ID: 944620883

View in Genome Browser
Species Human (GRCh38)
Location 2:201515022-201515044
Sequence CTAGCAAGGCCTGTTGGTTT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 162
Summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 139}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944620878_944620883 1 Left 944620878 2:201514998-201515020 CCTAAACACACTATTACCATTTG 0: 1
1: 0
2: 5
3: 37
4: 519
Right 944620883 2:201515022-201515044 CTAGCAAGGCCTGTTGGTTTAGG 0: 1
1: 0
2: 2
3: 20
4: 139
944620877_944620883 2 Left 944620877 2:201514997-201515019 CCCTAAACACACTATTACCATTT 0: 1
1: 0
2: 3
3: 22
4: 267
Right 944620883 2:201515022-201515044 CTAGCAAGGCCTGTTGGTTTAGG 0: 1
1: 0
2: 2
3: 20
4: 139
944620875_944620883 17 Left 944620875 2:201514982-201515004 CCAGGTCAGATGCACCCCTAAAC 0: 1
1: 0
2: 0
3: 7
4: 69
Right 944620883 2:201515022-201515044 CTAGCAAGGCCTGTTGGTTTAGG 0: 1
1: 0
2: 2
3: 20
4: 139
944620876_944620883 3 Left 944620876 2:201514996-201515018 CCCCTAAACACACTATTACCATT 0: 1
1: 0
2: 2
3: 15
4: 165
Right 944620883 2:201515022-201515044 CTAGCAAGGCCTGTTGGTTTAGG 0: 1
1: 0
2: 2
3: 20
4: 139

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944620883 Original CRISPR CTAGCAAGGCCTGTTGGTTT AGG Intronic
902325051 1:15694480-15694502 GCAGCAGGGCCGGTTGGTTTGGG + Intronic
907760104 1:57349258-57349280 CTACCAGTGCCTGATGGTTTGGG - Intronic
908314417 1:62918939-62918961 CTGACAAGGCCTCTTAGTTTTGG + Intergenic
908896679 1:68909149-68909171 TTAGCAAGGCCTGGTGGTGCGGG + Intergenic
910412438 1:86961683-86961705 CTAGAAAGAGCTGTTAGTTTTGG - Intronic
912942456 1:114057035-114057057 CTAGCAAGGCTTCATGGTCTGGG + Intergenic
923284638 1:232481601-232481623 CTAACAAGGCTTGTTGTTCTGGG + Intronic
923974118 1:239240535-239240557 CCAGCAAGGCCTGTCAGCTTCGG + Intergenic
1063769351 10:9180113-9180135 CAAGCACTGCCTGATGGTTTTGG + Intergenic
1065198513 10:23290296-23290318 ATAGCAAGGCTTTTTAGTTTTGG - Intronic
1065864913 10:29906272-29906294 CCAGCAAGGCCTGTCTGTCTAGG + Intergenic
1065977973 10:30860242-30860264 CCAGCAAGGCTTGTCTGTTTTGG - Intronic
1066125547 10:32338276-32338298 CCAGCAAGTTCTGTTGGTTCTGG + Intronic
1069763354 10:70831808-70831830 CCAGCAAGGCCTGTCTGTTCAGG + Intronic
1073475154 10:103747714-103747736 CTGGCCAGGCCTGTGGTTTTGGG - Intronic
1077799835 11:5526639-5526661 CTTGGAAGACCTGTTGGCTTTGG - Intronic
1083665961 11:64274836-64274858 CTAGCCAGGCATGGTGGTGTGGG + Intronic
1085421841 11:76369497-76369519 TTAGAAAGGCCTGTTTGTTAAGG + Intronic
1086293452 11:85337363-85337385 CTAGCCAGGCCTGATGGTTCAGG - Intronic
1087021964 11:93611923-93611945 CTAGCAAAGCCAGGTGATTTAGG - Intergenic
1089325171 11:117652017-117652039 CCAGCAAGGCCTGGTGCTCTTGG + Intronic
1092344344 12:7703122-7703144 TTAGCCAGGCCTGGTGGTGTAGG - Intergenic
1092443604 12:8532099-8532121 TTAGCAAGGCCTGTTTGTTCAGG + Intergenic
1092607164 12:10133205-10133227 TTAACAAGGCCTGTTTGTTCAGG + Intergenic
1095541301 12:43311317-43311339 CCAGCAAGGCCTGTCTGTCTAGG - Intergenic
1097503618 12:60437776-60437798 CCAGCAAGGCCTCTCCGTTTAGG + Intergenic
1100268400 12:93000336-93000358 CCAGCAAGGCCTGTCTGTTAAGG - Intergenic
1100573234 12:95862566-95862588 CTAGCTAGGCATGATGGTGTGGG + Intronic
1100950823 12:99847539-99847561 CCAGCAAGGCCTGTCAGTTGAGG - Intronic
1101250242 12:102926944-102926966 TTAGCAAGCACTGTTTGTTTGGG + Intronic
1105072277 12:133241923-133241945 CAAGCAAGACCTGTGGGGTTTGG + Intergenic
1107045841 13:35991200-35991222 TTAGCAAGGCCTGTTTGTTCAGG - Intronic
1110081991 13:71325435-71325457 GTAGCCAGGCCTGCAGGTTTGGG - Intergenic
1110906338 13:80895460-80895482 CTAGCAGGGCCTGTTTGTTCAGG + Intergenic
1112440810 13:99423371-99423393 TTAGCAAGGCTTGTTTGTTCAGG - Intergenic
1112460810 13:99602226-99602248 TTAGCAAGGCCTGTTTGCTCAGG - Intergenic
1112488624 13:99842224-99842246 TTGGCAAGGCCTGTTTGTTCAGG + Intronic
1116594886 14:46828402-46828424 CTGGCTAGCCCTGTTGATTTGGG - Intergenic
1116651193 14:47595141-47595163 CTATAAAGGCCTGTTGTATTTGG + Intronic
1119279842 14:73396492-73396514 CTAGCCAGGCCTTGTGGTATGGG - Intronic
1120464986 14:84845092-84845114 ACAGCAAGGCCTGTTTGTCTAGG + Intergenic
1120728693 14:87977438-87977460 CTAGTATGCCCTGTTAGTTTTGG - Intronic
1124090415 15:26594640-26594662 CTAGCCAGGCATGTTGGTGCAGG - Intronic
1124923264 15:34047039-34047061 CTAGCAGGGCTTTTTTGTTTTGG + Intronic
1124991671 15:34680431-34680453 CTAGCAAGGCCCATTGCTCTAGG + Intergenic
1125254256 15:37745005-37745027 CTAGCAAGGCTAGTGGGTCTTGG - Intergenic
1127573600 15:60268052-60268074 CTCGTAAGGACTGTTGCTTTGGG + Intergenic
1127941050 15:63696179-63696201 CTAGCAGGGTGTTTTGGTTTAGG - Exonic
1133237350 16:4393440-4393462 CTAGCCAGGCAGGGTGGTTTTGG - Intronic
1133799364 16:9072558-9072580 TTGGCAAGGCCTTTTTGTTTAGG + Intergenic
1134558119 16:15183903-15183925 CTGGAAAGGCGTGTTGGTTTGGG - Intergenic
1134918652 16:18095505-18095527 CTGGAAAGGCGTGTTGGTTTGGG - Intergenic
1135572556 16:23560057-23560079 CTAGCCAGGCTTGTTGACTTGGG - Intronic
1137245390 16:46699175-46699197 CTGGCAAGGCCTGTGGTATTGGG + Intergenic
1138330076 16:56206368-56206390 CAAGGAAGGCCTGTTGGCTATGG + Intronic
1140589984 16:76340291-76340313 GAAGCAAGGCCTGTGGGATTTGG - Intronic
1141647081 16:85373339-85373361 CTATCATGGGCTGTTTGTTTGGG + Intergenic
1144113740 17:12065443-12065465 CTAGCCAGGCATGGTGGTGTAGG - Intronic
1147752023 17:42741833-42741855 TTAGCCAGGCCTGGTGGTGTGGG - Intronic
1148484417 17:47981554-47981576 ATAGCCAGGGCTGTTGTTTTGGG + Exonic
1151944740 17:77313370-77313392 CTGGGCAGGCCTGTTGCTTTAGG - Intronic
1153920588 18:9785694-9785716 CCAGCAAGGCCTGTGTGTTCAGG - Intronic
1156190897 18:34719192-34719214 CTAGCCAGGCATGGTGGTGTGGG + Intronic
1163753163 19:19090714-19090736 TTAGCAAGGCCTGTTTGTTCAGG + Intronic
1165679500 19:37761673-37761695 CCAGCAAGGCCTGTCTGTCTAGG - Intronic
1166144718 19:40826149-40826171 CTAGCGAGGCCTGGTGGTCGTGG + Intronic
1166183025 19:41122058-41122080 CTAGCGAGGCCTGGTGGTCGTGG - Exonic
1166454282 19:42927405-42927427 CAAGCAAGAGCTGGTGGTTTTGG + Intronic
1168672442 19:58250849-58250871 CTGGCAAAGACTGTTGGCTTTGG - Intronic
928533911 2:32220540-32220562 CAAACAAGGCCTTATGGTTTTGG + Exonic
929619950 2:43344374-43344396 GCAGAAAGGCATGTTGGTTTTGG + Intronic
931229116 2:60359116-60359138 CTAGCAAGCCATATTGATTTTGG - Intergenic
931746440 2:65295450-65295472 CTTGGAAGCCCTGTTGGTTATGG - Intergenic
932966942 2:76487260-76487282 CTAGCAAAGACTGTTGCATTTGG + Intergenic
935463378 2:103365497-103365519 CAAGCCAGGCTTGTTGTTTTTGG - Intergenic
935927307 2:108083550-108083572 CCAGAAAGGCCTGGTGGTTGAGG + Intergenic
936097690 2:109545385-109545407 ATCGCAAGGCGTGTAGGTTTGGG - Intronic
936472164 2:112808898-112808920 CTGGCAAGGCCAATGGGTTTGGG + Intergenic
938201467 2:129376330-129376352 CTGTCAAGAGCTGTTGGTTTAGG + Intergenic
942222739 2:173787333-173787355 TTAGCAAGGCCTGTTGGTTCAGG - Intergenic
942667930 2:178341823-178341845 CCTGCAAGACCTGTTGGTTTGGG - Intronic
944620883 2:201515022-201515044 CTAGCAAGGCCTGTTGGTTTAGG + Intronic
944886070 2:204063871-204063893 TTAGCAAGGCCTGTTTGTTCAGG - Intergenic
948903551 2:240967598-240967620 CTCGCCAGGCCTGGTGGTTTGGG - Intronic
1171906904 20:30906615-30906637 TTAGCCAGGCCTGTTGGCATAGG + Intergenic
1174075902 20:47936776-47936798 CTGTCAAGGTCTGTTGGCTTTGG - Intergenic
1174141729 20:48419292-48419314 CTGTCAAGGCCTGTTGGGTTTGG + Intergenic
1174978623 20:55364354-55364376 CTTGCAAGACCTGTTATTTTGGG + Intergenic
1178848495 21:36193377-36193399 TTAGCAAGGCCTGTTTGTTCAGG + Intronic
1179963439 21:44785177-44785199 CTAGCATGGCCTGCTGCTCTTGG - Intronic
949677603 3:6474646-6474668 CTAGCTAGAACTGTTGATTTGGG - Intergenic
951114186 3:18840418-18840440 CTTGCAATGCCTGTTTGGTTAGG - Intergenic
952662200 3:35865303-35865325 ATCGCAAGAACTGTTGGTTTTGG - Intergenic
954715185 3:52523396-52523418 AGAGCAAGGCCTGTTGGCCTGGG - Intronic
954765833 3:52915261-52915283 CAGCCAAGGCCTTTTGGTTTGGG - Intronic
956140566 3:66142562-66142584 TTAGCAAGGCCTGTTTGTTCAGG - Intronic
961045120 3:123702865-123702887 CTAGCAAGCTCTGTGTGTTTAGG - Intronic
961338842 3:126203735-126203757 CTAGCAGGGCCTGATGGCTAAGG + Intergenic
962104854 3:132379929-132379951 GGATCAAGGCCTGTTGTTTTGGG - Intergenic
963677747 3:148334132-148334154 ATACCAGGGCCTGTTGGTGTTGG - Intergenic
964879711 3:161410048-161410070 CTGGCAGGGCCTGCTGGTTTCGG + Intergenic
965353837 3:167649187-167649209 CTAGGAAGACCTGTTCATTTGGG + Intronic
967725652 3:192860053-192860075 CTAACAAGGCCTGTAATTTTGGG - Intronic
970258944 4:14203196-14203218 TTTTCAAGGCCTCTTGGTTTAGG + Intergenic
970671738 4:18404538-18404560 CTAGAAATGTCTGTGGGTTTGGG + Intergenic
972853281 4:43075232-43075254 CTAGCAAGGGGATTTGGTTTTGG + Intergenic
973743997 4:53945858-53945880 CCAGCAAGGCCTGTGTGTTTAGG - Intronic
974850139 4:67394492-67394514 TTAGCAGGGCCTGTTTGTTCAGG - Intergenic
976087105 4:81417911-81417933 CCAGCAAAGCCTGTCTGTTTAGG - Intergenic
976639067 4:87318649-87318671 TTAGCCAGGCCTGATGGTGTGGG + Intronic
977372976 4:96163830-96163852 TTAGCAAGCCCTGTTTGTTCAGG + Intergenic
979167848 4:117558844-117558866 CTAGCAAGGTAGTTTGGTTTGGG + Intergenic
980458976 4:133080567-133080589 TTAGCAAGGCTTGTTCATTTAGG - Intergenic
981048787 4:140291078-140291100 CCAGCAAGCCCTGTTGTGTTGGG - Intronic
981279182 4:142937365-142937387 CTAGCAAGACTTGTTGGTCCTGG - Intergenic
984459281 4:180012511-180012533 GGAGAAAGGCCAGTTGGTTTGGG - Intergenic
986985862 5:13500545-13500567 CTAGCAGGGCAGGCTGGTTTTGG + Intergenic
987680072 5:21124304-21124326 CTCACAAGGGCTGATGGTTTAGG - Intergenic
990800511 5:59597044-59597066 ATAGCAGGGCCTATTGGATTAGG - Intronic
991477636 5:67040326-67040348 CTGGCTAGATCTGTTGGTTTGGG + Intronic
992378994 5:76218589-76218611 ACACCAAGGCCTGTTGGTTGAGG + Intronic
993034062 5:82737572-82737594 CCAGCAAGGCCTGTCTGTTCAGG + Intergenic
993971401 5:94424061-94424083 TTAGTAAGGCCTGTTTGCTTAGG - Intronic
995410817 5:111855238-111855260 CTACCAACGCTTATTGGTTTGGG + Intronic
997703668 5:135926523-135926545 CTAGCAAGGTCTGTCTGATTAGG + Intronic
1006485362 6:34335867-34335889 ATAGCCAGGCCTGGTGGTATGGG - Intronic
1006785398 6:36663204-36663226 CTAGCAAGACCTGTGGGAATGGG + Intergenic
1009842525 6:69094132-69094154 CCACCAAAGTCTGTTGGTTTCGG - Intronic
1012379406 6:98602123-98602145 CTAGGAAGGCATGCTGGATTGGG - Intergenic
1015592837 6:134838969-134838991 CTCACAAGACCTGATGGTTTTGG - Intergenic
1016901999 6:149112309-149112331 CTAGCCAGGCCTTTTGTTTGTGG + Intergenic
1017213602 6:151883528-151883550 CTCACAAGCCCTGTTGGATTAGG + Intronic
1020951447 7:14683393-14683415 CCAGCAAAGGCTGTTGCTTTTGG - Intronic
1023172350 7:37401897-37401919 TTAGCAAGGCCTGTTTGATCAGG - Intronic
1023841025 7:44097477-44097499 CTGGCAAGGCCCGTTGGTCTTGG + Intergenic
1025620103 7:63161434-63161456 TTAGCAAGGCCTGGTGGTGGAGG + Intergenic
1026708680 7:72717393-72717415 GGATCAAGGCCTGTTGTTTTGGG - Intronic
1027737712 7:81955284-81955306 CTAGCAATTTCTGTTGGATTAGG - Intronic
1027814649 7:82953340-82953362 AAAGATAGGCCTGTTGGTTTGGG + Exonic
1028606055 7:92656917-92656939 CTGGCAAGGCCTGCTTGTTCAGG - Intronic
1033215654 7:139491565-139491587 TTTGCAAGGCCTGTTTGATTTGG - Intergenic
1034490739 7:151391916-151391938 CTAGGAAGGCCTGGTGGCTGAGG - Intronic
1035353781 7:158265169-158265191 CTAGCAAGGCCTCTCGGTAGTGG + Intronic
1035452936 7:158990161-158990183 CTAGAAAGAGCTGTTGGTCTCGG + Intergenic
1035492868 7:159295363-159295385 CAAGCAAGACCTGTGGGGTTTGG + Intergenic
1036460562 8:8948719-8948741 GTAGCCAGGCCTGTTTGTTCAGG - Intergenic
1040588200 8:48764292-48764314 CGAGCAAGGCCTGTGGGTTTGGG - Intergenic
1041747076 8:61219305-61219327 ATACCAAGGCCTGTTGGTGGGGG - Intronic
1042938333 8:74082827-74082849 TTAGCAAGGCCTGTTTGTTCAGG + Intergenic
1048745957 8:137615396-137615418 CTTGCATGGGCTGTTTGTTTTGG - Intergenic
1049158537 8:141082510-141082532 CCAGCAAGGCCTGTCTGTTCTGG + Intergenic
1050206803 9:3204931-3204953 CCAGCAAAGCCTGTTTGTTCAGG - Intergenic
1050238119 9:3604644-3604666 CCAGCAAGGCCTGTTCATCTAGG + Intergenic
1051522215 9:18001816-18001838 GTAGGAATGCCTGTTAGTTTTGG + Intergenic
1053052874 9:34976428-34976450 TTAGCAAGAGCTGTGGGTTTGGG + Intronic
1057831794 9:98412857-98412879 CCAGCAAGGCCTGTCTGTCTAGG - Intronic
1186345891 X:8692700-8692722 TTAGCAAGGCCTGTTTGTTCAGG - Intronic
1187337196 X:18391810-18391832 CTAGCAAGTCTTTCTGGTTTGGG - Intergenic
1190712018 X:53078240-53078262 TTAGCAAGGCCTGGATGTTTAGG + Exonic
1191939826 X:66466536-66466558 TTAGCAAGGCCTGTTTGTTCAGG + Intergenic
1195024697 X:100864673-100864695 CTAGTAAGGCCTGTTTTTTGGGG - Intronic
1201421055 Y:13799450-13799472 TTAGCAAGGCCTGTTTGTTCAGG + Intergenic