ID: 944624790

View in Genome Browser
Species Human (GRCh38)
Location 2:201559519-201559541
Sequence CTCTGGGCAGGAATACTCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 188
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 172}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944624783_944624790 1 Left 944624783 2:201559495-201559517 CCTATGAAACAGCCCCACAAGTT 0: 1
1: 0
2: 1
3: 16
4: 275
Right 944624790 2:201559519-201559541 CTCTGGGCAGGAATACTCCCAGG 0: 1
1: 0
2: 1
3: 14
4: 172
944624782_944624790 13 Left 944624782 2:201559483-201559505 CCACATCTGACGCCTATGAAACA 0: 1
1: 0
2: 0
3: 7
4: 80
Right 944624790 2:201559519-201559541 CTCTGGGCAGGAATACTCCCAGG 0: 1
1: 0
2: 1
3: 14
4: 172
944624781_944624790 14 Left 944624781 2:201559482-201559504 CCCACATCTGACGCCTATGAAAC 0: 1
1: 0
2: 1
3: 2
4: 56
Right 944624790 2:201559519-201559541 CTCTGGGCAGGAATACTCCCAGG 0: 1
1: 0
2: 1
3: 14
4: 172

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944624790 Original CRISPR CTCTGGGCAGGAATACTCCC AGG Intronic
900331452 1:2136717-2136739 CTCTGTGCTGCAACACTCCCTGG - Intronic
900939330 1:5787621-5787643 CTCTGGACTGGAATGCCCCCAGG + Intergenic
903953182 1:27008239-27008261 CTCAGGACAGGAATGCTGCCTGG - Intronic
904817940 1:33219801-33219823 CCCTGGGCAGGGATAGACCCAGG - Intergenic
907929144 1:58982791-58982813 CTCTGGGCAGGAACACAACCTGG - Intergenic
907953039 1:59202529-59202551 CGCAGGGAAGGATTACTCCCTGG + Intergenic
908096161 1:60741255-60741277 CACTGGGCTGGCATTCTCCCAGG + Intergenic
910519688 1:88105815-88105837 TTCTGGGCAGGAGGACTCTCTGG - Intergenic
915622215 1:157092736-157092758 CTCTGGGCAGAAGACCTCCCTGG + Exonic
915928324 1:160041318-160041340 CCCTGGTAAGGAATACTACCCGG - Exonic
917080649 1:171253791-171253813 CTCTGAGCAGTAAATCTCCCTGG - Intronic
921982466 1:221273532-221273554 CTCTTGGCAGGACTATTTCCGGG + Intergenic
922433453 1:225580138-225580160 CTCTGGGCATGAATACTAGGAGG - Intronic
922556675 1:226537826-226537848 CTTTGGGCGGGAATTATCCCAGG + Intergenic
924084456 1:240436351-240436373 CTCTGAGCAGCAAGATTCCCAGG - Intronic
924674866 1:246165604-246165626 CTCAGGCCAGGAAAACTCCCAGG + Intronic
1062794355 10:332324-332346 CTCTGGCCAGGAATTCACACTGG - Intronic
1062848440 10:725706-725728 CTCTGGGCAGGGCTGCTGCCTGG - Intergenic
1063949788 10:11211580-11211602 CTCTGGGTAATAATACTCACAGG - Intronic
1066212551 10:33254037-33254059 CTCTCGGTAGGAATCCTCTCCGG + Exonic
1070533803 10:77360565-77360587 CTCTAAACAGAAATACTCCCCGG + Intronic
1070933216 10:80275100-80275122 CTCTGGGAAGGACTACACCAAGG - Exonic
1071965394 10:90846785-90846807 TTCTGGGCAGCCATATTCCCAGG + Intronic
1072915011 10:99532573-99532595 CGCGGGGCAGGAAAACTTCCTGG - Intergenic
1074267930 10:111923946-111923968 CTCTGTGGAGGAATTCTCTCTGG - Intergenic
1076122042 10:127944158-127944180 CTCTGAGCAGTAATATTCCCTGG - Intronic
1078151977 11:8767098-8767120 CTCCAGGCTGGAACACTCCCTGG + Intronic
1079243681 11:18738283-18738305 CCCTGGGCAGCATTCCTCCCTGG + Intronic
1079303133 11:19297293-19297315 CTCTGGGCAGGACCACTGCTGGG - Intergenic
1082121596 11:48385216-48385238 TTCTGGCCAGGACTACACCCTGG - Intergenic
1082252261 11:49995403-49995425 TTCTGGCCAGGACTACACCCTGG + Intergenic
1082555575 11:54559470-54559492 TTCTGGCCAGGACTACACCCTGG - Intergenic
1083593790 11:63909672-63909694 CTCAGGGCTGGAACACTCTCAGG + Exonic
1083778869 11:64907797-64907819 CACTGGGCAGGATCACTTCCAGG + Exonic
1084101429 11:66952127-66952149 AGCTGGGCAGGAAGAATCCCTGG - Intronic
1084256442 11:67946274-67946296 CTCTGGGGAGGAAGACTCTGTGG - Intergenic
1084972372 11:72778881-72778903 TTCTGGACAGGCATACACCCTGG - Intronic
1086099911 11:83088359-83088381 CTCTGGGCAGGAAAACTAAGGGG + Intergenic
1087154443 11:94886766-94886788 CTATGGGCAGGAACACAGCCAGG - Intergenic
1087477522 11:98655250-98655272 CTCTGGGCAGAAGTAATACCTGG + Intergenic
1089496651 11:118911435-118911457 CTCTGGGGAGGAAGGCTCCTGGG + Intronic
1091894752 12:4092197-4092219 CGCAGGGCAGGAATAGACCCAGG + Intergenic
1093110652 12:15148081-15148103 CACTGGTCAGAAAGACTCCCTGG - Intronic
1094080925 12:26534247-26534269 TTCTTGCCAGGAATACTTCCTGG - Intronic
1096762086 12:53850300-53850322 CTCTGGGCAGGTGTAGACCCGGG + Intergenic
1098872707 12:75834868-75834890 ATATGGGAAGGAATACTTCCAGG - Intergenic
1104573068 12:129942329-129942351 CTCTGGGCTGGAATTGTTCCTGG - Intergenic
1104591232 12:130085886-130085908 GTCTGAGCAGCAATACCCCCTGG - Intergenic
1105335045 13:19459700-19459722 CACTGGGCAGGAATCCCCGCGGG - Intronic
1112221789 13:97498453-97498475 CTCTTGACAGGAGTCCTCCCTGG + Intergenic
1117666242 14:58059302-58059324 ATCTGGGAAGGCATGCTCCCAGG + Intronic
1119740894 14:77013101-77013123 CTCTGGGCTTGAGTCCTCCCTGG - Intergenic
1120528723 14:85607263-85607285 ATCTCGGCAGGAAAACTTCCAGG - Intronic
1124689016 15:31806271-31806293 CTCTGGACAGGACTTTTCCCTGG + Intronic
1127546111 15:59995462-59995484 AGCTGGGCTGGAATGCTCCCCGG - Intergenic
1130423719 15:83774655-83774677 CTCTTTGCAAGAATAATCCCTGG - Intronic
1130665549 15:85866437-85866459 ATCTTGGCAAGAATACTACCAGG + Intergenic
1132565315 16:619759-619781 CTCTGGGCAGGAAGCTGCCCAGG + Intronic
1132768368 16:1546662-1546684 CTCTTGGCAAGAACACTGCCAGG + Intronic
1133371596 16:5249385-5249407 CTCTGGGGAGGAAGACTCTGTGG + Intergenic
1134054913 16:11164014-11164036 CACTGGGCAGGAAGATTCCTTGG - Intronic
1135347434 16:21701090-21701112 CTCTGAGCAGCAAAACACCCAGG + Intronic
1135817004 16:25643809-25643831 CTCTGAGCAGGAACACTGCTTGG + Intergenic
1139955508 16:70691261-70691283 CCCTGGCCAGGAGGACTCCCAGG + Intronic
1141446751 16:84064260-84064282 CTCTGTGCAGGAATCCTACTAGG + Intronic
1141950357 16:87335597-87335619 CTGTGGGCAGCAATGCGCCCAGG + Intronic
1144676794 17:17167206-17167228 CTCTGAGCAGGAGGGCTCCCGGG - Intronic
1146703491 17:34981886-34981908 CACTGGGCAGCAAGACTCACAGG - Intronic
1147142188 17:38466157-38466179 CTCTGGCCAGGCCTACTCCCAGG + Exonic
1148533570 17:48418883-48418905 CTCTGGGAGGGAATACTGACTGG + Intronic
1151471255 17:74319306-74319328 TTCTGGGCATGGCTACTCCCAGG - Intergenic
1152788853 17:82267156-82267178 CTCAGGGAAGGAAGTCTCCCAGG - Intronic
1156456799 18:37299394-37299416 CTCTGGGCAGGGATGCTCCTGGG + Intronic
1157302109 18:46486528-46486550 CTCTGGGCTGGAATCTGCCCTGG - Intronic
1160012551 18:75116884-75116906 AACTGGGCAGGAAAATTCCCAGG + Intergenic
1160716490 19:579176-579198 CTCTGGGCAGGAACATCGCCAGG + Intronic
1161516241 19:4698174-4698196 CTCTGGGCAAGCACAGTCCCCGG + Intronic
1162998448 19:14351034-14351056 CTCAAGGCAGGAAGACTTCCTGG + Intergenic
1166930951 19:46301026-46301048 CTCTGGGCAGGAAGACAAACAGG + Intronic
1167396535 19:49233089-49233111 CTGTGGGAGGGAAGACTCCCTGG + Intergenic
931653268 2:64487865-64487887 CTCTGAGCTGGGATACTTCCTGG + Intergenic
931936062 2:67197867-67197889 CACTGGGCAAGAATACTCTTTGG - Intergenic
934171766 2:89546126-89546148 CTGTTGACAGGAGTACTCCCTGG + Intergenic
934282075 2:91620444-91620466 CTGTTGACAGGAGTACTCCCTGG + Intergenic
935563056 2:104578189-104578211 CTCTAGGAAAGAATACTTCCTGG + Intergenic
937379359 2:121362638-121362660 CGCTGGGCTGGAATCATCCCTGG + Intronic
940150470 2:150594972-150594994 CCTGGGGCAGGAATACTCACAGG + Intergenic
940828756 2:158443728-158443750 AGCTGGGCAGAAATATTCCCTGG - Intronic
941116749 2:161480506-161480528 CTCCTGGCAGGCACACTCCCAGG + Intronic
942636997 2:178018249-178018271 CTCTGCGATGGACTACTCCCTGG + Intronic
943105739 2:183544008-183544030 CTCTGGGCAGGAGATCTCCAGGG + Intergenic
944624790 2:201559519-201559541 CTCTGGGCAGGAATACTCCCAGG + Intronic
1169029097 20:2394509-2394531 CTCAGGGCAGGGGTACTCCTGGG - Exonic
1170487786 20:16837355-16837377 CTATGGCCATGATTACTCCCAGG - Intergenic
1171330516 20:24333615-24333637 ATCTGGGAAGGTATACTGCCTGG + Intergenic
1173280062 20:41619105-41619127 CCCGGGGCTGGAAAACTCCCGGG - Intergenic
1173718756 20:45235366-45235388 CCCCTGGCAGGAACACTCCCAGG - Intergenic
1180135477 21:45859459-45859481 CCCTGGGGAGGAAAACTCCCAGG + Intronic
1181978996 22:26752802-26752824 CCCTGGGCAGACAGACTCCCAGG + Intergenic
1182004048 22:26944291-26944313 CTGTGAGCAGGAACAGTCCCAGG + Intergenic
1183520509 22:38293884-38293906 CTCAGGGCAGTAACATTCCCTGG - Intronic
952817231 3:37456283-37456305 CTCTGGGCAGGCAGACACTCTGG - Intronic
954441387 3:50524125-50524147 GTCTGGGCAGGAATACCCAGAGG - Intergenic
956720890 3:72116651-72116673 CTCAGGGCAGGAGGACTGCCAGG + Intergenic
957071350 3:75570302-75570324 CTCTGGGGAGGAAGACTCTGTGG - Intergenic
957957206 3:87202954-87202976 CTTTGGGCAGTAAGACTCCAGGG + Intergenic
961548098 3:127650214-127650236 CTCAGGGCAGCCATAATCCCAGG - Intronic
963854351 3:150238516-150238538 CTCTGGGCAGAAATGCACCAGGG + Intergenic
964532355 3:157682247-157682269 CTCTGGGCAGCTAATCTCCCTGG - Intergenic
965615028 3:170585229-170585251 CTCTGGGCAGGGAGCTTCCCTGG + Intronic
966715751 3:183011461-183011483 CTCTTGCCAGGAAAAATCCCAGG - Intergenic
969535537 4:7754449-7754471 CCCTGGGCAGGAAAACTGTCAGG + Intergenic
969669733 4:8583029-8583051 CTCGGGGCAGTAACACTGCCAGG + Intronic
969798169 4:9541935-9541957 CTCTGGGGAGGAAGACTCTGTGG + Intergenic
969868639 4:10091609-10091631 CTCTGGGCTGGAGCACCCCCAGG - Intronic
969968350 4:11020503-11020525 TTCTGGGCAGGAATCATCTCTGG + Intergenic
970918173 4:21360529-21360551 CACTGGCTAGGAATACTTCCTGG - Intronic
973301882 4:48594380-48594402 CTCTAGGAAGGAAATCTCCCGGG + Intronic
973878942 4:55249479-55249501 CTCTGGGAAGGAATTTTACCTGG - Intergenic
975200352 4:71581149-71581171 GTCTGGGGAGGAATACTGCCTGG + Intergenic
975450569 4:74520393-74520415 TTCTGGGCAGGACTACACTCAGG - Intergenic
975791409 4:77955980-77956002 CTCTAGGCAGGAACATTCCAGGG + Intergenic
978009058 4:103656240-103656262 CTCTGGGGAGGAGAAATCCCAGG - Exonic
979896366 4:126162952-126162974 CTCTGGGCAGGGATAATACGTGG - Intergenic
980084075 4:128373598-128373620 CTCTGGCATGGAACACTCCCTGG - Intergenic
981206548 4:142047726-142047748 TCCTGTGCAGAAATACTCCCAGG + Intronic
982839166 4:160160274-160160296 CTCTGGTCAGGGATTCTCTCTGG + Intergenic
983483387 4:168303438-168303460 CTCTGAGCAGGAATAGCCCTGGG - Intronic
983989081 4:174096719-174096741 CTCTTGGCAGGTATGATCCCAGG - Intergenic
984575573 4:181444188-181444210 CTATGGGCAGGAATCCTTCCAGG + Intergenic
984590619 4:181613475-181613497 CTGAGGGCAGGCATACTCCCAGG - Intergenic
985669917 5:1201917-1201939 CCCTGGGCAGACATCCTCCCCGG + Intronic
987648786 5:20712786-20712808 CTCTGGGCATGAACAATCTCTGG - Intergenic
988747438 5:34154780-34154802 CTCTGGGCATGAACAATCTCTGG + Intergenic
990315822 5:54582326-54582348 CTCTGGGCCAGAATACTCTTAGG + Intergenic
991114905 5:62943554-62943576 CTGTGGGCTGGAATTCTCTCTGG + Intergenic
991318439 5:65339011-65339033 CTCTTGGCAGGCACACCCCCAGG + Intronic
992173726 5:74128831-74128853 CTTTGGGCAGGAAGACTACCTGG - Intergenic
994762827 5:103878260-103878282 CTCTGGGCAGCCAAACTCCAAGG - Intergenic
998315311 5:141177912-141177934 CTCTGGAGAGGACTACTCACTGG + Exonic
998319237 5:141214000-141214022 CTCTGGAGAGGACTACTCACTGG + Exonic
999113487 5:149141754-149141776 CGCTGGGCAGGAATAGTCCGGGG + Exonic
1002922288 6:1581185-1581207 CAGTGGGCAGAAAGACTCCCGGG + Intergenic
1005544935 6:26857104-26857126 CTCTGGGCATGAACAATCTCTGG + Intergenic
1006317078 6:33297548-33297570 CTCTGGGCTGGTATAGTCCTTGG - Intronic
1006759023 6:36443063-36443085 CTCGGGGCTGGAATCCGCCCGGG - Exonic
1009015723 6:57898725-57898747 CTCTGGGCATGAACAATCTCTGG + Intergenic
1009244093 6:61213668-61213690 CTCTGGAGGGGAATGCTCCCAGG + Intergenic
1014645050 6:123962840-123962862 CTCTGGGCAGGAGTAAGCCTAGG - Intronic
1015422750 6:133029973-133029995 CTATGGGCAGGAATTCTCCCAGG - Intergenic
1017127779 6:151081719-151081741 CTCTGGGCAGGAGCTTTCCCAGG + Intronic
1018895295 6:168012635-168012657 CTCCTGGCAGGCACACTCCCAGG - Intronic
1022157470 7:27674754-27674776 CTCAGGGCCTGATTACTCCCAGG - Intergenic
1029666231 7:101996886-101996908 CTGTGGGCAGGAATACTGGAGGG - Intronic
1031356250 7:120790615-120790637 CTCTGTGCAGAAGTACTCACTGG - Intronic
1034877497 7:154738447-154738469 CTCTTGGCTGGAGAACTCCCAGG - Intronic
1036169066 8:6465561-6465583 CCCTGGGAAGAAATGCTCCCCGG + Intronic
1036256733 8:7212391-7212413 CTCTGGGGAGGAAGACTCTGTGG - Intergenic
1036308783 8:7670993-7671015 CTCTGGGGAGGAAGACTCTGTGG - Intergenic
1036360758 8:8075118-8075140 CTCTGGGGAGGAAGACTCTGTGG + Intergenic
1036890210 8:12591854-12591876 CTCTGGGGAGGAAGACTCTGTGG - Intergenic
1037501146 8:19486532-19486554 CTCTGGGCAGGAATGCTTCGAGG - Intronic
1039973563 8:42340575-42340597 CTAAGGGCAGGCAGACTCCCCGG - Intronic
1040955165 8:52972258-52972280 TTCTGGGCTGTAAAACTCCCTGG + Intergenic
1041068542 8:54104390-54104412 CACTGCGCTGGAATTCTCCCCGG + Intergenic
1041662234 8:60411650-60411672 TTCTAGGCATGAATATTCCCTGG + Intergenic
1042563340 8:70090122-70090144 CTCTGCTGAGGAATAGTCCCAGG + Intergenic
1043350392 8:79353443-79353465 TTCAGGGCAGGACAACTCCCTGG + Intergenic
1047419217 8:124692720-124692742 GTCTTGGCAGGATTCCTCCCTGG - Intronic
1050502764 9:6315676-6315698 CGCTGGGCAGGTAGACTCGCTGG + Intergenic
1052995173 9:34548053-34548075 CACTAGGCAGGAATCCTTCCTGG - Intergenic
1057744562 9:97741137-97741159 CTCTGAACAGGAATAGTCCTGGG + Intergenic
1058867597 9:109175896-109175918 CTCTGCGCAGTACTCCTCCCAGG + Intronic
1060545018 9:124454432-124454454 CTCTGGGCAGGGGTATTGCCCGG + Intronic
1203487273 Un_GL000224v1:68400-68422 CTCTGGGCAGCAAGCCACCCAGG - Intergenic
1203499894 Un_KI270741v1:10300-10322 CTCTGGGCAGCAAGCCACCCAGG - Intergenic
1185765521 X:2723080-2723102 CTCTGAGAACGCATACTCCCAGG - Intronic
1185980516 X:4773358-4773380 CTTTGGGCAGGAATTATTCCAGG + Intergenic
1186514546 X:10156825-10156847 CTCTGGACACGAATGCTCCGGGG + Intergenic
1187642613 X:21311473-21311495 TTCTGGGCAGGAATAAGACCTGG + Intergenic
1188159647 X:26784070-26784092 TTCTGGCCAGGACTACACCCCGG - Intergenic
1189368828 X:40411856-40411878 CTGGGGGCAGGGATGCTCCCTGG - Intergenic
1197188595 X:123618830-123618852 CCCTGGACAGGAATACTCGGTGG - Intronic
1200002033 X:153067148-153067170 CTGTGGGCAGGCAGACTCCCTGG - Intergenic
1200005699 X:153082877-153082899 CTGTGGGCAGGCAGACTCCCTGG + Intergenic
1200341640 X:155403265-155403287 CTCTGGGTAGGAATCTACCCAGG - Intergenic
1201073214 Y:10168856-10168878 CTCGGAGCAGGAAGACACCCCGG - Intergenic
1202202414 Y:22367322-22367344 CTCTGCGCTGGAATTCTCGCTGG - Intronic