ID: 944620009

View in Genome Browser
Species Human (GRCh38)
Location 2:201504770-201504792
Sequence TTCCATGCCAGGTTTTCCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 250
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 230}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944620004_944620009 3 Left 944620004 2:201504744-201504766 CCTTCCATCTGAAGAACTAGGGG 0: 4
1: 16
2: 19
3: 41
4: 141
Right 944620009 2:201504770-201504792 TTCCATGCCAGGTTTTCCCTGGG 0: 1
1: 0
2: 1
3: 18
4: 230
944620006_944620009 -1 Left 944620006 2:201504748-201504770 CCATCTGAAGAACTAGGGGCTAT 0: 1
1: 4
2: 9
3: 24
4: 108
Right 944620009 2:201504770-201504792 TTCCATGCCAGGTTTTCCCTGGG 0: 1
1: 0
2: 1
3: 18
4: 230

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944620009 Original CRISPR TTCCATGCCAGGTTTTCCCT GGG Intronic
900691308 1:3982176-3982198 GTCCATGCCAGGGTCTGCCTGGG + Intergenic
900735171 1:4295178-4295200 TTACATCCCAGGGTTTTCCTGGG - Intergenic
901160364 1:7172703-7172725 ATTCTTGCCAGGCTTTCCCTGGG + Intronic
901780592 1:11591934-11591956 TTCCATGTCAGTTTCTCCATGGG - Intergenic
902033880 1:13442410-13442432 TTCTATGCCTGTTTTTCCCTTGG - Intergenic
903337363 1:22634161-22634183 TTCCATGCCTGACTTGCCCTGGG - Intergenic
903554279 1:24181714-24181736 GCCCAGGCCTGGTTTTCCCTGGG + Intronic
904461054 1:30679995-30680017 GTCCATGCCAGTTGTTCCATGGG - Intergenic
905645288 1:39620978-39621000 TTCCTTCCCAGGCTTCCCCTTGG - Intergenic
906122384 1:43403013-43403035 CTCCATGCAAGGTGTTCCCAGGG - Intronic
907675178 1:56511337-56511359 GTCCATCCCAAGTTATCCCTAGG + Intronic
910460409 1:87443036-87443058 TTACCTGCCAGCTTTACCCTAGG + Intergenic
910793862 1:91078003-91078025 TTCCAGGCCAGGTATTTCCAGGG + Intergenic
911025170 1:93427884-93427906 CTCCATGCCTGGCTTGCCCTTGG + Intergenic
911044446 1:93617057-93617079 CTCAATGCCAGTTTTTCCTTGGG + Intronic
911475304 1:98366471-98366493 CTCCATGCCTGGTTCTCTCTTGG - Intergenic
912721676 1:112025502-112025524 TTGCAAACCAGGTTGTCCCTTGG - Intergenic
920009372 1:202856763-202856785 TTCCAAGTCATCTTTTCCCTAGG - Intergenic
923139222 1:231147224-231147246 TCCCTGGCCAGGTTTTCTCTGGG - Intergenic
923211634 1:231808807-231808829 CCCCAGGCCAGGTTTTACCTGGG - Intronic
923636474 1:235702458-235702480 TGCCCTGCGAGGCTTTCCCTGGG + Intronic
924254203 1:242166108-242166130 TCCCAGGCTGGGTTTTCCCTGGG + Intronic
1063152258 10:3347435-3347457 TTCCAGGCCATTTTTTCCCCTGG + Intergenic
1065384998 10:25125591-25125613 TTCCTTGCCAGCTTTGCCATTGG - Intergenic
1065830484 10:29609826-29609848 CTCCATGCCTGGCTTGCCCTTGG + Intronic
1065975822 10:30841523-30841545 TTCCATGCCAGGTTTCACTTTGG - Intronic
1066508344 10:36067536-36067558 CTCCATGCCTGGCTTGCCCTTGG + Intergenic
1067018160 10:42772840-42772862 CTCCATGCCTGGCTTACCCTTGG + Intergenic
1067643624 10:48074605-48074627 TACAATGTCAGCTTTTCCCTGGG - Intergenic
1069911838 10:71764858-71764880 TGCACTGCCAGGCTTTCCCTGGG - Intronic
1071060994 10:81570799-81570821 TTGCATGCCAGGAGCTCCCTGGG - Intergenic
1071381488 10:85067028-85067050 TTCAATGCCAGGTTGTTTCTAGG - Intergenic
1073670152 10:105579205-105579227 TTCCATGCCTGACTCTCCCTTGG - Intergenic
1074896750 10:117784088-117784110 TTCCCTGCCAAGTTTTCTCCAGG - Intergenic
1075117290 10:119637704-119637726 TTCATTTCCAGGCTTTCCCTTGG + Intergenic
1076540494 10:131211375-131211397 TTCCCTGCCAGATTTTTCCATGG + Intronic
1079802998 11:24895108-24895130 CTCCATGACAGATTTTCCGTGGG + Intronic
1081268723 11:41058423-41058445 TTCCATGCCTGACTTGCCCTTGG + Intronic
1081336679 11:41875250-41875272 GTTCATGCCAAGTTTTCCTTTGG + Intergenic
1083529358 11:63404847-63404869 TTTCAGGCTGGGTTTTCCCTAGG - Intronic
1083589397 11:63884388-63884410 TGCCATGTCAGGTTTTTCCCAGG + Intronic
1084365159 11:68692949-68692971 CTCCATGCCAGGAGCTCCCTAGG - Intergenic
1084387780 11:68854911-68854933 TTCCGTCCCAGGCTCTCCCTCGG + Intergenic
1086508173 11:87527859-87527881 CTCCATGCCTGGCTTACCCTTGG - Intergenic
1086821351 11:91439915-91439937 TTCTATGCCAGGTTGGCCCCTGG - Intergenic
1089497041 11:118913204-118913226 TTGCTTGGGAGGTTTTCCCTGGG + Intronic
1089805864 11:121088214-121088236 TTTATTCCCAGGTTTTCCCTGGG + Exonic
1091105237 11:132912850-132912872 ATCCATGCCAGATCTTCCATGGG + Intronic
1093145378 12:15559035-15559057 TTTCATGCCTGGTTCACCCTTGG + Intronic
1093492872 12:19725225-19725247 CTCCATGCCTGGCTTACCCTTGG - Intergenic
1094039385 12:26106865-26106887 ATCACTGGCAGGTTTTCCCTTGG - Intergenic
1095491266 12:42736321-42736343 TTCACTGACAGCTTTTCCCTGGG + Intergenic
1095909559 12:47412269-47412291 TTACATGCCAGGCTGTCTCTGGG + Intergenic
1097288138 12:57893381-57893403 TTCCATGCCAGGCTCTTCCAGGG - Intergenic
1098885191 12:75953794-75953816 CTACATGGGAGGTTTTCCCTTGG - Intergenic
1099940012 12:89175554-89175576 TTCCCTGCCAGGTTTTCACATGG + Intergenic
1100030287 12:90179551-90179573 TTTTATGCCAGTTTTTCCTTGGG + Intergenic
1102736365 12:115164136-115164158 TTGCCTTCCAGGTTTTCTCTGGG + Intergenic
1105694704 13:22876338-22876360 TACCATGCCAGTTTTTCCAAGGG + Intergenic
1105837705 13:24225185-24225207 CTCCATTCCTGGTTTGCCCTTGG - Intronic
1106914687 13:34499908-34499930 TTCCATGCCAGCTCTTACATAGG + Intergenic
1107101448 13:36597799-36597821 CCCTAGGCCAGGTTTTCCCTGGG - Intergenic
1109944787 13:69419846-69419868 CTCCATGCCTGGTTTGCCCTTGG - Intergenic
1110810795 13:79808721-79808743 CTCCATGCCTGGCTTGCCCTTGG + Intergenic
1113401650 13:109999857-109999879 TTCCATGCCAAGGTGTCCCTTGG - Intergenic
1113921517 13:113915802-113915824 TTCCAAACCAGAGTTTCCCTAGG + Intergenic
1114927500 14:27422194-27422216 TCCAATGCCACATTTTCCCTTGG + Intergenic
1115027509 14:28761591-28761613 TTCCACGCCTGGCTCTCCCTTGG + Intergenic
1115310404 14:31973656-31973678 TTCCATGCCTGGCTCACCCTTGG - Intergenic
1117652239 14:57919077-57919099 TTCCATTCCAGGATTTTCCATGG + Intronic
1117766326 14:59087174-59087196 TTCCATGTAAGGTTTTTCCTGGG - Intergenic
1118158866 14:63269014-63269036 TTCCATGCCAGCATCTCCTTGGG - Intronic
1119201526 14:72756341-72756363 TTCAATGCCAGGTATTTCCATGG - Intronic
1121722578 14:96120706-96120728 TTCCCTTCCAGGATATCCCTTGG - Intergenic
1122455910 14:101851115-101851137 TTCCATGCAAGGTGCTCCCAGGG - Intronic
1126215339 15:46147186-46147208 CTCCATGCCTGGCTTGCCCTTGG + Intergenic
1127282102 15:57501526-57501548 TCCCATGCCAGGCTATGCCTGGG - Intronic
1128683615 15:69668249-69668271 TTCCATGCAGGGATGTCCCTGGG - Intergenic
1128824291 15:70697277-70697299 TTTCAGGCCACTTTTTCCCTGGG + Intronic
1128961755 15:72013672-72013694 CTCCATGCTAGGTTTATCCTAGG - Intronic
1131053395 15:89362320-89362342 TTGCCTCCCAGCTTTTCCCTGGG - Intergenic
1131233132 15:90673918-90673940 TTCCATGAAAGGTGTTCCCTGGG - Intergenic
1132397338 15:101483532-101483554 TTGGATGCCATGCTTTCCCTTGG - Intronic
1132593223 16:735581-735603 CCCCAGGCCAGGTTTTCCCTGGG + Intronic
1133004362 16:2870160-2870182 TTCCTTTCCAGGCTTTGCCTAGG - Intergenic
1135703366 16:24652825-24652847 ATCCATGTCCTGTTTTCCCTGGG - Intergenic
1138998650 16:62481633-62481655 TTCCATGCTTGGCTTTTCCTTGG + Intergenic
1139463505 16:67141556-67141578 CTCCATGCCTGGCTTGCCCTTGG - Intronic
1140877382 16:79165104-79165126 TTCCATATCAAGTTTACCCTAGG - Intronic
1141853069 16:86660757-86660779 TTCTATGCCAGGTGTCCTCTTGG - Intergenic
1143478617 17:7216720-7216742 TTGGAAGCCAGCTTTTCCCTGGG + Intronic
1147376144 17:40023463-40023485 ACCCATGCCAGACTTTCCCTTGG + Intronic
1149253121 17:54793140-54793162 TCCCATGCCATGCTTTTCCTAGG + Intergenic
1151094177 17:71477119-71477141 TTCAATGCCAGTTTTCCCTTGGG - Intergenic
1154334741 18:13456376-13456398 CACCTTGCCAGGGTTTCCCTGGG + Intronic
1155072858 18:22331429-22331451 TTCCATGCAATATTTTACCTTGG - Intergenic
1156532842 18:37834948-37834970 TTCCAGGCCTGCTTTTCCTTGGG - Intergenic
1158154332 18:54408291-54408313 ATCCATGACATCTTTTCCCTGGG - Intergenic
1159096818 18:63911843-63911865 TTCCATCCGAGGTTTGCCTTCGG + Intronic
1160386576 18:78500520-78500542 TTCCCTGCCCAGTTGTCCCTGGG - Intergenic
1161780347 19:6287512-6287534 CTCCATGCCTGGCTTGCCCTTGG + Intergenic
1162050035 19:8027549-8027571 TTCCTTGCCAGGTCTTCCACAGG + Intronic
1163610129 19:18296317-18296339 TTCCATGCCAGCTTTCCCTTGGG + Intergenic
926070382 2:9884032-9884054 TTCCATGCCTGACTTGCCCTTGG - Intronic
926860368 2:17302235-17302257 TTCCATACAAGTTTTTCCTTTGG - Intergenic
927025822 2:19068103-19068125 TTCTATGCCATGTATTTCCTCGG + Intergenic
927667077 2:25040403-25040425 AACCATCCCAGGGTTTCCCTTGG + Intergenic
928764730 2:34630870-34630892 TTCCATGACTTGTTTTCCATTGG - Intergenic
929902286 2:46015519-46015541 TTCCATGCTGCATTTTCCCTAGG - Intronic
931102516 2:59018199-59018221 TTCCATGCCTGTTTTTCTATTGG + Intergenic
932448932 2:71797399-71797421 TTCTATGCCAGGCCTGCCCTGGG - Intergenic
933146601 2:78861494-78861516 TTCCCTTCCAGGTTTAACCTGGG - Intergenic
933527705 2:83464573-83464595 TTCCATGCTAGATTTTATCTAGG - Intergenic
934700032 2:96431527-96431549 TTCCATGCCTGACTTGCCCTTGG + Intergenic
935542651 2:104367775-104367797 TTCAATGCCATCTTCTCCCTGGG - Intergenic
936457781 2:112688652-112688674 TTCCATGCCCTCTTCTCCCTGGG + Intergenic
936850619 2:116893522-116893544 TTCCCTCCCAGGTTTAGCCTAGG - Intergenic
937430194 2:121831829-121831851 CTCCCTGACAGGTTTTCCCCAGG + Intergenic
938096314 2:128466504-128466526 CTCCATGCCTGGCTTGCCCTTGG - Intergenic
938721975 2:134075445-134075467 CTCCATGCCTGGCTTGCCCTTGG - Intergenic
938959699 2:136330025-136330047 TTCTATGCGAGTTCTTCCCTTGG + Intergenic
939058196 2:137387840-137387862 TTCTATGCCAGGTTTCCCATTGG + Intronic
939369394 2:141278640-141278662 TTCTATGCAAAGTATTCCCTAGG - Intronic
939893005 2:147759782-147759804 TTCCATTTCAGCATTTCCCTAGG - Intergenic
940246452 2:151623066-151623088 ATCCATGCCAGTTTACCCCTTGG + Intronic
941182724 2:162280422-162280444 TTCCATGTCAGTTTTCCACTTGG - Intronic
941868557 2:170359880-170359902 TTCCAGGCATTGTTTTCCCTAGG + Intronic
942022318 2:171878512-171878534 CTCCAAGCCAGAGTTTCCCTGGG + Intronic
942847796 2:180446842-180446864 TTTCATGCCAGGATTTCAGTTGG + Intergenic
943680734 2:190764908-190764930 TTACTTGCCTGGTTTTACCTGGG + Intergenic
944620009 2:201504770-201504792 TTCCATGCCAGGTTTTCCCTGGG + Intronic
946181094 2:217949349-217949371 CTCCAGGGCAGGGTTTCCCTTGG + Intronic
946374271 2:219298749-219298771 TTCTGTGCAAGGTGTTCCCTTGG + Intronic
947850771 2:233285925-233285947 TTCAATGCCAGGTTGTTTCTAGG - Intronic
1169498253 20:6134869-6134891 CTCCAGGCCAGGTTTTGCCTGGG - Intergenic
1169801544 20:9516465-9516487 TCCCAGGCCAAGTCTTCCCTCGG + Intronic
1169880631 20:10342405-10342427 GTCCATGCCTGGCTTGCCCTTGG + Intergenic
1170458506 20:16554971-16554993 CTCCATGCCTGGCTTGCCCTTGG + Intronic
1170769082 20:19316649-19316671 GTCCAGGCCAGGTTGGCCCTAGG + Intronic
1173740276 20:45395285-45395307 CTCCATGCCTGGCTTACCCTTGG + Intronic
1174393333 20:50231564-50231586 GTCCAGGCCAGGTCCTCCCTGGG - Intergenic
1175396745 20:58669606-58669628 TTCCAAGCCAGGGTTTCACATGG - Intronic
1183226303 22:36552340-36552362 TTCCATCCCAGCTTCTGCCTAGG + Intergenic
1184391264 22:44204897-44204919 TTCCATTCTAGCTTCTCCCTTGG - Intronic
952901481 3:38114592-38114614 TTCCAGGCCAGGGTTTCCCTGGG + Intronic
955111759 3:55957635-55957657 CTCCATGCCTGGCTTGCCCTTGG - Intronic
955603925 3:60678648-60678670 TTCTATCCCAGTTTTTCTCTTGG - Intronic
957307892 3:78481271-78481293 TTCCATGCCTGGCTTGCCCTTGG + Intergenic
958031222 3:88113515-88113537 TCCCATGCCACTTTTTCCCTTGG + Intronic
958141645 3:89570561-89570583 TTCCATTCCTGGTTTGCCCTTGG - Intergenic
961942850 3:130655892-130655914 CTCCATGCCTGGCTTGCCCTTGG - Intronic
962257740 3:133883964-133883986 TTCCAAACCAGTTTTTCTCTGGG + Intronic
962918667 3:139932220-139932242 TTCCATGCCAGGCTTTACAATGG - Intergenic
965375712 3:167921251-167921273 CTCCATGCCAGGTTTACCTCAGG - Intergenic
965729893 3:171760689-171760711 TACCCTGCCAGGTGCTCCCTTGG - Intronic
966254337 3:177899946-177899968 CTCCATGCCTGGCTTGCCCTTGG + Intergenic
967573651 3:191063620-191063642 TTCCATGCCACATTTTGTCTTGG - Intergenic
968052456 3:195664494-195664516 TTATATACCAGGTTTTCACTTGG + Intergenic
968103354 3:195983846-195983868 TTATATACCAGGTTTTCACTTGG - Intergenic
968301662 3:197621438-197621460 TTATATACCAGGTTTTCACTTGG - Intergenic
968443944 4:638988-639010 CCCCAGGCCAGCTTTTCCCTGGG - Intronic
968476849 4:814679-814701 CCCCAGGCCAGGTTTTCCCCAGG + Intronic
969385669 4:6845299-6845321 TTCTCTGCCAAGTTTTCTCTGGG - Intronic
969537676 4:7766739-7766761 TTCCATGCCTGGATGGCCCTTGG + Intronic
970076598 4:12228920-12228942 TCCCTTGCCAGGTTGGCCCTCGG - Intergenic
970466538 4:16329250-16329272 TTCCATTCCTTTTTTTCCCTTGG - Intergenic
971092540 4:23361663-23361685 CTCCATGCCTGGCTTGCCCTTGG + Intergenic
972473874 4:39432650-39432672 TTCCATGCCTGGCTTGCCCTGGG - Intronic
974558633 4:63487723-63487745 CTCCAGGCCAGTTTTTCCCCAGG + Intergenic
975660006 4:76679298-76679320 TTCCATCCCAGGTCTACTCTTGG + Intronic
976441445 4:85080287-85080309 TTCCATTCCTGATTCTCCCTGGG + Intergenic
977218219 4:94308657-94308679 TTTCATGTCATGTTTTCCTTGGG - Exonic
980396980 4:132227046-132227068 CCCCAGGCTAGGTTTTCCCTGGG - Intergenic
980672140 4:136023962-136023984 TTCCATGCCAGTTTTGCTCAGGG - Intergenic
982287306 4:153748562-153748584 TTCCAGGACATGTTCTCCCTTGG - Intronic
982293235 4:153800592-153800614 TTCTGTGCCAGGTTTTCCTTTGG - Intergenic
983519884 4:168697201-168697223 TTCCATGTGAAGTTTTGCCTAGG - Intronic
983561761 4:169108707-169108729 TTCAATGCCACATTTTCCGTGGG + Intronic
985498658 5:226290-226312 TTACATACCAGGTTTTAACTTGG + Intronic
986306208 5:6518964-6518986 CTCCATGCCAGGTGGTGCCTAGG - Intergenic
986522720 5:8638595-8638617 CTCCATTCCATTTTTTCCCTTGG + Intergenic
987999709 5:25331906-25331928 CTCCATGCCTGGCTTGCCCTTGG + Intergenic
990999107 5:61765025-61765047 TTCCATTCCAGCCTTTGCCTAGG + Intergenic
992945316 5:81803691-81803713 CTCAAGGGCAGGTTTTCCCTGGG - Intergenic
993736526 5:91483213-91483235 TTCCAGGCCAGGATTTTCATGGG + Intergenic
995599887 5:113783977-113783999 TACCAGGCCAGTTTTTCCCAGGG + Intergenic
997600956 5:135138018-135138040 TTCCATCTCAGCTTTTCCCCAGG - Intronic
997711521 5:136008722-136008744 CTCCATGCCAGTTGTGCCCTGGG - Intergenic
999183457 5:149687663-149687685 TTCTTTGCCAAGTTTTCCGTCGG + Intergenic
999250655 5:150180402-150180424 TTCCTGGGCAGCTTTTCCCTGGG - Intronic
999297050 5:150466213-150466235 TTCCAGGCTGGGTTTCCCCTCGG - Intergenic
1000269765 5:159672868-159672890 TTCAATTCCACATTTTCCCTTGG - Intergenic
1001422119 5:171596120-171596142 CTACATGCCAGGTTTACCCCTGG + Intergenic
1002099927 5:176852445-176852467 TTCCTTCCCCAGTTTTCCCTGGG + Intronic
1006219707 6:32478178-32478200 TTCCATGTCAGGTATGCACTAGG + Intergenic
1006228986 6:32565938-32565960 TTCCATGTCAGGTATGCACTAGG + Intronic
1006334390 6:33412934-33412956 TTCCATGGCTGCTTCTCCCTGGG - Intronic
1007059782 6:38927447-38927469 GTCCATTCTAGGATTTCCCTGGG - Intronic
1008743077 6:54633690-54633712 GTCCTTGCCAGGTTTTCCGAGGG - Intergenic
1009588758 6:65638747-65638769 CTCCATGCCTGGCTTACCCTTGG + Intronic
1009870736 6:69450030-69450052 CTCCATGCCTGGCTTGCCCTTGG - Intergenic
1011930031 6:92700582-92700604 TTCCACGCCTGGCTTGCCCTTGG - Intergenic
1012386093 6:98685009-98685031 TGCAATGCCAGCTCTTCCCTGGG + Intergenic
1012536889 6:100309412-100309434 TTCCATATTAGGTTTTGCCTTGG - Intergenic
1012749409 6:103139526-103139548 TTCCATTCCTGGCTTGCCCTTGG - Intergenic
1014392062 6:120874671-120874693 CTCCATGCCTGGTTCGCCCTTGG + Intergenic
1014714300 6:124846545-124846567 TTCCATGACTGTTTTTCCCCAGG - Intergenic
1015206611 6:130646933-130646955 TTCTATACCAGTTTTACCCTAGG - Intergenic
1015699650 6:136021950-136021972 TCTCATGCCACCTTTTCCCTTGG + Intronic
1016986587 6:149900133-149900155 CTCCATGGCTGGTTTTCCCAGGG + Intergenic
1017588052 6:155948102-155948124 CTCCATGCCTGGCTTGCCCTTGG + Intergenic
1018548287 6:164962765-164962787 TTCAATCCCACATTTTCCCTTGG - Intergenic
1018659849 6:166076113-166076135 CTCCATGCCTGGCTTGCCCTTGG - Intergenic
1022157856 7:27678367-27678389 CTCCTTACCAGGTTTGCCCTTGG - Intergenic
1022263658 7:28732121-28732143 TTCCATTCCATCTTTTCTCTTGG + Intronic
1022753054 7:33252341-33252363 TAACAGGCCAGGTTTTCTCTGGG + Intronic
1026296688 7:69059137-69059159 TTCCTTGGCAGGTTTTCATTTGG - Intergenic
1028945825 7:96579072-96579094 TTCTTTGCCAGGTTTTCCTCTGG - Intronic
1031947647 7:127858220-127858242 GTACATGCCAAGGTTTCCCTGGG + Intronic
1041237428 8:55818542-55818564 TTACTAGCCAGCTTTTCCCTTGG + Intronic
1041527407 8:58822710-58822732 TTCCATGCCAGCTCTTACATAGG - Intronic
1041956070 8:63559083-63559105 CTCCATGCCTGGCTTGCCCTTGG - Intergenic
1042455264 8:68994450-68994472 TTTCATCCCAGTTTATCCCTGGG - Intergenic
1043082414 8:75783756-75783778 TTCCATGTCAGGCTCACCCTTGG - Intergenic
1043277357 8:78415806-78415828 TTCACTGCTAGATTTTCCCTAGG - Intergenic
1045150523 8:99402069-99402091 TTACATGAGAGGTTTTCTCTAGG - Intronic
1045222670 8:100213642-100213664 GTCCCCGCCGGGTTTTCCCTTGG + Intronic
1048480671 8:134789405-134789427 CTGCATTCCAGGATTTCCCTTGG + Intergenic
1049974534 9:849036-849058 TCCAGTGCCAGGTTTTCCATAGG + Intronic
1051818027 9:21132690-21132712 TTGAATGCCAGGCTTTCCCCAGG + Intergenic
1054929213 9:70618785-70618807 TTCCATGGCAGATTTTGGCTGGG + Intronic
1055572717 9:77632834-77632856 TTCCATGCCTGACTCTCCCTTGG + Intronic
1058395272 9:104545301-104545323 TTACATGCCAGATTTTAGCTGGG + Intergenic
1059430561 9:114247723-114247745 TACCATGCCAGCCGTTCCCTTGG + Intronic
1059516786 9:114903286-114903308 GTCCCAGCCTGGTTTTCCCTGGG + Exonic
1060016655 9:120092453-120092475 TTCCATGCCTGGTTTTTACTTGG - Intergenic
1185993509 X:4917757-4917779 TTCCATGTCAGGTTTACCTCAGG + Intergenic
1186076568 X:5886207-5886229 TTCCAGGTAAGGTTTTCCCCTGG + Intronic
1190078004 X:47332881-47332903 TTCCAAGACAGGTTCTCCGTCGG + Intergenic
1190217643 X:48490636-48490658 TTTCATTCCAGGCTTGCCCTGGG - Intergenic
1190360444 X:49644191-49644213 TTCCATGCCTGGCTTGCCCTTGG - Intergenic
1192367474 X:70486136-70486158 TTACATGTCACATTTTCCCTGGG + Intronic
1195710742 X:107772041-107772063 TTACTTGCTTGGTTTTCCCTTGG - Intronic
1198564824 X:137893737-137893759 TTCCATGCTAAAATTTCCCTAGG + Intergenic
1199872203 X:151909545-151909567 TACCAGGCGAGGTGTTCCCTGGG - Intergenic
1199872413 X:151911984-151912006 TACCAGGCGAGGTGTTCCCTGGG - Intergenic
1199947017 X:152678658-152678680 TCCCAGGCCAGGTGCTCCCTGGG - Intergenic
1199962664 X:152789796-152789818 TCCCAGGCCAGGTGCTCCCTGGG + Intergenic
1200411647 Y:2867663-2867685 CTCCACGCCTGGTTTGCCCTTGG - Intronic
1201490387 Y:14535096-14535118 TTCGATGGCAGGTTTGTCCTAGG + Intronic