ID: 944620882

View in Genome Browser
Species Human (GRCh38)
Location 2:201515016-201515038
Sequence ATTTGGCTAGCAAGGCCTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 98
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 85}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944620875_944620882 11 Left 944620875 2:201514982-201515004 CCAGGTCAGATGCACCCCTAAAC 0: 1
1: 0
2: 0
3: 7
4: 69
Right 944620882 2:201515016-201515038 ATTTGGCTAGCAAGGCCTGTTGG 0: 1
1: 0
2: 1
3: 11
4: 85
944620878_944620882 -5 Left 944620878 2:201514998-201515020 CCTAAACACACTATTACCATTTG 0: 1
1: 0
2: 5
3: 37
4: 519
Right 944620882 2:201515016-201515038 ATTTGGCTAGCAAGGCCTGTTGG 0: 1
1: 0
2: 1
3: 11
4: 85
944620874_944620882 28 Left 944620874 2:201514965-201514987 CCAAAATGATGCTAGGACCAGGT 0: 1
1: 0
2: 0
3: 9
4: 170
Right 944620882 2:201515016-201515038 ATTTGGCTAGCAAGGCCTGTTGG 0: 1
1: 0
2: 1
3: 11
4: 85
944620877_944620882 -4 Left 944620877 2:201514997-201515019 CCCTAAACACACTATTACCATTT 0: 1
1: 0
2: 3
3: 22
4: 267
Right 944620882 2:201515016-201515038 ATTTGGCTAGCAAGGCCTGTTGG 0: 1
1: 0
2: 1
3: 11
4: 85
944620876_944620882 -3 Left 944620876 2:201514996-201515018 CCCCTAAACACACTATTACCATT 0: 1
1: 0
2: 2
3: 15
4: 165
Right 944620882 2:201515016-201515038 ATTTGGCTAGCAAGGCCTGTTGG 0: 1
1: 0
2: 1
3: 11
4: 85

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944620882 Original CRISPR ATTTGGCTAGCAAGGCCTGT TGG Intronic
907848707 1:58233661-58233683 ACCTGGCTAGCAAGGCAGGTGGG + Intronic
913118688 1:115719807-115719829 ATCTGGGTAGCAAAGGCTGTGGG - Intronic
1062795592 10:342587-342609 ATGTGGCCAGCAAGACCTGCTGG + Intronic
1063447681 10:6129832-6129854 ATTTGGCTGGCCAGGCGTGGTGG - Intergenic
1064092882 10:12399969-12399991 ATGTGACTAGAGAGGCCTGTAGG + Intronic
1068345488 10:55772640-55772662 ATTGGGCTAGCAATGGCTTTTGG + Intergenic
1074135600 10:110623891-110623913 AAATAGCTACCAAGGCCTGTGGG + Intergenic
1085708083 11:78804805-78804827 ATTTGGCTAGAAGGGCAGGTGGG + Intronic
1086578400 11:88367537-88367559 ACTTGGTTAGCAACTCCTGTGGG - Intergenic
1090534627 11:127627044-127627066 ATTGGGCAAGGAAGGCCTGGAGG + Intergenic
1097058008 12:56261856-56261878 AATTGGCTTGGTAGGCCTGTTGG + Intergenic
1104265150 12:127225265-127225287 ATATGGCTGGGAAGGCTTGTTGG - Intergenic
1109285415 13:60402839-60402861 AATTGGCTAGCCAGGCGTGGTGG - Intronic
1112767310 13:102759587-102759609 TTTTTGCTAGCAGGGTCTGTTGG + Intergenic
1116984569 14:51205034-51205056 CTCTGCCTCGCAAGGCCTGTGGG - Intergenic
1118170451 14:63383949-63383971 ATGTGGCTAGAAAAGACTGTGGG - Intronic
1127240833 15:57112191-57112213 ATTTGGGTAGAAAGGCCTGGGGG + Intronic
1127672344 15:61207284-61207306 CCTTGGCTAGCACGTCCTGTAGG - Intronic
1141936208 16:87240156-87240178 AATTGTCTAGCAAGCCCTGCGGG + Intronic
1147414447 17:40278460-40278482 ATGTGGCTAGCAGGGCTTGCTGG - Exonic
1150735106 17:67730025-67730047 ATTTGGCTAGCCAGGCGTGGTGG - Intronic
1151154030 17:72111869-72111891 ATTTGGGCAGCAAGGTCTGGGGG + Intergenic
1151974385 17:77476101-77476123 ATTTGGCCAGCAAGGCTGATGGG + Intronic
1152420101 17:80188086-80188108 AGTTGGTTATCAAGGCCTCTTGG + Intronic
1158964711 18:62612197-62612219 GTTTTGCTAGCAAGGCAAGTGGG + Intergenic
1164460883 19:28446536-28446558 ATTTGGATATCAAAGCTTGTCGG - Intergenic
927249347 2:20983687-20983709 CTCTAGCTAGCAATGCCTGTTGG + Intergenic
932337030 2:70937444-70937466 ATTTCTCAAGCAAGGCCTGTAGG + Intronic
933821490 2:86116233-86116255 ATTTAGCTAGAAAGACTTGTGGG + Intronic
934131118 2:88950044-88950066 ATCTGGCCAGCAATGCATGTAGG - Intergenic
934233430 2:90207769-90207791 ATTTGGCCAGCAATGCATGAAGG + Intergenic
935124759 2:100213748-100213770 ATTTGGCTAATGAGGCCTCTTGG + Intergenic
935455472 2:103262501-103262523 GCTTAGCTAGGAAGGCCTGTAGG - Intergenic
935792834 2:106609727-106609749 GTTTGGCCTACAAGGCCTGTGGG - Intergenic
935840036 2:107098949-107098971 ATTTAGGTAGCACGGCCTGGGGG + Intergenic
937224678 2:120361575-120361597 ATATGGCCTGCAAGGCCTTTAGG + Intergenic
944620882 2:201515016-201515038 ATTTGGCTAGCAAGGCCTGTTGG + Intronic
1169055829 20:2619924-2619946 ACTTGGCTAGCCAGGCATGGTGG + Intronic
1169868312 20:10224310-10224332 ACTTGGGTAGCAAGGCCTGAAGG + Intronic
1170467092 20:16631955-16631977 ATTTGGCTAACAAGATTTGTTGG + Intergenic
1171329519 20:24325436-24325458 TTTAGGGTAGCAAGGCCTGATGG + Intergenic
1172156113 20:32826070-32826092 ATTTTTCTAGGAAAGCCTGTAGG + Intronic
1172158532 20:32847416-32847438 GTGTGCCTAGCAAGGTCTGTAGG + Intronic
1173964015 20:47098194-47098216 ATATGTCTAGCAGTGCCTGTGGG + Intronic
1175316456 20:58051597-58051619 ATTTCACTAGCAAGGTATGTGGG - Intergenic
1178503655 21:33145947-33145969 ATTTGGCTGGAAATTCCTGTCGG + Intergenic
1182062495 22:27407929-27407951 ATGTGGCCAGCACAGCCTGTCGG - Intergenic
1183591558 22:38782070-38782092 CTGTGGCTGGCCAGGCCTGTAGG + Intronic
949368726 3:3311204-3311226 ATTTTGCTAACAAGGCTTCTTGG + Intergenic
953192560 3:40701358-40701380 ATGTGGCTGCCAAGGCCTGTGGG + Intergenic
956802663 3:72775648-72775670 ATTTGGCTTGCAAACTCTGTGGG - Intronic
957026379 3:75187090-75187112 ATTAGGCTAGCATGTCCTCTAGG + Intergenic
957892233 3:86375449-86375471 ATTTGTCTAGAACTGCCTGTCGG - Intergenic
960029235 3:113041179-113041201 CTTTGGCTGCCAAGGCTTGTTGG - Intergenic
961311686 3:126006169-126006191 ATTTGGCTAGTCAGGCCAGGGGG + Intergenic
961855630 3:129868249-129868271 ATTTGGGTAGAAATGCCTTTTGG - Intronic
963500723 3:146122148-146122170 ATCTTGCTGGCAAAGCCTGTGGG + Intronic
964739839 3:159953773-159953795 ACTAGGCTAGCAAGCCCTGTGGG + Intergenic
968540969 4:1168247-1168269 ATCTGGCTGGCTTGGCCTGTGGG - Intronic
975430684 4:74287457-74287479 ATTTGGCTAGCCAGGCATGGTGG + Intronic
977718142 4:100207249-100207271 ATGAGGCTTGCAAGGCCTTTTGG - Intergenic
983558899 4:169082097-169082119 ATTTGGCTATCAATTCCTATTGG + Intergenic
984753122 4:183297829-183297851 ATGTGGTTAGCATGGCCTTTGGG - Intronic
990310563 5:54533983-54534005 ATTTGGTCAGCGTGGCCTGTTGG - Intronic
993011472 5:82488286-82488308 GTTGGGAAAGCAAGGCCTGTGGG + Intergenic
993502582 5:88679904-88679926 ATTTGGCAAGCAACGCTTTTGGG + Intergenic
997136330 5:131330143-131330165 ATTTGGCTAGGAAGGCTGGAAGG + Intronic
1000832934 5:166126632-166126654 ATGTGGCTAGGAAGGACTATTGG + Intergenic
1001223984 5:169928113-169928135 GTTTGGCTGGGAAGGCCTGAAGG - Intronic
1004315582 6:14584469-14584491 ATTTGCCTACCAAGGCTTTTAGG - Intergenic
1004895319 6:20142427-20142449 ATTTTACTAGCAATGCATGTTGG + Intronic
1007395164 6:41573561-41573583 GTTTGGTTAGCAAGGCCTTCTGG + Intronic
1007912620 6:45531200-45531222 ACTTTGCTACAAAGGCCTGTTGG + Intronic
1009910026 6:69914311-69914333 ATTTGGCTAGCAGGGCCTAGAGG - Intronic
1011843428 6:91530343-91530365 ACCTGGCTCCCAAGGCCTGTAGG + Intergenic
1012865603 6:104614691-104614713 TTTTGGCTAGGAAAGCCTTTAGG - Intergenic
1015450756 6:133363849-133363871 ATTTGACAACCCAGGCCTGTTGG - Intronic
1016225003 6:141724034-141724056 ATTTGCCCAGCAAGGCCTGTTGG + Intergenic
1017753380 6:157509588-157509610 ATTTGGCTTGCAGGGCATCTTGG - Intronic
1028580533 7:92404790-92404812 ATGTGACTAGCAAGGCCTGCTGG - Intergenic
1029853674 7:103490839-103490861 ATTTGTCTAACAAAGCCTTTTGG - Intronic
1033957285 7:146866611-146866633 ATTTGGCTGGCACGGCAAGTGGG + Intronic
1041757501 8:61330441-61330463 ATTTGGATAGCATGGGCTGCAGG + Intronic
1042019387 8:64354829-64354851 ATTTGGCCAGCAAGGCTTCCTGG + Intergenic
1048410268 8:134165116-134165138 TTTTGCCTACCAAGGCTTGTTGG - Intergenic
1049725739 8:144145042-144145064 ATTTGCCAAACAAGGCCTGAGGG - Intergenic
1052408938 9:28097943-28097965 ATTGGCTAAGCAAGGCCTGTTGG - Intronic
1052467456 9:28847224-28847246 ATTAGCCTACCAAGGCCTGTAGG - Intergenic
1056780111 9:89542936-89542958 ATTTTTATAGCAAGGCCTGAGGG - Intergenic
1058923675 9:109641076-109641098 CCTTGGCTAGCAGGGCCTGGGGG + Intronic
1059205701 9:112462854-112462876 ATTTGGCTGGCTAGGGCTTTGGG - Intronic
1060538310 9:124410775-124410797 ATGTGTCTAGCATGGCCTGTGGG - Intronic
1060588713 9:124802620-124802642 ACTCTGCCAGCAAGGCCTGTGGG + Intronic
1194004496 X:88473828-88473850 ACTTGGCTAGCAAGTCATGAGGG - Intergenic
1195214208 X:102682006-102682028 ATTTGGTAAGGAAGGCCTATTGG + Intergenic
1196937056 X:120740619-120740641 ATTTAGCTAGGATGTCCTGTGGG - Intergenic
1198240660 X:134782268-134782290 ACATGGTTAGCAAGGCCTATTGG + Intronic
1198713723 X:139533718-139533740 CTGTGGTAAGCAAGGCCTGTAGG + Intronic