-98361076 CCCCTTTGAGTGAAGCAGAGTGG + Intergenic
1013144968 6:107380384-107380406 TCCCTTTATGTTAGACAGAAAGG + Intronic
1014971269 6:127818191-127818213 CCCCTTTGGGAGAGATAGAATGG - Intronic
1016427505 6:143950095-143950117 TCCAAGTGGGTGAGGCAGGATGG - Intronic
1018924816 6:168198682-168198704 GCCCTGGGGGTGAGGGAGAAGGG - Intergenic
1021899054 7:25264840-25264862 TTCCTTTGGGAGAGGAAGAGGGG + Intergenic
1021953192 7:25796233-25796255 TGCCTTTGGGTGAGGCATGATGG - Intergenic
1022577672 7:31513983-31514005 TCCCTTTGGATGAGGAAAACAGG + Intergenic
1023564163 7:41507102-41507124 TCCCTTTGGGTTAGGCTTCATGG - Intergenic
1024117142 7:46205396-46205418 GGCCTTTGAGTGAGACAGAAAGG - Intergenic
1028827380 7:95289260-95289282 TCCCTTTGGGAAAGGGAAAAAGG + Intronic
1028942481 7:96538755-96538777 CCCCTTTTGGTGAGACAGAAAGG + Intronic
1029369375 7:100138545-100138567 CCCCTTTGGGTGGGGCACGATGG + Intergenic
1030064819 7:105651583-105651605 TCCTTCTGGGTGAGGCAGTGAGG + Intronic
1031219353 7:118945535-118945557 TCCCTTTAAGTGATACAGAAGGG + Intergenic
1033915076 7:146314471-146314493 TTCCTTGGAGTAAGGCAGAATGG - Intronic
1034339484 7:150342297-150342319 AGCCTTCGGGTGTGGCAGAACGG + Intergenic
1034608586 7:152342936-152342958 TGCTTTTAGGTGGGGCAGAATGG - Intronic
1034680563 7:152924993-152925015 TCCCTTTGGCTGGGGGAAAACGG - Intergenic
1035120499 7:156562885-156562907 TCCTTTTGTGTGATGGAGAATGG + Intergenic
1035446691 7:158948014-158948036 TCCCTGGGGGTGAGGCTGAGGGG - Intronic
1035530168 8:345163-345185 TCCACCTGGGTGAGGCAGGAAGG - Intergenic
1035832704 8:2714919-2714941 GCCCCTTGTGTGAGACAGAAAGG + Intergenic
1036680319 8:10867673-10867695 TTCCTTGGGGTGACGCAGTAAGG + Intergenic
1038702809 8:29865038-29865060 TTCCTTTAGGTGAGGCAGGAAGG - Intergenic
1039086378 8:33783906-33783928 TCCCTTTAAGTGATGCAGAAGGG - Intergenic
1039110397 8:34035422-34035444 TACCTTTGAGTGAGACAGTAAGG + Intergenic
1041289221 8:56293021-56293043 TCCCCTTAGGTGAGACAGCAGGG + Intergenic
1041339406 8:56826459-56826481 TCCCCTTAGGTGAGGCAGAAAGG - Intergenic
1042514295 8:69643709-69643731 TCCCTGTGTGTGAAGCAGGAGGG + Intronic
1042556233 8:70035494-70035516 TCCCTTTTGGAAAGGCCGAATGG - Intergenic
1042778235 8:72459903-72459925 CCCCTTTAAGTGGGGCAGAATGG + Intergenic
1044008968 8:86968053-86968075 TCCCCTTAGGTGGGACAGAATGG + Intronic
1044280144 8:90345197-90345219 TCCATTTTGGTGAGGGTGAAAGG - Intergenic
1047731747 8:127734456-127734478 TGCCTTTGGGTGAGGGACCAAGG + Intergenic
1048306818 8:133290199-133290221 TCCCACAGGGTGAGGCTGAAGGG + Intronic
1048385423 8:133908069-133908091 TCCCATTGTGGAAGGCAGAAGGG + Intergenic
1049202242 8:141346020-141346042 GCCCCTTGGGTCAGGCAGAGGGG - Intergenic
1050771751 9:9209952-9209974 TCCCATGGGGTGATGCAGAAGGG + Intronic
1055020137 9:71660568-71660590 TCCCCTTGGGTGGGACAGGACGG - Intergenic
1055272120 9:74572858-74572880 TCCCTTCGTGTGTGGCACAAAGG + Intronic
1056392295 9:86151431-86151453 TCCCTTTGACTTAGGCAGATGGG + Intergenic
1056570913 9:87814030-87814052 TCATTTTGGCTGAAGCAGAAAGG - Intergenic
1056725141 9:89107692-89107714 TGCATTTGGGTGGTGCAGAATGG - Intronic
1057420326 9:94907054-94907076 TCCCTTCGGGTGAGAAACAAAGG - Intronic
1058104861 9:100958023-100958045 TCTCTTTTGGTGGAGCAGAATGG + Intergenic
1058536254 9:105963356-105963378 TCCCTTTGGTAGAGGCAATATGG - Intergenic
1062361642 9:136191034-136191056 TCCCAGTGGGAGAGGCAGACGGG - Intergenic
1185632818 X:1527954-1527976 TCCCTGTGGCTGAGACTGAAGGG + Intronic
1186530800 X:10293359-10293381 TGGCTTTGGGACAGGCAGAATGG + Intergenic
1187584291 X:20642926-20642948 TCCCTTTGGGTGAAAAACAAGGG - Intergenic
1187694991 X:21910636-21910658 GCACTTTGGGTGATGGAGAAAGG + Intergenic
1187954611 X:24504923-24504945 TCACATTGGGAGAGGAAGAACGG + Intronic
1188268397 X:28107450-28107472 TCCCTTGGGGTGAGGGTGAGGGG + Intergenic
1190292010 X:48999502-48999524 AGCCTTTGGGGGAGGCAGGAAGG + Exonic
1191004330 X:55694934-55694956 TCCCTTTAGGTGGGGCAAGATGG + Intergenic
1197707732 X:129646563-129646585 TTCCTTTGGGGGAGGCGGAGAGG - Exonic
1199199326 X:145068521-145068543 TCCCATTGAGAGAGACAGAAAGG - Intergenic
1200753986 Y:6972824-6972846 TCCCTGTGAGGGAGGCAGGATGG + Intronic
1202474472 Y:25244328-25244350 TCCCTTTGAGTTAGGCATATGGG + Intergenic