ID: 944620875

View in Genome Browser
Species Human (GRCh38)
Location 2:201514982-201515004
Sequence GTTTAGGGGTGCATCTGACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 77
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 69}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944620875_944620883 17 Left 944620875 2:201514982-201515004 CCAGGTCAGATGCACCCCTAAAC 0: 1
1: 0
2: 0
3: 7
4: 69
Right 944620883 2:201515022-201515044 CTAGCAAGGCCTGTTGGTTTAGG 0: 1
1: 0
2: 2
3: 20
4: 139
944620875_944620880 3 Left 944620875 2:201514982-201515004 CCAGGTCAGATGCACCCCTAAAC 0: 1
1: 0
2: 0
3: 7
4: 69
Right 944620880 2:201515008-201515030 CTATTACCATTTGGCTAGCAAGG 0: 1
1: 0
2: 0
3: 7
4: 90
944620875_944620882 11 Left 944620875 2:201514982-201515004 CCAGGTCAGATGCACCCCTAAAC 0: 1
1: 0
2: 0
3: 7
4: 69
Right 944620882 2:201515016-201515038 ATTTGGCTAGCAAGGCCTGTTGG 0: 1
1: 0
2: 1
3: 11
4: 85
944620875_944620879 -6 Left 944620875 2:201514982-201515004 CCAGGTCAGATGCACCCCTAAAC 0: 1
1: 0
2: 0
3: 7
4: 69
Right 944620879 2:201514999-201515021 CTAAACACACTATTACCATTTGG 0: 1
1: 0
2: 2
3: 23
4: 184

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944620875 Original CRISPR GTTTAGGGGTGCATCTGACC TGG (reversed) Intronic
901177560 1:7315728-7315750 CTTTAGGGGTGGATCTTTCCTGG + Intronic
901201277 1:7468802-7468824 GTTTAGGGATCTCTCTGACCTGG + Intronic
902697687 1:18151311-18151333 GCTCAGGGGAGCCTCTGACCAGG - Intronic
905061477 1:35143326-35143348 GTTTGGGGGTGCACCTGACTCGG + Intergenic
907763871 1:57389095-57389117 GTTTGGGGGTGCATAGGACAAGG - Intronic
909427367 1:75541803-75541825 GGTTAGGGGTGCATTTTACAGGG - Intronic
1066645081 10:37598461-37598483 TGTTAGGGGGGCATGTGACCAGG + Intergenic
1067227084 10:44383394-44383416 AGTTATGGGTGCAACTGACCTGG - Intronic
1070223636 10:74477340-74477362 GTTTACGGGTGCATGCCACCAGG + Intronic
1071751804 10:88487298-88487320 GTTCAGGGGTGCATGTGTCATGG - Intronic
1075305886 10:121366706-121366728 GTTTAAGAGTCAATCTGACCTGG + Intergenic
1077486694 11:2841956-2841978 GTGTTGGGGTGGAGCTGACCAGG + Intronic
1084502592 11:69543714-69543736 GTTGAGGGGTGCCTCTGATGTGG - Intergenic
1085263131 11:75219728-75219750 GTTTAGGGGGTGAACTGACCAGG + Intergenic
1085327553 11:75618751-75618773 ATTTAGGGGGGCCTCTGGCCAGG - Intronic
1085594456 11:77795933-77795955 GTTTAGAGGTGTATGTGTCCAGG + Intronic
1089308020 11:117538830-117538852 GTTTGGGGGAGGATCTGAACTGG + Intronic
1091487260 12:901571-901593 GTTTAACTGTGCATCTGAACAGG + Intronic
1097744403 12:63285493-63285515 GTTTTGGGGTGCATCTGTGCAGG + Intergenic
1102079311 12:110085215-110085237 GTTTAGGGTTGCAGAAGACCTGG - Intergenic
1102495649 12:113317072-113317094 GTTTAGGGGTGCAAGTGTTCAGG + Intronic
1104636594 12:130441528-130441550 GTCCAGGGGTGCATGTGACACGG + Intronic
1109436111 13:62305234-62305256 GTTTAGAGTTTCTTCTGACCTGG + Intergenic
1113104750 13:106759953-106759975 ATCTTGGGGTCCATCTGACCTGG + Intergenic
1113568870 13:111339293-111339315 GTTTAGGGGAGGAATTGACCTGG + Intronic
1117058158 14:51934041-51934063 GTTTAGAGTTGGATCCGACCAGG + Intronic
1119157147 14:72421749-72421771 GATAAGGGGTGCAACTGCCCAGG - Intronic
1125287528 15:38110042-38110064 TTTTATGGGTTCATCTGATCAGG - Intergenic
1128145400 15:65329899-65329921 GTTTGGGAGTGCTTCAGACCTGG - Intronic
1135063206 16:19288271-19288293 GTTTATGGGTGCATATGGGCAGG + Intronic
1141054221 16:80802341-80802363 GTTTAGGGGTGAAAGTGATCTGG - Intronic
1152221905 17:79073524-79073546 GTTCAGGGGTGCACCGGACGTGG - Intergenic
1152230582 17:79112322-79112344 GTTGAGGGGTGCATCCCACCTGG + Intronic
1152780152 17:82223987-82224009 GTGTAGGGGTGCGTCTGCACAGG - Intergenic
1156248994 18:35332701-35332723 GCTTAGGTGAGCATGTGACCAGG - Exonic
1156892982 18:42211055-42211077 GATTGGGGTTGCAACTGACCTGG + Intergenic
1157288450 18:46393331-46393353 GGTGTGGGGTGCATCTGGCCAGG + Intronic
1162131639 19:8529703-8529725 GTTGAGAGATGCATCTGGCCAGG + Intronic
1164998843 19:32744203-32744225 GTATATGGATGAATCTGACCGGG + Intronic
936154464 2:110039369-110039391 CTGTAGGGGTGCCCCTGACCTGG + Intergenic
936190218 2:110332045-110332067 CTGTAGGGGTGCCCCTGACCTGG - Intergenic
944620875 2:201514982-201515004 GTTTAGGGGTGCATCTGACCTGG - Intronic
946696066 2:222360415-222360437 GTTTAGTGGTTCTGCTGACCTGG - Intergenic
1185229415 22:49671554-49671576 GCTTGGGGGGGCATCTGATCTGG - Intergenic
950499733 3:13355990-13356012 GTTTAGGGGTGGAACTCAGCTGG + Intronic
960672449 3:120166445-120166467 GTGTAGGGGTGGCTCTGAGCTGG + Exonic
964028699 3:152110510-152110532 ATTAAGGGGAGCATCTGCCCAGG + Intergenic
968444918 4:647330-647352 GATTTGGGGTCCATCTGGCCGGG + Intronic
986515147 5:8553772-8553794 TTTTAGGGGTGCATCTCTCCAGG - Intergenic
995244589 5:109921695-109921717 GCTCAGGGGTGAATCTGATCAGG + Intergenic
1000934152 5:167287964-167287986 GATTAGGGCTGGGTCTGACCAGG - Intronic
1002441167 5:179265284-179265306 GTTCAGGGGTGGAGCCGACCAGG - Intronic
1006714204 6:36104247-36104269 GCTTAGGTTTGCATCTGCCCTGG + Intronic
1007666963 6:43520109-43520131 GGTTCCGAGTGCATCTGACCTGG - Exonic
1010003259 6:70969344-70969366 TTTCAGAGGGGCATCTGACCTGG - Intergenic
1011649186 6:89490283-89490305 TTTTATGGGTGCAACTGACAGGG + Intronic
1015253029 6:131147016-131147038 GTTCAGGGAGGCATCTAACCTGG + Intronic
1018637729 6:165879079-165879101 ATTTGGGGGTGCAACTGACCTGG + Intronic
1019482927 7:1274664-1274686 GCTTCCGGGTGCATCTGACGGGG - Intergenic
1020111191 7:5448646-5448668 GTCCAGGGGTGGATCTGGCCTGG - Intronic
1026489573 7:70851113-70851135 GTTTAGGTCTGGAGCTGACCAGG - Intergenic
1029237008 7:99129098-99129120 TTTTAGGGCTGCCTCTGACTTGG - Intronic
1032826240 7:135571385-135571407 GTTTAGGGGTACATGTCATCAGG - Intronic
1034730499 7:153382995-153383017 GTTTGGCGGTGCTTCTGACTTGG - Intergenic
1037764661 8:21765046-21765068 CTTCTGGGCTGCATCTGACCAGG + Intronic
1037804444 8:22051169-22051191 ATTTAGGGGAGGATGTGACCAGG + Intronic
1041247137 8:55899327-55899349 GTTTAGGGGTCCGGCTGACTTGG - Intronic
1043238504 8:77899968-77899990 GCTTAGGGGTGCAGCAGGCCAGG + Intergenic
1053270665 9:36747256-36747278 GCTTTGGGGTCCAGCTGACCTGG + Intergenic
1055608889 9:78000725-78000747 GTTTATGGCTGAATCTGAGCAGG - Intronic
1057739113 9:97696818-97696840 GTTTAGGGATGCAGCCGCCCCGG - Intronic
1060903489 9:127282557-127282579 GTTTTGGGGCTCAACTGACCAGG - Intronic
1062474097 9:136719071-136719093 CTCCAGGGGTGCATCTGATCGGG - Intronic
1194090906 X:89581217-89581239 TGGTGGGGGTGCATCTGACCTGG + Intergenic
1195215161 X:102691910-102691932 GGTAACGGGTGCATCTCACCAGG - Intergenic
1199433203 X:147784025-147784047 GTTTAGGGCTGCCTATGACCAGG + Intergenic
1199531403 X:148851770-148851792 GTTTGGGGGTGCATGTGACACGG + Intronic