ID: 944624759

View in Genome Browser
Species Human (GRCh38)
Location 2:201559364-201559386
Sequence TGGCCTGGTGATGTGTCTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 224
Summary {0: 1, 1: 1, 2: 2, 3: 25, 4: 195}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944624759_944624768 27 Left 944624759 2:201559364-201559386 CCAGCAGACACATCACCAGGCCA 0: 1
1: 1
2: 2
3: 25
4: 195
Right 944624768 2:201559414-201559436 GGCCCAAGAAACATCCCTACGGG 0: 1
1: 0
2: 0
3: 9
4: 88
944624759_944624767 26 Left 944624759 2:201559364-201559386 CCAGCAGACACATCACCAGGCCA 0: 1
1: 1
2: 2
3: 25
4: 195
Right 944624767 2:201559413-201559435 AGGCCCAAGAAACATCCCTACGG 0: 1
1: 0
2: 0
3: 14
4: 188
944624759_944624762 6 Left 944624759 2:201559364-201559386 CCAGCAGACACATCACCAGGCCA 0: 1
1: 1
2: 2
3: 25
4: 195
Right 944624762 2:201559393-201559415 CAGCTGTGCCCCCACATCTCAGG 0: 1
1: 1
2: 5
3: 32
4: 278

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944624759 Original CRISPR TGGCCTGGTGATGTGTCTGC TGG (reversed) Intronic
900158151 1:1211782-1211804 GGGCCTGGTGCTGGGGCTGCTGG - Exonic
900376710 1:2358157-2358179 AGGCCTGGTGATGTGTGCGTGGG + Intronic
900537699 1:3187062-3187084 TGGCCTGGTGATCCTGCTGCAGG + Intronic
901552514 1:10006056-10006078 TGGCCAGGTGACGTCTCAGCGGG - Intronic
901790818 1:11653095-11653117 TGGGCAGGTGATGTGACTTCAGG - Intronic
902088535 1:13883232-13883254 TGTCTTCTTGATGTGTCTGCTGG + Intergenic
902755884 1:18548866-18548888 AGTCATGGTGCTGTGTCTGCAGG - Intergenic
902954528 1:19916048-19916070 TAGCGTGGTGATGTGCCTGTGGG + Intergenic
903327319 1:22576893-22576915 TGGCCTGGGCATGGGTCAGCCGG + Intronic
904399231 1:30244868-30244890 TGGCCTGAGGATGTGTCACCAGG + Intergenic
904464736 1:30701096-30701118 TGTCCTGGTGATGAGGCTGATGG - Intergenic
904482655 1:30803895-30803917 AGGCCGTGTGAAGTGTCTGCTGG - Intergenic
906059164 1:42937057-42937079 TGGCACTGTGATGTTTCTGCTGG - Intronic
909487315 1:76188454-76188476 TGGACTGGTGATGTTTCTAAGGG + Intronic
909869556 1:80722618-80722640 CGGCCTGGGAGTGTGTCTGCTGG + Intergenic
909898435 1:81103526-81103548 AGGTATGGTGATGTGTCTGTGGG + Intergenic
910892668 1:92033840-92033862 TGCCTTGTTGATGTGTCTTCTGG + Intronic
911582319 1:99648236-99648258 TAGCCTGGTGAGGTGTAGGCTGG - Intronic
912608598 1:111019213-111019235 AGGCCTGGATGTGTGTCTGCTGG + Intergenic
912639543 1:111332241-111332263 TGGTCTGAGGATGTGTCTTCTGG + Intergenic
912639622 1:111332760-111332782 TGATCTAGGGATGTGTCTGCAGG + Intergenic
913198954 1:116480816-116480838 TGGCCTAGTGAAGTGTCTGTGGG - Intergenic
913611584 1:120514401-120514423 TGGCATGGTAATGTGCATGCAGG - Intergenic
914579608 1:149007838-149007860 TGGCATGGTAATGTGCATGCAGG + Intronic
917721004 1:177786571-177786593 TGGGCTGGGGATGTGAGTGCTGG - Intergenic
918395316 1:184108621-184108643 TGCTCTGATGATGTGTCTGCAGG + Intergenic
920181575 1:204135067-204135089 TGCCCTGGCCACGTGTCTGCTGG + Intronic
921611904 1:217222334-217222356 AGGCCTGGTGATGAGTCTGGGGG + Intergenic
924057708 1:240140046-240140068 TGGCCTGGTGAGTGGTCTGCTGG + Intronic
1067821053 10:49530753-49530775 TTTCCTGTTGATGTCTCTGCTGG + Exonic
1071507260 10:86240317-86240339 TGTCCTAGTGATGTGTGTGCTGG - Intronic
1073175308 10:101552732-101552754 TGGCCTGGCTGTGTGGCTGCAGG - Intronic
1075415485 10:122259249-122259271 TGGAATGGGGAGGTGTCTGCAGG - Intergenic
1076926097 10:133488685-133488707 TGGCCTGAGTGTGTGTCTGCTGG + Intergenic
1076978579 11:193339-193361 TGGGCTGGTGTTGGGTCAGCTGG - Intronic
1077319814 11:1936121-1936143 TGGCCTGGTGATGGCCCTCCAGG - Intronic
1077501041 11:2909822-2909844 TGGCCACGTGATGTGGCTACTGG + Intronic
1078071472 11:8114038-8114060 TGGCCTGGTGTTGAGTCCGTGGG - Intronic
1081978974 11:47254402-47254424 TGGACTGGTGATGTGGGTGCTGG + Intronic
1083610595 11:64002478-64002500 GGGCCAGGTGATGGCTCTGCAGG + Intronic
1084582081 11:70030272-70030294 AGGGCTGCTGATGTGGCTGCCGG + Intergenic
1084751825 11:71209189-71209211 TGGCCTGGGGATGGGGCTGGAGG - Intronic
1087891986 11:103545842-103545864 TGTCCTGATGGTGAGTCTGCTGG + Intergenic
1090317126 11:125803188-125803210 TGGCCTTGTCCTGAGTCTGCTGG + Intergenic
1095829478 12:46569328-46569350 TGGCCTGGGGGCGTGTTTGCTGG + Intergenic
1096658211 12:53104897-53104919 TGGGGTGGTGATGGGTCTGCTGG - Intronic
1096680819 12:53254077-53254099 TGTCATGGTGATGGCTCTGCTGG + Exonic
1097314810 12:58160522-58160544 AGGCCTGGTTATGTGTGTGTTGG + Intergenic
1099734644 12:86551380-86551402 TGGCCTGGAGATAAGTCAGCTGG - Intronic
1100992726 12:100267533-100267555 TTGCCTGGTGACGGGCCTGCCGG + Exonic
1101438980 12:104688845-104688867 GGGCATGGTGATGAGCCTGCAGG + Intronic
1102040810 12:109799568-109799590 GGGCCTGGTGATGGGGCTGTTGG + Intronic
1104069723 12:125333902-125333924 TGGCATGGTTATATTTCTGCTGG + Intronic
1105701317 13:22937598-22937620 CGGCCTGGTGGTATGGCTGCTGG - Intergenic
1106462877 13:29988812-29988834 TGGCCTGGGGGTGTTTCTGTGGG + Intergenic
1106462919 13:29989031-29989053 TGGCCTGGGGTAATGTCTGCAGG + Intergenic
1107835633 13:44410550-44410572 TGGCCTGGTGAGGAACCTGCTGG + Intergenic
1108653945 13:52510090-52510112 TGGCCTGGGAGTGTTTCTGCGGG - Intergenic
1109897740 13:68715834-68715856 TGCCCAGGGGATGTGGCTGCTGG + Intergenic
1112098756 13:96164416-96164438 TGGCGTGGTGACGTGCCTGTAGG + Intronic
1113386025 13:109848979-109849001 TGGCCTGGGGTTGGGGCTGCAGG + Intergenic
1113493027 13:110706764-110706786 TGGGATGCTGATGTGTGTGCTGG - Intronic
1114296550 14:21334521-21334543 TGGATTGGAGATGTGTGTGCTGG + Intronic
1115023497 14:28712107-28712129 TGGCCTGGTGGTATGTCTCCTGG - Intergenic
1117184470 14:53226686-53226708 AGGTCTGGTGATATGTCTGCTGG + Intergenic
1118699659 14:68420933-68420955 TGACTTGGTGATGATTCTGCTGG + Intronic
1118859471 14:69651263-69651285 TGGGGTGGTAGTGTGTCTGCTGG + Intronic
1119217496 14:72880391-72880413 GGGTTTGGTGATGTGTCTTCAGG - Intronic
1123124760 14:105938266-105938288 TGGCCTGGGTGTGTGTCTGCTGG - Intergenic
1124393500 15:29280681-29280703 CTGCCTGGTGATGTCTCAGCTGG + Intronic
1125115044 15:36080746-36080768 TGGCCTGGAGGTGAGTCTGCTGG - Intergenic
1126713215 15:51484080-51484102 TGGCCTGGGGGTGTTTCTGCAGG - Intronic
1126792767 15:52236203-52236225 TCTCCTGGTAAAGTGTCTGCTGG + Intronic
1127904733 15:63368284-63368306 TGGCCTGGTGGTGTGGCCCCTGG + Intronic
1131019918 15:89088876-89088898 GGGCCTGGGGAGGGGTCTGCCGG + Intronic
1131253424 15:90845693-90845715 GGGCCTAGTGATGTGCCTGGTGG + Intergenic
1132572990 16:652065-652087 GGGCCTGGTGAGGTGTGGGCTGG + Intronic
1135303622 16:21350860-21350882 GGGCCTGGTTCTGTGTCTGTGGG + Intergenic
1135510697 16:23080609-23080631 TTGCCTTGTGATGTGCCTGTTGG - Intronic
1135985797 16:27183206-27183228 TGGCATGGTGATTTGCATGCTGG - Intergenic
1136300368 16:29330055-29330077 GGGCCTGGTTCTGTGTCTGTGGG + Intergenic
1138651327 16:58463268-58463290 TGGGATGGGGATGTCTCTGCAGG + Intronic
1139652202 16:68368123-68368145 TGTCCTGGTGCTCTGTCTGATGG + Intronic
1139870461 16:70104435-70104457 TGACCTAGTGATCTGCCTGCTGG - Intergenic
1140384985 16:74528114-74528136 TGACCTAGTGATCTGCCTGCTGG + Intronic
1141018335 16:80470815-80470837 TGGCCTGGAGATGCAGCTGCAGG + Intergenic
1142279475 16:89140249-89140271 TGGCCAGGGGAGGTGGCTGCAGG - Intronic
1142466010 17:137830-137852 TGGGCTGGTGTTGGGTCAGCTGG - Intronic
1143290775 17:5826250-5826272 TGCGCTGGTGAAGTGTCTGAGGG + Intronic
1144488388 17:15686596-15686618 TGGCCGGGAGATGTGTGTCCTGG + Intergenic
1144715357 17:17431617-17431639 TGGCCTGAGGAAGTGGCTGCAGG - Intergenic
1144912629 17:18695708-18695730 TGGCCGGGAGATGTGTGTCCTGG - Intergenic
1145711444 17:26982527-26982549 TGGACTGGTGCTGTGGCTGGAGG + Intergenic
1148711428 17:49684178-49684200 AGCAGTGGTGATGTGTCTGCTGG - Intergenic
1150170170 17:62986412-62986434 TGACCTGGGGATGTGTTTGCTGG + Intergenic
1150604376 17:66678313-66678335 TGGCCTGGTGATGTGGATGTTGG + Intronic
1151368329 17:73631281-73631303 TGCCCTGGTGTAGTGTCTACAGG - Intronic
1152123120 17:78431017-78431039 TGGCATGGTGGTGTGACTGTAGG - Intronic
1155261232 18:24044449-24044471 TGGCATGGTGAAGTGTCTCCAGG + Intronic
1159276838 18:66232817-66232839 TGGAATGGTGATGTGTCAGGGGG + Intergenic
1160541604 18:79627023-79627045 TGGCCCGGTGATGTGTCCGGCGG - Intergenic
1160791564 19:925945-925967 TCCCCTGGTGATTTGTCTGGGGG + Intronic
1161162120 19:2767437-2767459 TGGGCTGGGGACGTGGCTGCAGG - Intronic
1161524175 19:4743176-4743198 TGGCCTTGGTCTGTGTCTGCAGG - Intergenic
1162693890 19:12456707-12456729 TGGGCTGTTGATGTCTCTGGGGG - Intronic
1163798749 19:19352580-19352602 TGGCCTGGGGGTGTGTCAGATGG + Intronic
1163824522 19:19515596-19515618 TTGCCTTGTGAAGTGACTGCGGG + Exonic
1164856821 19:31531325-31531347 TGGCAAGGTGAGGTCTCTGCAGG - Intergenic
1166259715 19:41628668-41628690 TCCCCTGGTGAAATGTCTGCAGG + Intronic
1166331202 19:42079038-42079060 TGGCCCGGAGGTGCGTCTGCCGG - Exonic
927199102 2:20567593-20567615 TGGCCGGGGGCTGTGTCTGGGGG - Intronic
927200973 2:20577900-20577922 AGGCCTGGAAATGTGTTTGCAGG - Intronic
927524107 2:23721482-23721504 TGGCCTGGGGATGTGTCTGCAGG - Intergenic
929111333 2:38407545-38407567 TGGTCTGTGGATGTGTCTGAAGG - Intergenic
930117294 2:47729468-47729490 TGGCCTGTTGCTGTGGCAGCAGG - Intronic
931505765 2:62923917-62923939 TGGCCTGTTGATGTGTCCACTGG - Intronic
932654927 2:73602097-73602119 TGGGCAGGTGGTGTGTCTCCAGG + Intronic
933272916 2:80252815-80252837 TTGCAAGGTGATGTATCTGCAGG + Intronic
934873235 2:97887339-97887361 TGGTCTGGAGGTGTGTCTGCCGG + Intronic
935225348 2:101047666-101047688 TGGCCCTGTGATGGGGCTGCAGG - Intronic
935529745 2:104217967-104217989 TGGCCTTCTCACGTGTCTGCTGG - Intergenic
936471566 2:112803127-112803149 TGGCCTGATGATATGTCAGAAGG + Intergenic
937730543 2:125224167-125224189 TGGCCTGTGGGTGTTTCTGCTGG + Intergenic
937856313 2:126674315-126674337 GGGCCTGGGGATGGGTCTGAGGG - Intronic
937980293 2:127610794-127610816 TGGCCATGTGATGGGGCTGCAGG - Intronic
939197744 2:138993016-138993038 TGTCCTGGTGATGTAGCTGGTGG + Intergenic
940962173 2:159798015-159798037 CGGCCGGGTGTTGCGTCTGCGGG + Intronic
942594882 2:177583508-177583530 GGTCCTTGTGATTTGTCTGCAGG - Intergenic
944268969 2:197760024-197760046 TGTCCTGGGGACGTGTCTGCTGG - Intronic
944269046 2:197760392-197760414 TGGCCTGGGGGTGCATCTGCTGG - Intronic
944624759 2:201559364-201559386 TGGCCTGGTGATGTGTCTGCTGG - Intronic
945736704 2:213609824-213609846 TGTTCTGGTGATGTGTATGCAGG + Intronic
947361207 2:229347278-229347300 TAGCCTGGGAATGTGTCTGTGGG + Intergenic
947905700 2:233760326-233760348 GGGCCTGCTGCTGTGTGTGCTGG + Exonic
1169091339 20:2862987-2863009 GGGGCTGGAGATGCGTCTGCAGG + Intronic
1172771544 20:37385060-37385082 TGCGTTGGGGATGTGTCTGCGGG - Intronic
1175756965 20:61536109-61536131 TGGCCGGGTTCTGTGCCTGCAGG - Intronic
1176736159 21:10548584-10548606 TGTCCTGGATATGTGTCTGCTGG - Intronic
1179798823 21:43800993-43801015 AGGCCTGGTGGTGTTTCTGAGGG + Intronic
1180921574 22:19524207-19524229 GGGCCTGGTGCTGTGCCTGGTGG - Exonic
1181330331 22:22086125-22086147 TGGCCTGGTGCTGAGCCTGGGGG + Intergenic
1181488305 22:23245402-23245424 TGGCCTGGTGATGTCATTGTTGG + Intronic
1182085364 22:27557454-27557476 TGGCTTGCTGATCTGTCTGCCGG + Intergenic
1183508337 22:38221389-38221411 TGGCCTGGTGGTGAGGCTGGAGG + Exonic
1183910951 22:41078699-41078721 GGGCATGGTGATGTGCCTGTGGG - Intergenic
1185410471 22:50678955-50678977 TTGCCTGGTGATGGGGCTGGGGG + Intergenic
950123508 3:10497188-10497210 AGCACTGGTGATGTATCTGCTGG + Intronic
950696500 3:14704725-14704747 AAGCCTGGTGATGGGTCTCCTGG + Intronic
951219157 3:20051317-20051339 TGGGCTGATGATGTCACTGCTGG + Intronic
951705399 3:25539495-25539517 TGGCCAGGTGGTGAGTCTGTGGG - Intronic
952314749 3:32222977-32222999 TTACCTGGTGATGTTTCTTCTGG - Intergenic
952339911 3:32436838-32436860 TGGGCTGGGGAGGTGTCTGGTGG - Intronic
952495234 3:33909980-33910002 TGGGCTGGAGATGGGGCTGCTGG + Intergenic
952892026 3:38049678-38049700 TGGCTAGGTGCTGTGTCTGCAGG - Intronic
953477979 3:43222050-43222072 GGGCCTGCTGATGAGGCTGCAGG + Intergenic
956607663 3:71089262-71089284 TGCCCTTGTGATGTGGCAGCTGG - Intronic
956757258 3:72401094-72401116 TGTCCTCATGATGTGACTGCTGG - Intronic
957329998 3:78750220-78750242 TGACCTCGTGATCTGCCTGCTGG - Intronic
963236973 3:142964877-142964899 TGACCTCGTGATCTGTGTGCTGG - Intronic
963941625 3:151101667-151101689 AGGCCTGGTGGAGCGTCTGCTGG + Intronic
970186019 4:13454866-13454888 TGGCCTGGGTGTGTGTCTGCTGG + Intronic
970414987 4:15847938-15847960 TGCCCTTGTGATGTGTCACCTGG - Intronic
973826979 4:54717872-54717894 TGGCATTGTGATGTGTGTACAGG + Intronic
977996539 4:103502592-103502614 TAACCTGGTGTTGAGTCTGCGGG + Intergenic
980032243 4:127844665-127844687 TGGCCTGGAAATGTGTCCACTGG - Intergenic
982319861 4:154066949-154066971 CAGCCTGGGGGTGTGTCTGCTGG + Intergenic
984834978 4:184011029-184011051 CGGCCTGGCAATGTGTCAGCAGG - Exonic
985077117 4:186226772-186226794 TGACCTGGTGCTGGATCTGCAGG + Intronic
985476533 5:82426-82448 TGGAGGGGTGATGGGTCTGCAGG + Intergenic
989547825 5:42694951-42694973 TGCCCTGATTATGTTTCTGCTGG + Exonic
989586205 5:43075516-43075538 TGGCCAGGGAATGTGTCTTCCGG + Intronic
992945415 5:81804165-81804187 TAGCCTGGAGACATGTCTGCTGG - Intergenic
997040054 5:130242333-130242355 TTGCCTATTGCTGTGTCTGCTGG - Intergenic
999999173 5:157120847-157120869 TGGCCTGGGTGTGTGTCTGGTGG - Intronic
1003796706 6:9613272-9613294 TGGCCTGGTGCTGTGTGCACAGG - Intronic
1004116969 6:12778900-12778922 TGGCTTGGGGCTGTGTCTGCAGG - Intronic
1004182551 6:13393491-13393513 TGCGCTGTTGCTGTGTCTGCAGG - Intronic
1004811672 6:19269874-19269896 TGGCTTGGGGATGTGTCTGCTGG - Intergenic
1005706123 6:28455330-28455352 TGTGCTAGTTATGTGTCTGCTGG + Intergenic
1014745184 6:125192469-125192491 TGGCCAGATGATGTCACTGCAGG - Intronic
1015044388 6:128760661-128760683 TGGCCTGGGGTTATGTCTGTTGG - Intergenic
1017775840 6:157680265-157680287 TGGAGTGGTGAAGTCTCTGCAGG - Intergenic
1017811914 6:157989834-157989856 TGAGCTGGAGAAGTGTCTGCGGG + Intronic
1018636981 6:165871432-165871454 TGACCTGGTGAGGTGAATGCAGG + Intronic
1018902538 6:168058725-168058747 GGGCCTAGTGCTGTGTGTGCAGG - Intronic
1020952172 7:14694029-14694051 TGGCCTGGTGGTGAGTCAGTGGG - Intronic
1022399440 7:30023442-30023464 TGGCCTGCTGATGGCTCTGACGG + Intronic
1022660898 7:32365405-32365427 TGGCCTGAGGGTATGTCTGCTGG - Intergenic
1023024880 7:36041321-36041343 TGGCCTGGAGAAGTGTGTGTAGG + Intergenic
1024928027 7:54638371-54638393 TGGCATGTTGATGTTTCTGGGGG + Intergenic
1026564865 7:71481480-71481502 TGGCCTGGCCATATGTGTGCTGG + Intronic
1027624263 7:80528193-80528215 TGGCCTGGTGCTGGGGCTGATGG - Intronic
1028022352 7:85792377-85792399 TGACCTAGTGATGTACCTGCTGG + Intergenic
1029151388 7:98483026-98483048 GGGCAAGGTGATGTGGCTGCTGG - Intergenic
1030824110 7:114133692-114133714 TGGCTTGGTGCTGTGTTTTCTGG + Intronic
1031472351 7:122182248-122182270 TGCCCAGTTGATGTGTCAGCAGG - Intergenic
1031547440 7:123068028-123068050 TGGGGTGGTAATGGGTCTGCTGG + Intergenic
1032524138 7:132566777-132566799 TGGCCTTGTGATCTGCCTTCAGG - Intronic
1032683363 7:134208060-134208082 AGGCCTGGGGATGTGAGTGCGGG + Intronic
1034543894 7:151777233-151777255 AGGCCTGGGGATGACTCTGCTGG - Intronic
1034991842 7:155552611-155552633 TGGGCTGGTGATGCCTCTGGAGG - Intergenic
1037756678 8:21714768-21714790 TGGCCTGGTGTGCTGGCTGCAGG - Intronic
1039582269 8:38676571-38676593 TGGCCTGAGGAGGTGGCTGCTGG + Intergenic
1040474396 8:47763930-47763952 TGGTGTGGTGATGTGTGTGATGG + Intergenic
1047523440 8:125613307-125613329 TTGCCTGATGATGAATCTGCAGG + Intergenic
1047776247 8:128073154-128073176 AGACCTGGTGATGGGTCTGAGGG + Intergenic
1049826934 8:144674944-144674966 TGGCCTGCTTCTGAGTCTGCAGG + Intergenic
1050276820 9:4009361-4009383 TGTCCTGGTGGTGTCTCTGTTGG - Intronic
1050823605 9:9914730-9914752 TGGCCCGGGAGTGTGTCTGCTGG - Intronic
1057832213 9:98416215-98416237 TGGCTTGGTTATGGGTGTGCTGG - Intronic
1058429686 9:104907141-104907163 TGCCCTGGAGATGTGTATACAGG + Intronic
1059746653 9:117207438-117207460 TGGCCTGAAAATGTGTCTGAGGG - Intronic
1062165739 9:135106432-135106454 TGGCCTGGGGATGGGGGTGCTGG - Intronic
1187590970 X:20716931-20716953 TGGTCTGCTCATATGTCTGCAGG - Intergenic
1188666546 X:32828339-32828361 TGGCCAGGTGTGGTGACTGCTGG - Intronic
1189251459 X:39603423-39603445 TGCCCTGGAGATGTCTCTTCTGG - Intergenic
1190685694 X:52870665-52870687 TGGCTTGATGATGTGTCCTCTGG - Intergenic
1191250189 X:58256515-58256537 GGGCCTGGTGCAGTGGCTGCAGG - Intergenic
1192397703 X:70799515-70799537 TTGCCTGGTGATTTTTCTGGAGG - Intronic
1192496321 X:71618453-71618475 TGGGCTGGTGCTCTGGCTGCTGG + Exonic
1192737514 X:73863343-73863365 TGGCCTGGAGATGGGTTTGTGGG - Intergenic
1197653199 X:129087235-129087257 TGGCCTGGGTATGTGTCTGCTGG - Intergenic
1199255414 X:145713761-145713783 TGGTGTGGTGATGTGTCAGGTGG - Intergenic
1200175969 X:154116563-154116585 TGTCATGGTGATGTGCCTGGGGG + Intergenic