ID: 944620941

View in Genome Browser
Species Human (GRCh38)
Location 2:201515521-201515543
Sequence GGTGTAATAACACCATAGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 74
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 70}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944620936_944620941 19 Left 944620936 2:201515479-201515501 CCTTGAATTTGTCAGGGTTTGTC 0: 1
1: 0
2: 0
3: 11
4: 192
Right 944620941 2:201515521-201515543 GGTGTAATAACACCATAGTCAGG 0: 1
1: 0
2: 0
3: 3
4: 70
944620939_944620941 -6 Left 944620939 2:201515504-201515526 CCACTCCTGTTGGTAGAGGTGTA 0: 1
1: 0
2: 0
3: 7
4: 89
Right 944620941 2:201515521-201515543 GGTGTAATAACACCATAGTCAGG 0: 1
1: 0
2: 0
3: 3
4: 70

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944620941 Original CRISPR GGTGTAATAACACCATAGTC AGG Intronic
908691976 1:66791829-66791851 AGTGTAATGACATCATAGACAGG + Intergenic
911311868 1:96302708-96302730 AGTGTAATAACATCAATGTCAGG - Intergenic
913256521 1:116959195-116959217 GGTGTATTAGCACCATGCTCAGG + Intronic
914874437 1:151502225-151502247 GGTTAAATTACAGCATAGTCTGG - Intergenic
923910028 1:238431141-238431163 GGTAGAATAACACCACACTCAGG + Intergenic
1064120482 10:12613954-12613976 TGTGTAATAATACCATGTTCTGG + Intronic
1070680348 10:78444702-78444724 GCTGTAATAATACCACAGACTGG + Intergenic
1072017965 10:91368620-91368642 CTTGTAATAACACTATAGTTTGG - Intergenic
1074827651 10:117226219-117226241 GGTATAACAACACCACAGACTGG - Intergenic
1078850291 11:15157308-15157330 GGTGGAAAACCACCAGAGTCAGG - Intronic
1081299447 11:41432771-41432793 GGTGTAATGAGACCAAAATCAGG + Intronic
1084946108 11:72639480-72639502 GGTGTAAGAACAGCTTAGGCTGG - Intronic
1088591439 11:111407309-111407331 TCTGTAATAACACCATAGAAAGG + Intronic
1101558291 12:105831445-105831467 GGTGACAAAACACCATAGGCTGG - Intergenic
1102934141 12:116882602-116882624 GGTGAAATGACAACAAAGTCAGG + Intergenic
1109004881 13:56860242-56860264 GGTATAATAACACCAAAGTAGGG + Intergenic
1111928617 13:94490157-94490179 GGTGTAAAACCACCAGATTCAGG - Intergenic
1113272778 13:108693180-108693202 AGTTTAAGAACACCATTGTCAGG + Intronic
1117259154 14:54012193-54012215 GGTGAAATATTACCATAATCAGG - Intergenic
1119020177 14:71104218-71104240 GGTGTAGGAACATCATAGTTTGG + Intronic
1130320167 15:82835020-82835042 GGAGTAATATCACCAGAGTGAGG - Exonic
1132337423 15:101057267-101057289 GGTGAAGTAACACAAAAGTCGGG - Intronic
1133410020 16:5560432-5560454 AGTGTAATAACACCGGAGTGCGG - Intergenic
1134494600 16:14722670-14722692 GGGTTAATGACACCATATTCTGG + Intronic
1134499983 16:14761790-14761812 GGGTTAATGACACCATATTCTGG + Intronic
1134526528 16:14948409-14948431 GGGTTAATGACACCATATTCTGG + Intronic
1134545876 16:15107937-15107959 GGGTTAATGACACCATATTCTGG - Intronic
1134580596 16:15367260-15367282 GGGTTAATGACACCATATTCTGG - Intronic
1134714105 16:16346882-16346904 GGGTTAATGACACCATATTCTGG + Intergenic
1134721978 16:16390245-16390267 GGGTTAATGACACCATATTCTGG + Intronic
1134945447 16:18321624-18321646 GGGTTAATGACACCATATTCTGG - Intronic
1134952712 16:18361776-18361798 GGGTTAATGACACCATATTCTGG - Intergenic
1136150667 16:28346381-28346403 GGGTTAATGACACCATATTCTGG - Intronic
1136166904 16:28460219-28460241 GGGTTAATGACACCATATTCTGG - Intronic
1136196072 16:28654813-28654835 GGGTTAATGACACCATATTCTGG + Intronic
1136212411 16:28768936-28768958 GGGTTAATGACACCATATTCTGG + Intronic
1136257133 16:29048848-29048870 GGGTTAATGACACCATATTCTGG + Intronic
1137354093 16:47742328-47742350 GGTGTAGTAAGTCCAAAGTCTGG + Intergenic
1139855906 16:69979896-69979918 GGGTTAATGACACCATATTCTGG - Intergenic
1140366824 16:74388183-74388205 GGGTTAATGACACCATATTCTGG + Intronic
1140769063 16:78187053-78187075 GGTTTACCAACATCATAGTCAGG + Intronic
1153624483 18:7011222-7011244 TGTTTAAAATCACCATAGTCTGG - Intronic
1154117378 18:11623104-11623126 GGGTTAATGACACCATATTCTGG - Intergenic
1168578538 19:57534329-57534351 GGTCAAATAACACCAAGGTCAGG + Intronic
929175717 2:38973445-38973467 TGTGTAATAACATCATAATAGGG - Intronic
938130308 2:128709812-128709834 GGTGTAATATCAACAGAGACAGG - Intergenic
943216702 2:185045757-185045779 GGTGTAATCACATTATTGTCTGG + Intergenic
944411311 2:199445705-199445727 GGTGTAATAACTTCCTATTCAGG + Intronic
944620941 2:201515521-201515543 GGTGTAATAACACCATAGTCAGG + Intronic
1173073164 20:39789547-39789569 GGTGTGAGAACACCAGAATCAGG + Intergenic
953588280 3:44225598-44225620 GGTGTTTCAAGACCATAGTCTGG - Intergenic
962557278 3:136566436-136566458 GCTGTAACAATACCATAGACTGG - Intronic
962878350 3:139553248-139553270 GGTGAAATAAGACCACAGCCTGG - Intergenic
964376034 3:156050025-156050047 GGTGTTATCACACCCAAGTCTGG - Intronic
967297777 3:187982142-187982164 GCAATAATAACACAATAGTCAGG - Intergenic
971444449 4:26728102-26728124 AGTGTAAGAATACCCTAGTCAGG - Intronic
977808395 4:101330887-101330909 TGTGTTATAACACCATAATAAGG + Intronic
985306182 4:188542970-188542992 AGTGTAACTACACCATGGTCAGG + Intergenic
988606277 5:32680992-32681014 GGGCTAAGAACACCATAGTGGGG + Intergenic
990182378 5:53175191-53175213 TCTATAATAACACCAAAGTCTGG + Intergenic
990605248 5:57403327-57403349 GGTGCTATAAATCCATAGTCAGG + Intergenic
999056115 5:148578869-148578891 GGTGTAAGGACACCATTGTAAGG - Intronic
1003769695 6:9285356-9285378 TCTGTAAGAACACAATAGTCAGG - Intergenic
1006181781 6:32157890-32157912 GGAGTAATAACACCATCATCAGG - Exonic
1014281435 6:119446230-119446252 GATGTAATAACACCACAGGGGGG - Intergenic
1023652039 7:42381428-42381450 GGGTTATTAACACCATAATCTGG - Intergenic
1031232160 7:119122426-119122448 GCTTTAAAACCACCATAGTCAGG - Intergenic
1031285662 7:119864039-119864061 GCTGCTATAACACCATAGACTGG - Intergenic
1031642282 7:124180078-124180100 GGTGTAATGACATTATAGTGAGG + Intergenic
1033790977 7:144791969-144791991 GGTATGGTAACACCACAGTCAGG - Intronic
1055589684 9:77798919-77798941 TGTGTAATAACACCACAATCAGG + Intronic
1056720073 9:89063907-89063929 GCTGTAACAACACCACAGGCTGG + Intronic
1186525896 X:10247997-10248019 GTGGTAATAACTGCATAGTCTGG - Intergenic
1197817769 X:130515956-130515978 GGTCTAATAACAACATATTTTGG + Intergenic