ID: 944617840

View in Genome Browser
Species Human (GRCh38)
Location 2:201481299-201481321
Sequence CTGGACCCCCTCAAGAATGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 171
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 146}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944617838_944617840 18 Left 944617838 2:201481258-201481280 CCATAGGCGATTTCAAGCACAAT 0: 1
1: 0
2: 0
3: 1
4: 49
Right 944617840 2:201481299-201481321 CTGGACCCCCTCAAGAATGAAGG 0: 1
1: 0
2: 1
3: 23
4: 146

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944617840 Original CRISPR CTGGACCCCCTCAAGAATGA AGG Intergenic
900758907 1:4457240-4457262 CTGGACCAGCTCAGGAATGAAGG - Intergenic
901385060 1:8902632-8902654 CAGGACCCTCTCTGGAATGAAGG - Intergenic
907983073 1:59503937-59503959 CAGGACCCTCTCTGGAATGAGGG - Intronic
909017966 1:70400004-70400026 CAGGACCCCCTCTGGAATGGGGG + Intergenic
909865933 1:80671501-80671523 CTGGCCACCCTAATGAATGAAGG + Intergenic
910613254 1:89167610-89167632 CTGGAGTCCCTCATTAATGATGG - Intronic
910900403 1:92114652-92114674 CCAGACCCCCTGAAGAAGGAGGG - Intronic
911771154 1:101744173-101744195 CAGGACCCTCTCCAGAGTGAGGG - Intergenic
917787855 1:178478236-178478258 CTGTACCCCCACAAAGATGATGG - Intronic
920244172 1:204575627-204575649 CTGAAGTCCCTGAAGAATGAGGG + Intergenic
923759942 1:236832948-236832970 CTGGACAGCAGCAAGAATGAGGG - Intronic
923974131 1:239240605-239240627 CAGGACCCCCTCTGGAATGGGGG + Intergenic
1064281287 10:13953849-13953871 AGGGACCCCCTCAAGGATAAGGG + Intronic
1068935460 10:62631536-62631558 CTGGAACCCTTCAAGAACTAGGG - Intronic
1069724963 10:70571583-70571605 CAGGACCCCCAGAAGATTGAGGG - Intergenic
1069938568 10:71937308-71937330 CTGCACCACCTCAAGACTGAAGG + Intergenic
1071293175 10:84201764-84201786 CTGGACCTCAGCAAGAATGCAGG - Intronic
1072154846 10:92715027-92715049 CTGGCCACCCTCAAGAGTGAGGG + Intergenic
1074768731 10:116719427-116719449 ATGGACCCCCTCAAGGACGGAGG - Intronic
1075639675 10:124055900-124055922 CCGGAACCCCTCAACAATGATGG + Intronic
1077635544 11:3839408-3839430 CTGGGCCCTCTCAAGGCTGAGGG + Intronic
1077935650 11:6783031-6783053 CCTGACCCCAGCAAGAATGAAGG + Intergenic
1079574607 11:21987805-21987827 CTGGACCCCTGGAAGCATGAGGG - Intergenic
1080695393 11:34599413-34599435 GGGGACCACCTCAAGACTGAAGG - Intergenic
1082196751 11:49315886-49315908 CTGGGCCACCTCAAGAGTGAAGG - Intergenic
1086152446 11:83626902-83626924 CTGGACCCCATGAAGCCTGAAGG - Intronic
1086524974 11:87714428-87714450 CAGGACCCTCTCTAGAATGGGGG + Intergenic
1086659078 11:89392313-89392335 CTGGGCCACCTCAAGAGTGAAGG + Intronic
1088538862 11:110891903-110891925 CTGGACCTGCTGAAGAAGGAAGG - Intergenic
1093926535 12:24913800-24913822 CTGGACCCTCTCTGGAATGGGGG + Intronic
1095990138 12:48028889-48028911 CTGCCTGCCCTCAAGAATGAGGG + Intergenic
1096255336 12:50058748-50058770 CAGGATCCCCTCAACAAGGATGG + Exonic
1100044114 12:90357494-90357516 CAGGACCCTCTCTGGAATGAAGG - Intergenic
1100950812 12:99847469-99847491 CAGGACTCCTTCTAGAATGAGGG - Intronic
1101784465 12:107871001-107871023 CTGGACCACATCTGGAATGAAGG - Intergenic
1102508477 12:113398732-113398754 ATTGAGCGCCTCAAGAATGAAGG - Exonic
1106415048 13:29539474-29539496 CTGAACCCCCTTCAAAATGAAGG + Intronic
1107122180 13:36807955-36807977 CTGGACCCCATCAATAATAACGG + Intergenic
1110571875 13:77013317-77013339 CTGGACCCCGGCAAGAAGGAGGG - Intronic
1110605085 13:77422820-77422842 CAGGACCCTCTCTAGAATGGGGG - Intergenic
1111363360 13:87207117-87207139 CCAGACCCCCTCAGGAATGAGGG - Intergenic
1113612731 13:111659047-111659069 CTGGCGCCCCTCAGTAATGAAGG - Intronic
1113787665 13:113011013-113011035 TTGAACCCACTCAAGAATGATGG - Intronic
1114227193 14:20749625-20749647 CTGGACCCCTTCACAAATGCAGG + Intergenic
1115155891 14:30338595-30338617 CTGGACAGCATCAAGAATAAAGG - Intergenic
1115193271 14:30769718-30769740 CTGGAGCCCCTCTAGAAAGAGGG - Intergenic
1115648236 14:35384883-35384905 CTGGAGCCCCTCAAGAACACAGG - Intergenic
1116326689 14:43539315-43539337 CGGGACCCCTTCCAGAGTGAAGG + Intergenic
1118719363 14:68583375-68583397 CTGGACCCCCAAAAGTATGTGGG - Intronic
1118955088 14:70473623-70473645 TAGGACCCCCTCTGGAATGAGGG + Intergenic
1123415235 15:20090353-20090375 CTGGCCCCGCTCCAGAAGGAGGG - Intergenic
1123524577 15:21097467-21097489 CTGGCCCCGCTCCAGAAGGAGGG - Intergenic
1125887581 15:43240207-43240229 CAGAACCCTCTCTAGAATGAGGG - Intronic
1130044573 15:80433979-80434001 CAGGACCCTCTCTGGAATGAGGG + Intronic
1132285025 15:100656680-100656702 CAGGAGCCCCTCAAAGATGAGGG + Intergenic
1132511967 16:347512-347534 CTGGACCCTCACAAGTAAGATGG + Intronic
1133104304 16:3496586-3496608 CTGGACTCCCTCAAGGACGGCGG + Intergenic
1135041151 16:19117730-19117752 GTGGATCCCCTAAAGAAAGAAGG - Exonic
1135069613 16:19340488-19340510 CAGGACCCACTCTGGAATGAAGG - Intergenic
1139987032 16:70907186-70907208 CTGGACACCCAGAGGAATGAGGG - Intronic
1140326900 16:74013228-74013250 CTCAAACCCCTCAGGAATGAAGG - Intergenic
1142906321 17:3044655-3044677 CTGGACTCCCTCTTAAATGAGGG - Intergenic
1143161849 17:4877109-4877131 CTGCACCTCCTGCAGAATGATGG - Intronic
1144258903 17:13498579-13498601 CAGGACCCTCTCAGGAATGAAGG - Intronic
1146401202 17:32501403-32501425 CAGGACCCCCTCGGGAATGAGGG - Intronic
1146550000 17:33772215-33772237 CAGGACCCTCTCTGGAATGAGGG - Intronic
1146949549 17:36896431-36896453 CAGGACCCCTTCTGGAATGAGGG + Intergenic
1148793152 17:50184874-50184896 CATGACCCCCTCAAAAACGAAGG + Exonic
1149173658 17:53843895-53843917 CTGGAGCCCTTCAAGAAACAAGG + Intergenic
1152206026 17:78974788-78974810 CTGGACCTCATCCAGCATGATGG + Exonic
1154065669 18:11104818-11104840 CTGGACCATATCAAGCATGATGG - Intronic
1154282152 18:13013663-13013685 CTGGACCACCTGAAGTATAAAGG + Intronic
1158220620 18:55146729-55146751 CTTGACACCCTCCAGAATGCAGG - Intergenic
1160015291 18:75135451-75135473 CTGGAACCCCTCAGGAGTCAGGG + Intergenic
1160586547 18:79916435-79916457 CAGGACCCTCTCTGGAATGAGGG - Intronic
1166348604 19:42182695-42182717 CTGGGCCCCTTCTAGGATGATGG - Intronic
1167583297 19:50359044-50359066 CCAGACCCCCCCAAGAAGGAAGG + Exonic
1168694609 19:58397280-58397302 CTGGACAGCCACAAGAATGGGGG - Intergenic
940427012 2:153541646-153541668 CAGGACACCCTCTGGAATGAAGG - Intergenic
943187403 2:184629288-184629310 CTGCACCCCCTAAGGAATGCAGG - Intronic
943528433 2:189048256-189048278 CTGGACCCTATAAAGAATAATGG + Exonic
944617840 2:201481299-201481321 CTGGACCCCCTCAAGAATGAAGG + Intergenic
944755417 2:202756618-202756640 CTGTACCCCATCAAGCAGGATGG - Intronic
945133115 2:206596132-206596154 CTTCACCCCCCCAAGGATGAAGG + Exonic
945148202 2:206760644-206760666 CTGCACCCCCTGAAGAATCCAGG - Intronic
946743796 2:222826299-222826321 CAGGACCCTCTCTGGAATGAGGG + Intergenic
1169206222 20:3741746-3741768 CTGGACTCCCCTAAGAATAAGGG - Intronic
1169293627 20:4374085-4374107 CAGGACCCTCTCTGGAATGAGGG - Intergenic
1174002188 20:47382970-47382992 CCGGACCCCCTCTGGAATGAGGG + Intergenic
1177374664 21:20253967-20253989 CAGGACCCCCTCTGGAATGAAGG + Intergenic
1178856849 21:36257456-36257478 CAGGACCCTCTCCAGAATGAGGG + Intronic
1178893387 21:36539050-36539072 CTGACCCCACTCCAGAATGATGG + Intronic
1179618501 21:42597045-42597067 TAGGACCCCCTCTGGAATGAGGG + Intergenic
1182544856 22:31069151-31069173 CTGGCCCCGCTCCAGAAGGAGGG + Intronic
1182765851 22:32757829-32757851 CCAGACCCCCTCAGGAATGAAGG + Intronic
1183787740 22:40040508-40040530 CTGGACCCCCTCATGTGTGCTGG - Exonic
949609936 3:5693588-5693610 CACGACCCCCTCCAGAATCATGG - Intergenic
950423206 3:12910678-12910700 CTGGTCCCACTGAAGACTGAAGG + Intronic
952259153 3:31722766-31722788 CTGGAAACCCCCAGGAATGACGG - Intronic
953419025 3:42740385-42740407 CAGGAAACCCTCGAGAATGAAGG - Intronic
955085840 3:55701939-55701961 AGGGACTCGCTCAAGAATGAAGG + Intronic
956142063 3:66156068-66156090 CTGGAGCCCCTGAACAGTGAGGG - Intronic
956738418 3:72256469-72256491 CTGGACCCTCTCAAGCAGGATGG + Intergenic
958124928 3:89343538-89343560 CAGGGGCCCCTCAAGAAAGACGG - Intronic
961992178 3:131203964-131203986 CAGGACCCTCTCTAGAATGAAGG - Intronic
962405112 3:135093913-135093935 CATGACCCCATCAAGAAAGATGG - Intronic
962922764 3:139965730-139965752 CTGGGCCCCTGCAAGAAGGAGGG - Intronic
964489668 3:157222442-157222464 CTGGAACTCCTCGAGAATAAAGG - Intergenic
965678991 3:171230966-171230988 AGGGACTCCCTCAGGAATGAGGG - Intronic
968512171 4:1000598-1000620 GTGGACCCCCTGCAGAAGGACGG - Exonic
970697687 4:18697087-18697109 CAGGACCCTCTCTAGAATGGGGG + Intergenic
973816915 4:54627497-54627519 CAGGACCCTCTTTAGAATGAGGG + Intergenic
978343081 4:107738102-107738124 CTGGACCGGCTCACAAATGATGG + Intergenic
978567512 4:110099762-110099784 CTGGACCCAATCTAGAAGGATGG + Intronic
979968383 4:127105125-127105147 CTGGACAACCTCAGGAATCAGGG - Intergenic
981295216 4:143123854-143123876 CTCAAACCCCTCAGGAATGAGGG + Intergenic
981514108 4:145588338-145588360 CTGGCCAGCCTAAAGAATGAGGG + Intergenic
982084429 4:151819411-151819433 CTGGACCCTCTCTAGAATGAGGG - Intergenic
982606794 4:157525986-157526008 GTGGAGCCCTTCAAGAAGGAAGG + Intergenic
982719950 4:158849076-158849098 CTGGACCCCTTCTGGAATTAAGG + Intronic
984239448 4:177200018-177200040 CTGCACCCTCTCAAGAGTGCTGG - Intergenic
984876002 4:184368130-184368152 CTGGACCCCTTCAATCATGTAGG + Intergenic
985019127 4:185669110-185669132 CTGGAGCTCCTGAGGAATGAAGG + Intronic
985122856 4:186661310-186661332 CGGGACCCTCTCTGGAATGAGGG - Intronic
985701373 5:1375163-1375185 CTGCACCCCCTTAAGATTAAGGG + Intergenic
986468808 5:8053211-8053233 CAGGTCCTCATCAAGAATGAGGG + Intergenic
994244579 5:97465761-97465783 CTGGAGCCCTTCAAGAATCAAGG + Intergenic
995440428 5:112185952-112185974 CTGGACACCCCCAGGACTGAGGG + Intronic
995494051 5:112723011-112723033 CAGGACCCTCTCTGGAATGAGGG + Intronic
997960393 5:138316340-138316362 CTTGACCCCCTCTAGAATTTGGG + Intronic
998512899 5:142728520-142728542 CTCAGCCTCCTCAAGAATGAGGG - Intergenic
999411389 5:151352973-151352995 CTAGACCCCCTCTGGAATAAGGG + Intergenic
1002626482 5:180533138-180533160 CAGGACCCTCTCTGGAATGACGG + Intronic
1006205489 6:32337986-32338008 CTGAACATCCTCAAAAATGAAGG + Intronic
1007321732 6:41032827-41032849 CGGGAGCCCCACAGGAATGAAGG - Intronic
1008742182 6:54622959-54622981 CAGGACCCTCTCTAGAATGAGGG - Intergenic
1009281244 6:61754303-61754325 CTGGCCCCACTCATGAATAATGG - Intronic
1010477685 6:76308487-76308509 CTGGACTCCTTCAAGAATCACGG + Intergenic
1010800630 6:80170679-80170701 CAGGACCTTCTCGAGAATGAGGG - Intronic
1011489268 6:87874093-87874115 GTGGAACCCCTCTGGAATGAGGG + Intergenic
1011882918 6:92053279-92053301 CAGGACCCCTTCTGGAATGAGGG + Intergenic
1013483813 6:110576104-110576126 CAGGACCCCCTCTGGATTGAGGG + Intergenic
1020407392 7:7852949-7852971 CAGGACCCTCTCTGGAATGAGGG + Intronic
1027638026 7:80700639-80700661 CTTCACCCCCTCAAAAATGAGGG - Intergenic
1028354198 7:89886774-89886796 CTGGAAATCCTCAAGAAGGATGG - Intergenic
1031884276 7:127229851-127229873 CGTGAGCCCCTCAAGAATGGTGG + Intronic
1032845856 7:135751194-135751216 CGTGAGCCCCTCAAGAATGGTGG - Intergenic
1033597587 7:142868116-142868138 CTGGATCCCCCCAAGATTGGGGG + Intronic
1037403684 8:18519440-18519462 CAGGACCCCTTCTGGAATGAGGG + Intergenic
1038493695 8:27987245-27987267 CTGGACCACCATAAGACTGATGG + Intronic
1039907917 8:41799662-41799684 CTGGCCCGCCTCAAGCCTGAGGG - Intronic
1042125937 8:65537089-65537111 CTGGACCTAGTCAATAATGAGGG - Intergenic
1044833156 8:96269785-96269807 CTTGATCCACTCAAGAATAAGGG + Intronic
1045602359 8:103732544-103732566 CTGGACCCACCCAGGATTGAGGG - Intronic
1045826412 8:106403477-106403499 GTGGAGCTCTTCAAGAATGATGG + Intronic
1050487246 9:6147250-6147272 CAGGACCCTCTCTAGAATGCAGG + Intergenic
1051944773 9:22554771-22554793 CAGGACCCTCTCTGGAATGAGGG + Intergenic
1052752250 9:32503701-32503723 CTGGTGCCCCTCCAGAATCATGG + Intronic
1053565634 9:39247749-39247771 CTGGAATCACTCAAGAATAAAGG - Intronic
1053831400 9:42085604-42085626 CTGGAATCACTCAAGAATAAAGG - Intronic
1054131515 9:61371287-61371309 CTGGAATCACTCAAGAATAAAGG + Intergenic
1054599147 9:67101834-67101856 CTGGAATCACTCAAGAATAAAGG + Intergenic
1054746217 9:68856495-68856517 GGAGACCCACTCAAGAATGATGG - Intronic
1054840118 9:69729459-69729481 CTGTAGCCCTTCAATAATGAGGG - Intronic
1055250194 9:74294276-74294298 CAGGACCCTCTCTGGAATGAGGG + Intergenic
1060217416 9:121746650-121746672 CTGGGCCCCCCCTAGAATGCGGG - Intronic
1062462465 9:136667639-136667661 AAGGACCCCCTCTAAAATGAAGG + Intronic
1189724335 X:43953516-43953538 CTGGACCCATTCAAGTTTGAGGG + Intronic
1191896868 X:66002099-66002121 CAGGACCCTCTCTGGAATGAGGG - Intergenic
1195753346 X:108178363-108178385 CTAGACTCCCTCAACGATGAGGG + Intronic
1201176811 Y:11314737-11314759 CTGCACCCCTTCATGAATGGCGG - Intergenic