ID: 944620880

View in Genome Browser
Species Human (GRCh38)
Location 2:201515008-201515030
Sequence CTATTACCATTTGGCTAGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 98
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 90}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944620874_944620880 20 Left 944620874 2:201514965-201514987 CCAAAATGATGCTAGGACCAGGT 0: 1
1: 0
2: 0
3: 9
4: 170
Right 944620880 2:201515008-201515030 CTATTACCATTTGGCTAGCAAGG 0: 1
1: 0
2: 0
3: 7
4: 90
944620875_944620880 3 Left 944620875 2:201514982-201515004 CCAGGTCAGATGCACCCCTAAAC 0: 1
1: 0
2: 0
3: 7
4: 69
Right 944620880 2:201515008-201515030 CTATTACCATTTGGCTAGCAAGG 0: 1
1: 0
2: 0
3: 7
4: 90

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944620880 Original CRISPR CTATTACCATTTGGCTAGCA AGG Intronic
902314540 1:15608110-15608132 CTTTTAGAATTTGTCTAGCAGGG - Intergenic
902419502 1:16267500-16267522 CTATAACCATTTGGCTTCCGTGG - Intronic
903370842 1:22834996-22835018 CTAATACCATTTGCCTTGCCAGG + Intronic
909308030 1:74106439-74106461 CTATTTCCTTTTGGCTCCCATGG + Intronic
909337962 1:74498034-74498056 CTATTACCATTTAGTGAGCTGGG + Intronic
909350879 1:74652082-74652104 CTATCACCATATGACTAGCTTGG + Intronic
910442746 1:87269323-87269345 CTATTACAATCTATCTAGCAAGG - Intergenic
916943595 1:169701573-169701595 CATTTATCATTTGGCTGGCAAGG - Exonic
922548232 1:226474450-226474472 CTATTATCATTCAGCTAGCTGGG - Intergenic
923897095 1:238283474-238283496 CTATTCTCTTTTGGCTTGCAGGG + Intergenic
924158454 1:241205876-241205898 CTATTAATATTTGTCTAGCCTGG - Intronic
924403619 1:243718156-243718178 CTCTTACCATTTGTTTAGAAGGG + Intronic
1064609554 10:17083981-17084003 TTATTACCACTTGACTAGCTGGG + Intronic
1065855933 10:29830084-29830106 CCATTTCCATGTGGCTAGCTTGG - Intergenic
1069140526 10:64817359-64817381 CTATGACCATCAGGCTAGCCTGG - Intergenic
1071074524 10:81734964-81734986 CTATTCCTATTTGGCTATCTTGG - Intergenic
1072805760 10:98423313-98423335 CTACTACCATTTTGCCAGCTGGG + Intronic
1073169208 10:101488500-101488522 CTAATACCATTTGATTAACAAGG - Intronic
1074336694 10:112583575-112583597 TTATTACAATTTGCCTATCATGG + Intronic
1077627041 11:3781408-3781430 CTTTTAGAATTTGTCTAGCAGGG + Intronic
1078049743 11:7952945-7952967 CTATTATTATTTGGCTAGAATGG - Intergenic
1088419293 11:109624680-109624702 CTATTCCCATTTCGCTATCTTGG + Intergenic
1089863975 11:121615881-121615903 ATATTCCCATTTTGCCAGCAAGG + Intronic
1092951172 12:13504949-13504971 CTTTTAGCACTTGGTTAGCACGG + Intergenic
1095725058 12:45442788-45442810 CTACTGCCTTTTGGCTTGCATGG - Intergenic
1097754159 12:63390425-63390447 CTATTATCATTTGCCTATCTAGG + Intergenic
1098761344 12:74429062-74429084 CTACTACTACTTGGCTGGCACGG + Intergenic
1101564037 12:105888477-105888499 CTATTTCTATTTGTCTAGTATGG + Intergenic
1104578320 12:129989082-129989104 CTATGACCATTGTTCTAGCAGGG - Intergenic
1109663585 13:65498176-65498198 CTATTACCATCTCCCTATCAAGG + Intergenic
1110472346 13:75874268-75874290 CTATGACCCCTTGTCTAGCAAGG + Intronic
1112817518 13:103290484-103290506 CTATTACAAATTAGCTAGAAGGG + Intergenic
1115130608 14:30048565-30048587 CAATTTGCATTTGGCTGGCAAGG + Intronic
1129855632 15:78822760-78822782 CTAGTAGCAATGGGCTAGCATGG - Intronic
1129987184 15:79928433-79928455 GTTTCACCATTTGGCTAGGATGG + Intergenic
1137909515 16:52362336-52362358 CTATAATCATTTGGCTAAGAAGG + Intergenic
1145021745 17:19437206-19437228 ATATTACAATTTGTCTAGTAAGG + Intergenic
1149010357 17:51850325-51850347 CCAAGACCATTTGACTAGCATGG - Intronic
1158978831 18:62738593-62738615 CCAGTACCACTTGGATAGCAAGG + Intronic
1160278630 18:77464685-77464707 CCATTACCAGATGGTTAGCAAGG + Intergenic
1166842920 19:45709904-45709926 CTATCACCATTTTGCTGGAAGGG - Intergenic
1167732576 19:51269607-51269629 CTACTAGCATCTGGCTAGAAAGG - Intergenic
926235760 2:11042306-11042328 CTCTGACCACTTGGCTAACATGG - Intergenic
926509815 2:13761081-13761103 CTCTTTCCATTTGGCTTGCAGGG - Intergenic
926903696 2:17785962-17785984 CTTTTTCCTTTTGGGTAGCATGG + Exonic
931580931 2:63773419-63773441 CAATTACCATTTAGAAAGCAGGG + Intronic
935760769 2:106318634-106318656 CATTTACCATATGGCAAGCATGG - Intergenic
937684873 2:124684528-124684550 CAATAACCTTTTGGCTATCAAGG - Intronic
938806958 2:134814968-134814990 CTCTTACCATTTGGTTAGAAGGG - Intergenic
943121400 2:183740548-183740570 CTATTCCTTTTTGGCTAGCTGGG - Intergenic
944620880 2:201515008-201515030 CTATTACCATTTGGCTAGCAAGG + Intronic
944683634 2:202098711-202098733 CTATTATCATATGTCTAACAAGG + Intronic
945112482 2:206374457-206374479 CTATTTCCTTTTGGTTATCAAGG + Intergenic
1172239327 20:33401903-33401925 CTTTTTCAATGTGGCTAGCAGGG + Intergenic
1177816813 21:25986789-25986811 CTGTTATCATTTGGCCAACATGG - Intronic
1181150698 22:20881265-20881287 CTAAGGCCCTTTGGCTAGCATGG - Intronic
949425025 3:3907476-3907498 CCATAAGCATTTGGCAAGCATGG + Intronic
951249481 3:20378105-20378127 TTATTACCATTTTACAAGCATGG - Intergenic
957944507 3:87045716-87045738 CTATTACCATGTAGAAAGCATGG + Intergenic
963410797 3:144925290-144925312 CCATGACCATTTGGCAAGCCTGG + Intergenic
963425750 3:145120513-145120535 CTATTTCGATTTGGCAAGTATGG - Intergenic
965534888 3:169813438-169813460 CTATTACCATTTCAGTATCAAGG - Intergenic
966936583 3:184713748-184713770 CTAATACCACTTACCTAGCAGGG - Intergenic
972178813 4:36440224-36440246 CTATTCCCATTTGGCCATCTTGG + Intergenic
972735704 4:41839173-41839195 CCATGACCATTTGGTTGGCATGG - Intergenic
973576187 4:52291581-52291603 ATATTGGCATTTGGCTAGCAGGG - Intergenic
975161670 4:71131749-71131771 CTAGTTCCATTTGAATAGCAGGG + Intergenic
975915616 4:79322143-79322165 CTCTTACCATTTTGGTAGCAAGG - Intronic
981932922 4:150209719-150209741 CTTTTAGAATTTGTCTAGCAGGG + Intronic
984372361 4:178883932-178883954 CTGTTACTATTTGGCTATCTTGG - Intergenic
993884602 5:93401003-93401025 ATGTTTCCATTTTGCTAGCAAGG + Intergenic
994589525 5:101755908-101755930 CTATAACCATTTGGCCCTCAGGG + Intergenic
1000661571 5:163945838-163945860 CTATTACATTTTCTCTAGCAAGG + Intergenic
1007224567 6:40303603-40303625 CTCTTACCATATGCCAAGCATGG + Intergenic
1013996035 6:116309375-116309397 CTATTATCTATTGTCTAGCATGG + Intronic
1024202512 7:47121436-47121458 CTGTTTCCATATGGCCAGCATGG + Intergenic
1031660996 7:124423934-124423956 CTGTTACCACTTAGCTTGCAGGG - Intergenic
1032059265 7:128710213-128710235 CTTTTAGAATTTGTCTAGCAGGG - Intronic
1032601146 7:133296791-133296813 CAATTTCCATTTGGCTTGCTTGG + Intronic
1032875790 7:136036928-136036950 ATATCAACATTTGGGTAGCATGG - Intergenic
1033531243 7:142266125-142266147 GTTTCACCATTTGGCCAGCATGG - Intergenic
1035758681 8:2053526-2053548 CTGTTACCATTTTACCAGCAGGG - Intronic
1036494063 8:9253270-9253292 CAATCACCATTTAGCTATCAAGG - Intergenic
1041032507 8:53752464-53752486 CTATTATCATTTGGCAGGAATGG - Intronic
1041988149 8:63952198-63952220 CTATAACCATTAGACTAGCTAGG + Intergenic
1043990092 8:86742097-86742119 CAATTACTATTTGCCAAGCAAGG - Intronic
1046171584 8:110515124-110515146 CTATTCCCATTAAGCTACCATGG + Intergenic
1046344296 8:112902361-112902383 CCATTTCCATTTGACAAGCACGG - Intronic
1050719127 9:8564897-8564919 CACTTACAATGTGGCTAGCATGG - Intronic
1050751670 9:8946075-8946097 GTATTTACATTTTGCTAGCAAGG - Intronic
1051612473 9:18974792-18974814 CCATCACCATTTGGCAACCATGG + Intronic
1055310970 9:74979149-74979171 CTATTTCTCTTTGACTAGCAAGG - Intergenic
1059098882 9:111450251-111450273 CTCTTACTATTAGGATAGCAAGG - Intronic
1186983636 X:14986127-14986149 CTATTACCATTTTGCCACCATGG - Intergenic
1192117494 X:68425353-68425375 GTTTGACCATTTGACTAGCATGG + Intronic
1193732367 X:85116550-85116572 CTAGTAACATTTGGCTGGTAAGG - Intergenic
1198041665 X:132859116-132859138 CTATTCCCATGTGGCTAGAAAGG - Intronic
1201407947 Y:13667203-13667225 CTAGTCCCATATGGCTTGCATGG + Intergenic