ID: 944620879

View in Genome Browser
Species Human (GRCh38)
Location 2:201514999-201515021
Sequence CTAAACACACTATTACCATT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 210
Summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 184}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944620875_944620879 -6 Left 944620875 2:201514982-201515004 CCAGGTCAGATGCACCCCTAAAC 0: 1
1: 0
2: 0
3: 7
4: 69
Right 944620879 2:201514999-201515021 CTAAACACACTATTACCATTTGG 0: 1
1: 0
2: 2
3: 23
4: 184
944620871_944620879 29 Left 944620871 2:201514947-201514969 CCAATTTTTTTTGCAAAACCAAA 0: 1
1: 0
2: 2
3: 66
4: 698
Right 944620879 2:201514999-201515021 CTAAACACACTATTACCATTTGG 0: 1
1: 0
2: 2
3: 23
4: 184
944620874_944620879 11 Left 944620874 2:201514965-201514987 CCAAAATGATGCTAGGACCAGGT 0: 1
1: 0
2: 0
3: 9
4: 170
Right 944620879 2:201514999-201515021 CTAAACACACTATTACCATTTGG 0: 1
1: 0
2: 2
3: 23
4: 184

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944620879 Original CRISPR CTAAACACACTATTACCATT TGG Intronic
905015125 1:34772809-34772831 TTAAACACAGAATTACCATAGGG - Intronic
911813696 1:102315231-102315253 CTAAACATGCTCTTACCATATGG + Intergenic
912264451 1:108142224-108142246 CTAAACACAGAATGACCATATGG + Intronic
914007648 1:143746823-143746845 TTTAAAACACTATTAGCATTTGG + Intergenic
918620928 1:186604962-186604984 CTAGATACAGTATTATCATTTGG + Intergenic
918688913 1:187455951-187455973 CTAAAGAAACTATTATGATTAGG - Intergenic
919243422 1:194945225-194945247 CTAAACACAGTCTTACCATATGG + Intergenic
920490621 1:206411724-206411746 TTAAATACACTCTTACCATGGGG - Intronic
921104770 1:211965404-211965426 CTAAAAACAGAATTACCATTCGG + Intronic
923115393 1:230932204-230932226 AGAAACACACTTTTCCCATTTGG + Intronic
923374632 1:233348526-233348548 TTAAACACAGAATTACCATATGG - Intronic
923419066 1:233794858-233794880 CTAAAGACAGAAATACCATTTGG + Intergenic
924060428 1:240168627-240168649 ATAAACACATTATTACTATTGGG - Intronic
1062924857 10:1308535-1308557 CTAAACATACTCTGACCATATGG - Intronic
1062976122 10:1684606-1684628 GTTAAAACACTATTGCCATTTGG - Intronic
1066123646 10:32317301-32317323 GTCCACAAACTATTACCATTTGG + Intronic
1070259089 10:74836351-74836373 TTAAACACAGAATTACCATATGG - Intronic
1071343513 10:84669563-84669585 CTAAAGACAGAAATACCATTTGG + Intergenic
1071424115 10:85531185-85531207 TTAAACACATTATTACAGTTTGG + Intergenic
1074667449 10:115745509-115745531 TTAAACATACTTTTACCATATGG - Intronic
1074705884 10:116131363-116131385 CTAAACATACAATTACCCTATGG + Intronic
1078029311 11:7733462-7733484 CTAAAAACAGAATTACCATTTGG + Intergenic
1078719135 11:13867853-13867875 CTCAACACACTATTAGCAAATGG + Intergenic
1079892770 11:26078658-26078680 CTAAACACTTTATCTCCATTTGG - Intergenic
1080570896 11:33556264-33556286 CTAAACATAGAATTACCATATGG + Intronic
1080995087 11:37589574-37589596 CTAAACATATTCTTACCATATGG + Intergenic
1081218670 11:40433979-40434001 CTGAACACAGTCTTCCCATTAGG - Intronic
1082665302 11:55969067-55969089 ATAAAAACACTAATACCAGTAGG + Intergenic
1082931038 11:58605711-58605733 CTAGACACATTATTATCAATCGG - Intronic
1083040977 11:59686855-59686877 CTAAACACACATTTACCCTAAGG - Intergenic
1084669835 11:70598664-70598686 CTAAACACAATATTAGCAAATGG + Intronic
1085658239 11:78337158-78337180 CTCAACACATTCTTAGCATTTGG + Intronic
1086665854 11:89481286-89481308 CACAATACAATATTACCATTTGG + Intronic
1087370413 11:97277092-97277114 CTAAAGACAGAAATACCATTTGG + Intergenic
1089852133 11:121508403-121508425 CTGAAGACAGTATTACCAATTGG - Intronic
1092465257 12:8725778-8725800 GTAAACATACTCTTACCATATGG - Intronic
1092724927 12:11475619-11475641 CTAGACCCACTGCTACCATTGGG - Intronic
1094416870 12:30225872-30225894 ATAAAAACACTATTATTATTTGG - Intergenic
1098221679 12:68276577-68276599 CAACACATACTATTACCAATAGG + Intronic
1099364674 12:81753616-81753638 TTAAACACAATATTGACATTTGG - Intronic
1100931092 12:99610275-99610297 CTACTCAGTCTATTACCATTAGG - Intronic
1101329645 12:103747210-103747232 CTAAACATACTCTCACCACTAGG + Intronic
1101414526 12:104497782-104497804 CTGATCACACTGTTACCATCCGG - Intronic
1105225970 13:18431926-18431948 CATACCACACTATTTCCATTAGG - Intergenic
1107137034 13:36956434-36956456 CTAAAAACAGAATTACCATATGG + Intronic
1108186004 13:47889088-47889110 CTAAACATACTCTTACCATATGG + Intergenic
1109333296 13:60958934-60958956 CTAAACACTCAAAAACCATTTGG - Intergenic
1109362620 13:61315559-61315581 CTATACTTACTATTACCAGTGGG + Intergenic
1109729241 13:66389184-66389206 TTAAACACATTATAAACATTAGG - Intronic
1112965269 13:105183759-105183781 CCAATCCCACTATTACAATTTGG + Intergenic
1113019551 13:105869026-105869048 CTAAAAACACAGCTACCATTAGG + Intergenic
1115066040 14:29260892-29260914 CTAAACACAGTCTTACCACGTGG - Intergenic
1115473455 14:33791883-33791905 TTAAACATACTAGAACCATTTGG + Intronic
1116159976 14:41255950-41255972 GTAAACACAATATTACTGTTGGG - Intergenic
1117165680 14:53030313-53030335 CTAAAGACAGAACTACCATTTGG - Intergenic
1119570855 14:75670457-75670479 TTAAACACAGAATTACCATATGG - Intronic
1120515325 14:85463692-85463714 CAAAACTCACTGTTACCATGGGG - Intergenic
1120795471 14:88627659-88627681 CAGAACATACTATTACCATTTGG - Exonic
1127055099 15:55123289-55123311 CTAAAAACAGAACTACCATTTGG + Intergenic
1129013166 15:72441226-72441248 CTAAAAACAGAACTACCATTTGG - Intergenic
1131535967 15:93238329-93238351 CTAAAAACAGAAATACCATTTGG - Intergenic
1131705371 15:94989788-94989810 CTAAACATGCTATTAACATGTGG + Intergenic
1133398845 16:5470034-5470056 TTAAACACAGAATTACCATATGG - Intergenic
1135461610 16:22648846-22648868 CTAAACAGACTTTTATCATAAGG - Intergenic
1137895741 16:52210296-52210318 CTAAATACAGTTTTATCATTTGG - Intergenic
1138628769 16:58276428-58276450 CTAAACACATTACTGACATTTGG + Intronic
1140304731 16:73792510-73792532 CTAAATACACTTTCCCCATTGGG + Intergenic
1140545119 16:75800341-75800363 CTAAACATAGTATTACCATATGG + Intergenic
1148722216 17:49762402-49762424 CTAAACATACTTTTACTACTTGG + Intronic
1149511157 17:57242861-57242883 CTAAAAATACTACTACTATTTGG - Intergenic
1150780042 17:68114384-68114406 TTTAACACACTATTACTATTAGG - Intergenic
1153895215 18:9552623-9552645 TTAAACACAGAATTACCATATGG + Intronic
1154527413 18:15307592-15307614 CATACCACACTATTTCCATTAGG + Intergenic
1155015820 18:21838076-21838098 GTAGACACACTATTACTATCTGG - Intronic
1155110065 18:22706029-22706051 CTAAAAACAGAACTACCATTGGG + Intergenic
1156830040 18:41480827-41480849 CTAAACAGATTGTCACCATTTGG - Intergenic
1157950824 18:52035060-52035082 CTAGGCACACTATTATGATTTGG + Intergenic
925719727 2:6815378-6815400 CTAAAAACAGAAATACCATTAGG + Intergenic
928002327 2:27535194-27535216 CTAAACAAAATATTAGCAATTGG + Intergenic
929680146 2:43985845-43985867 CTAAACATAGATTTACCATTAGG - Intronic
929998405 2:46844524-46844546 TTAAACATACAATTACCATAAGG - Intronic
931749929 2:65321322-65321344 CTAAAAACACTCTTGCCTTTGGG + Intronic
935057849 2:99582865-99582887 GTAAACAAACTGTTGCCATTAGG + Exonic
937725344 2:125157851-125157873 CTAAAGACAGAAATACCATTTGG - Intergenic
938247291 2:129787928-129787950 CTAAAGACAGAAATACCATTCGG - Intergenic
938526505 2:132139049-132139071 CATACCACACTATTTCCATTAGG + Intergenic
938806960 2:134814977-134814999 GTAAATACACTCTTACCATTTGG - Intergenic
941539841 2:166768439-166768461 CTAAAAACAGAAATACCATTTGG - Intergenic
943022301 2:182589935-182589957 CTAACCACGCTATTAGCTTTTGG + Intergenic
943471311 2:188297168-188297190 CTAAAAACACTTTTAGAATTTGG - Intronic
943862089 2:192879879-192879901 CTAAATACAATATTAGAATTTGG - Intergenic
944620879 2:201514999-201515021 CTAAACACACTATTACCATTTGG + Intronic
944812046 2:203336830-203336852 CTAAACACACATTTACCATACGG - Intronic
946667854 2:222069493-222069515 ATAAACACTTTATTAACATTGGG + Intergenic
1169032525 20:2421332-2421354 CAAAACATACTCTTACCATAAGG - Intronic
1169716314 20:8622607-8622629 CTCAAAACACTAGTGCCATTTGG - Intronic
1173700104 20:45062461-45062483 CTTAAAACAGCATTACCATTTGG - Intronic
1174710197 20:52696454-52696476 CTAAAAACAGAACTACCATTGGG + Intergenic
1176770023 21:13060932-13060954 CATACCACACTATTTCCATTAGG - Intergenic
1178783465 21:35629386-35629408 CTAACCATGCTATTGCCATTGGG + Intronic
1179253303 21:39692510-39692532 CTTAAAACAGAATTACCATTTGG - Intergenic
1185017854 22:48355714-48355736 CTAAACATACACTTACCATATGG - Intergenic
949150049 3:755839-755861 CTTAAAACAGAATTACCATTTGG - Intergenic
950149675 3:10677017-10677039 CTAAACACACTCTTACCATGTGG + Intronic
950413086 3:12851720-12851742 CTTTGCACACTGTTACCATTGGG + Intronic
950511937 3:13434784-13434806 CTAAACCCGCTTTTCCCATTAGG - Intergenic
952078120 3:29723313-29723335 CTAAATAAATTATTACCATTGGG + Intronic
952274348 3:31862873-31862895 CTAAACATAGAATTACCATATGG + Intronic
952719791 3:36520756-36520778 CTAAACACATTAGTGACATTTGG - Intronic
953034788 3:39202292-39202314 CTAAGAACACTATGACCAGTAGG - Intergenic
955341007 3:58125004-58125026 CTAAACAGACTACTCTCATTCGG - Intronic
958595712 3:96218957-96218979 TTAAACCCACTATTTCCACTGGG + Intergenic
959059014 3:101599131-101599153 CTAAAAACAGGATTACCATGTGG - Intergenic
959213092 3:103414265-103414287 CTAAAAACAGAACTACCATTTGG + Intergenic
959435012 3:106303897-106303919 CTCAAAACACAACTACCATTTGG - Intergenic
961805274 3:129484866-129484888 CTATGCACACTGTTACCGTTGGG - Intronic
964105902 3:153039171-153039193 CTAAACATGCAATTACCATATGG - Intergenic
965237832 3:166149603-166149625 CTAAATGCCCCATTACCATTGGG + Intergenic
966998049 3:185303850-185303872 CTAAACCCAGTATTAGTATTAGG - Intronic
970209135 4:13689380-13689402 CTAAAGACACAAATACCATTCGG - Intergenic
971520307 4:27541522-27541544 CAAAAAAAATTATTACCATTGGG + Intergenic
973216017 4:47670291-47670313 TTGAATACAATATTACCATTTGG - Intronic
973815030 4:54611610-54611632 TTAAACACACTTTCACCAGTGGG + Intergenic
974070115 4:57115518-57115540 CCAGACACACTATTAGCATGAGG - Intergenic
977691927 4:99921663-99921685 CTAAACTCACTTTTAGCTTTTGG + Intronic
978793086 4:112682798-112682820 CTAAAAACACCAGGACCATTTGG - Intergenic
979290042 4:118969426-118969448 ATAAACCCAGTATTACCATCGGG - Intronic
979885419 4:126021941-126021963 CTAAGCACAGTCTTACAATTGGG + Intergenic
980504439 4:133696871-133696893 CTTAAAACAGGATTACCATTGGG + Intergenic
980748009 4:137046409-137046431 ATACACAAACTATCACCATTGGG + Intergenic
981392060 4:144202622-144202644 CTAATCTCACTATTCCTATTTGG + Intergenic
982058556 4:151578702-151578724 CTAAACATACTCTTGCCATGTGG + Intronic
983282564 4:165699444-165699466 CGTAACACACTGTTACCATTTGG - Intergenic
983820407 4:172186380-172186402 GTAAACACAGAATTACCATATGG + Intronic
984553826 4:181191033-181191055 CTAATCATCCTATTACCATTTGG + Intergenic
984846033 4:184108376-184108398 CTTAACATTCTTTTACCATTTGG + Intronic
991174630 5:63672903-63672925 CTTAAAACACAATTACCTTTTGG + Intergenic
991571111 5:68054196-68054218 CTAAACAAACTAGTCCCATCTGG + Intergenic
991606875 5:68411395-68411417 CTAAACATACTCTTACCATATGG - Intergenic
992600995 5:78399354-78399376 CTAAACATACTGTTACCATATGG - Intronic
993415120 5:87618631-87618653 CTAAACACAATAATACAAATGGG + Intergenic
993856582 5:93083868-93083890 CTAAACTCATTATGACCAATGGG + Intergenic
994119496 5:96097865-96097887 CTAAAGACAGAAATACCATTTGG - Intergenic
994334021 5:98542864-98542886 CTAAAAACAGAAATACCATTTGG + Intergenic
995244406 5:109920256-109920278 CTTAAAACAGAATTACCATTTGG - Intergenic
995857766 5:116611769-116611791 CAGAACACACTAAGACCATTTGG + Intergenic
995936764 5:117526005-117526027 GTAAACAGAGTCTTACCATTTGG + Intergenic
996363009 5:122671249-122671271 CTAAACACAGAAATACCATATGG - Intergenic
996382504 5:122876702-122876724 CAAAACAAGCTATTACCATAGGG - Intronic
996904360 5:128580986-128581008 CTAAACACAATCTTACCATAAGG + Intronic
998571877 5:143267527-143267549 TTAAACATACTTTTACCATATGG - Intergenic
1005625159 6:27655705-27655727 TTAAACATATTATTACCATACGG + Intergenic
1008081644 6:47201324-47201346 CTAAACACCCAATGATCATTTGG + Intergenic
1008112824 6:47511553-47511575 TTATACACACTATTAACATTAGG + Intronic
1008438689 6:51507379-51507401 CTAAAAATAGAATTACCATTTGG + Intergenic
1008774598 6:55022053-55022075 TTAAACACTGAATTACCATTAGG - Intergenic
1011441832 6:87395641-87395663 CTAAACATAGTCTTACCATGTGG + Intronic
1016344624 6:143099686-143099708 TTAAACACACTATTTCTATTTGG - Intronic
1016632713 6:146250601-146250623 GAAAACACACTAATACAATTAGG - Intronic
1016734075 6:147456919-147456941 CTAAACTCACAATTCCAATTTGG + Intergenic
1020538752 7:9434566-9434588 CTGAATACTCTATTACCATCTGG + Intergenic
1020579205 7:9972805-9972827 CTAAACACATAATTACCATATGG + Intergenic
1024968219 7:55044300-55044322 TTAAACACACTTTCACCCTTGGG - Intronic
1025259389 7:57407544-57407566 ATACACACATTGTTACCATTTGG - Intergenic
1028105780 7:86876761-86876783 GTCAACAAACTATAACCATTAGG + Intergenic
1028575050 7:92339423-92339445 CTAAGCAGACTAATAACATTGGG - Intronic
1028822244 7:95225842-95225864 CTACTTACACTTTTACCATTTGG + Intronic
1029309200 7:99645489-99645511 CTAAAGACAGAAATACCATTTGG - Intergenic
1030200681 7:106900473-106900495 TTAAAGACAGCATTACCATTGGG + Intronic
1030250276 7:107435753-107435775 CTAAACATAGAATTACCATATGG + Intronic
1030470758 7:109959729-109959751 CTAAAATCACTAGTGCCATTTGG - Intergenic
1030815833 7:114036362-114036384 TTAAACACAGAATTACCATATGG - Intronic
1031155609 7:118107352-118107374 CTAAACAAACTGTGACCATCAGG - Intergenic
1032691262 7:134289524-134289546 CTTCATACAGTATTACCATTAGG - Exonic
1040793575 8:51263833-51263855 CTAAACATACTGTCACCATCTGG - Intergenic
1040958829 8:53008994-53009016 CTAAACATAGAATTACCATATGG - Intergenic
1041657522 8:60368791-60368813 ATAAACACAGAATTACCATATGG + Intergenic
1042156616 8:65851112-65851134 TAAAACACACTATAACCAATTGG - Intergenic
1043134277 8:76501446-76501468 CTAAAGACAGAAATACCATTTGG + Intergenic
1043216095 8:77590913-77590935 CTAAACCCACTATTTCAATGAGG - Intergenic
1043791496 8:84473118-84473140 TAAACCACACTATTACTATTTGG - Intronic
1045043960 8:98256754-98256776 TTAAACACAGGATTACCATATGG + Intronic
1046065675 8:109194296-109194318 CTAAACATACTCTTACCATTTGG - Intergenic
1047088813 8:121550672-121550694 CTAAACATATGATTACCATATGG - Intergenic
1047884336 8:129232009-129232031 CTACAAACAATATTACCATTGGG + Intergenic
1048659122 8:136575879-136575901 CAAAACAGACTAATACAATTGGG - Intergenic
1050404174 9:5290398-5290420 CTAAACATATTCTTACCATGTGG + Intergenic
1051688040 9:19679204-19679226 CTAAAGACACTATTGCCCTTTGG - Intronic
1054703277 9:68435630-68435652 CAAAACACACTATAACCATATGG - Intronic
1055745177 9:79436390-79436412 CTAAAAACAGAATTACCACTGGG + Intergenic
1058067887 9:100569109-100569131 TTAAACACAGGGTTACCATTTGG - Intronic
1059091288 9:111361408-111361430 CTAAACTGACCCTTACCATTGGG - Exonic
1186353556 X:8765922-8765944 CAAAACACAATACTCCCATTGGG - Intergenic
1186377677 X:9023944-9023966 CAAAACACAGTACTCCCATTGGG - Intergenic
1186794804 X:13034985-13035007 CAAAACACAATACTCCCATTGGG - Intergenic
1186955510 X:14677638-14677660 CTTATAACACTATTAACATTTGG + Intronic
1187316449 X:18199988-18200010 CTAAACATGCTAGTACCATAAGG + Intronic
1187510251 X:19911102-19911124 CTAAACATAGGATTACCATGTGG - Intergenic
1191655696 X:63596567-63596589 CTAGAAACACAACTACCATTTGG - Intergenic
1192508233 X:71703974-71703996 CTAAAGACAGAAATACCATTCGG - Intergenic
1192518463 X:71777579-71777601 CTAAAGACAGAAATACCATTCGG + Intergenic
1192559635 X:72118005-72118027 TTAAACACAGAGTTACCATTTGG - Intergenic
1194670519 X:96727024-96727046 CTGAAAACACTCTTATCATTTGG + Intronic
1195492519 X:105488036-105488058 CTAAACACATTATCAACTTTGGG + Intronic
1196486218 X:116211843-116211865 CAAAATACACTATTGCCATGGGG - Intergenic
1198644823 X:138794692-138794714 CAAAACAAATTATTACCTTTGGG - Intronic
1202173254 Y:22073628-22073650 TAAAACACTCTGTTACCATTGGG + Intronic
1202218106 Y:22512746-22512768 TAAAACACTCTGTTACCATTGGG - Intronic
1202325079 Y:23683312-23683334 TAAAACACTCTGTTACCATTGGG + Intergenic
1202545692 Y:25986742-25986764 TAAAACACTCTGTTACCATTGGG - Intergenic