ID: 944625472

View in Genome Browser
Species Human (GRCh38)
Location 2:201564233-201564255
Sequence TAATTGAATTAAAGTGATCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 334
Summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 308}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944625465_944625472 27 Left 944625465 2:201564183-201564205 CCCCCTCACAAGAACTAAAGCCC 0: 1
1: 0
2: 0
3: 6
4: 102
Right 944625472 2:201564233-201564255 TAATTGAATTAAAGTGATCTGGG 0: 1
1: 0
2: 2
3: 23
4: 308
944625468_944625472 24 Left 944625468 2:201564186-201564208 CCTCACAAGAACTAAAGCCCAGC 0: 1
1: 0
2: 4
3: 14
4: 146
Right 944625472 2:201564233-201564255 TAATTGAATTAAAGTGATCTGGG 0: 1
1: 0
2: 2
3: 23
4: 308
944625470_944625472 6 Left 944625470 2:201564204-201564226 CCAGCTTCAAATCATTTCAATTT 0: 1
1: 0
2: 1
3: 56
4: 466
Right 944625472 2:201564233-201564255 TAATTGAATTAAAGTGATCTGGG 0: 1
1: 0
2: 2
3: 23
4: 308
944625469_944625472 7 Left 944625469 2:201564203-201564225 CCCAGCTTCAAATCATTTCAATT 0: 1
1: 1
2: 7
3: 57
4: 381
Right 944625472 2:201564233-201564255 TAATTGAATTAAAGTGATCTGGG 0: 1
1: 0
2: 2
3: 23
4: 308
944625467_944625472 25 Left 944625467 2:201564185-201564207 CCCTCACAAGAACTAAAGCCCAG 0: 1
1: 0
2: 2
3: 26
4: 291
Right 944625472 2:201564233-201564255 TAATTGAATTAAAGTGATCTGGG 0: 1
1: 0
2: 2
3: 23
4: 308
944625464_944625472 28 Left 944625464 2:201564182-201564204 CCCCCCTCACAAGAACTAAAGCC 0: 1
1: 0
2: 0
3: 11
4: 139
Right 944625472 2:201564233-201564255 TAATTGAATTAAAGTGATCTGGG 0: 1
1: 0
2: 2
3: 23
4: 308
944625466_944625472 26 Left 944625466 2:201564184-201564206 CCCCTCACAAGAACTAAAGCCCA 0: 1
1: 0
2: 0
3: 6
4: 122
Right 944625472 2:201564233-201564255 TAATTGAATTAAAGTGATCTGGG 0: 1
1: 0
2: 2
3: 23
4: 308

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944625472 Original CRISPR TAATTGAATTAAAGTGATCT GGG Intronic
900491887 1:2953599-2953621 ACATTGGATTAAAGTGATCTTGG + Intergenic
901151644 1:7107344-7107366 CAATTGAATCCAATTGATCTTGG - Intronic
902390023 1:16098153-16098175 AACTTGAATTAAAGTGGCCTTGG + Intergenic
904934196 1:34115702-34115724 TACTAGAATTAAAATGATTTAGG - Intronic
906859588 1:49344940-49344962 TAAATGACTTATGGTGATCTGGG + Intronic
908016794 1:59848679-59848701 TAATTGAGTTTGAGTTATCTGGG + Intronic
908485194 1:64584770-64584792 GAATTGATTTAAATTGATATAGG + Intronic
909625531 1:77711623-77711645 TAATAGATTTCAAGTGTTCTAGG - Intronic
910140737 1:84024800-84024822 TATTAGAATTAGAGTAATCTTGG - Intergenic
911694135 1:100869145-100869167 TAAGTTAATTAAATTTATCTGGG - Intergenic
912120267 1:106462638-106462660 TAATTGAATTGAATTAATGTTGG - Intergenic
912666929 1:111589841-111589863 CACTTGAGTTCAAGTGATCTAGG - Intronic
913026812 1:114851899-114851921 TAATTGAAATAAAGAGAGTTTGG + Intergenic
913393238 1:118337787-118337809 TCATTGAATTAAAGTTAGTTTGG - Intergenic
913698412 1:121350275-121350297 TAATTGGATTAAGGTGATTTAGG + Intronic
914139138 1:144929767-144929789 TAATTGGATTAAGGTGATTTAGG - Intronic
915501574 1:156322514-156322536 TAATAAGATTAAAGTGTTCTAGG + Intronic
916163298 1:161941080-161941102 TAATTGAATCATATTGATCATGG + Intronic
916642027 1:166740584-166740606 TAATTGAATTAAAGCTCTGTGGG - Intergenic
917343959 1:174009352-174009374 TATTTGAAATAAGGTGATCAGGG - Intronic
917471058 1:175326298-175326320 TTATTGAATGAAAGAGGTCTTGG + Intronic
918510917 1:185313550-185313572 TACTTTCATTAAAGTGAGCTAGG + Intronic
918566371 1:185938206-185938228 TAATTGAAGAAAACTGTTCTAGG + Intronic
918690348 1:187471168-187471190 TATTTGAATTTAATTGATCCAGG - Intergenic
919246296 1:194989824-194989846 TTATTGAATTAAAGTCCTCAAGG - Intergenic
919394673 1:197030443-197030465 TGATTGAATAAAAGTGGTATAGG + Intergenic
920485814 1:206368931-206368953 TAATTGGATTAAGGTGATTTAGG + Intronic
921153833 1:212422781-212422803 TAGCTGAATTAAAGTGACCATGG + Intergenic
921215055 1:212929488-212929510 TAATTATATTGAAATGATCTAGG + Intergenic
924087240 1:240465172-240465194 TTGTGGAATTAAGGTGATCTGGG - Intronic
924249830 1:242121094-242121116 ATATTGAATTAAATTCATCTTGG + Intronic
1063516846 10:6704985-6705007 TAACTGCATTAAAATGATCAGGG - Intergenic
1063811376 10:9713011-9713033 GAATTGCAGTAAAGTGATGTTGG + Intergenic
1065663387 10:28030536-28030558 TAATCAAATTAGAGTAATCTGGG - Intergenic
1066240205 10:33526116-33526138 TAATTGTACTATAGTTATCTAGG + Intergenic
1068727730 10:60321835-60321857 TAATTCACTTAAAGTGATTCTGG + Intronic
1071720358 10:88137747-88137769 TAATTATATAAAAGTGCTCTGGG - Intergenic
1072238565 10:93474099-93474121 TGATTAAATTAAAGTGATAAGGG - Intronic
1074087201 10:110217367-110217389 TACTTGAATAAAGGTGATTTGGG + Intronic
1075822991 10:125330367-125330389 TAAGTGAAATAAAGTGCTCAGGG - Intergenic
1075870083 10:125765896-125765918 TAAATGAATTATAGTGAACCAGG + Intergenic
1076386318 10:130058634-130058656 TAATTGAACCAAGATGATCTGGG + Intergenic
1078643977 11:13121413-13121435 TAATTGAGTTAGTGTGATTTTGG - Intergenic
1079043426 11:17079217-17079239 TATTTGAAATAAAGTTATCAGGG + Intronic
1079442249 11:20526666-20526688 TATTTGAAAAAAAGTGATTTAGG + Intergenic
1079646895 11:22875402-22875424 TAAAGGAAATAAATTGATCTTGG + Intergenic
1079759767 11:24314159-24314181 TAAATGAATTCTAGTTATCTAGG - Intergenic
1079863700 11:25707764-25707786 AAATTGAAATAGAGTGATATTGG - Intergenic
1079887536 11:26005730-26005752 TAATTGATATAAATTGATTTAGG + Intergenic
1080131791 11:28804220-28804242 TAATTATATAAAAGTTATCTAGG - Intergenic
1080171099 11:29303984-29304006 TCATAGAATTAAAGAGATTTAGG - Intergenic
1080174126 11:29341457-29341479 TAAATTAATTAAAGTGAGTTTGG - Intergenic
1081385151 11:42463370-42463392 TAAATGAATTAAGGTAAACTTGG + Intergenic
1081417408 11:42832483-42832505 TCATTTCATTAAACTGATCTAGG + Intergenic
1081603546 11:44512277-44512299 TAACTGAATTAAAATGAAATGGG + Intergenic
1082792564 11:57356845-57356867 TGATGCAATTAGAGTGATCTTGG + Intronic
1086197568 11:84159354-84159376 TAATTTAATTACAGTGAACAGGG + Intronic
1086797248 11:91122105-91122127 TAATTGAAATAAACTGAGCATGG - Intergenic
1087301492 11:96441161-96441183 AATTTGAATTAAGGTAATCTTGG + Intronic
1089825283 11:121269950-121269972 AATTTCAATTACAGTGATCTTGG + Intergenic
1090854565 11:130600112-130600134 TAAATGAATTAAACTAATGTGGG + Intergenic
1092812271 12:12282853-12282875 TGAATGAATTAAAGTAAGCTTGG - Intergenic
1093566636 12:20614170-20614192 TAATTGACTAAAACTGTTCTGGG - Intronic
1094278167 12:28703212-28703234 TAATTGATTTAGAGTGATTTTGG - Intergenic
1095329565 12:40942131-40942153 TAATTAAATGAAAGGGATGTGGG + Intronic
1095858102 12:46884275-46884297 TTATTGAGATAAAGTGAACTGGG - Intergenic
1099538041 12:83870080-83870102 TAATGGAATTAAGGTAATTTAGG - Intergenic
1100424589 12:94472217-94472239 TTATTGAATTAAAGTGAAAATGG + Intergenic
1100548163 12:95622893-95622915 TAAATGAATTAGAATTATCTAGG - Intergenic
1100695596 12:97089319-97089341 TCATAGAATTAAAGTGAATTAGG + Intergenic
1102790682 12:115642670-115642692 TAATTGAGTCAAAGAGGTCTGGG + Intergenic
1105365830 13:19763698-19763720 TCATTAAATCAAAGTGAACTCGG + Intronic
1105744507 13:23364329-23364351 AAATTGAAGTGATGTGATCTCGG + Intronic
1107506445 13:41038638-41038660 TAATTGGAATAATGTGATATAGG - Intronic
1107759505 13:43662137-43662159 TAATGGAATTAAAGTAATTGAGG - Intronic
1107774110 13:43820013-43820035 TATTTGTATTAATGTGATTTAGG + Intergenic
1107818807 13:44267603-44267625 TCATTGAATGCAAGTCATCTGGG - Intergenic
1108503952 13:51092437-51092459 TGGTTTATTTAAAGTGATCTAGG + Intergenic
1108970468 13:56368860-56368882 TCATTCAATCAAAGTGTTCTGGG - Intergenic
1109143143 13:58741867-58741889 GTATTACATTAAAGTGATCTCGG - Intergenic
1109349914 13:61166201-61166223 TAATTGCATTCAACTGATTTAGG - Intergenic
1110017116 13:70420786-70420808 TAATTCAATTAAATTGATTCTGG - Intergenic
1110035581 13:70678663-70678685 TAATAGAATTAAAAATATCTTGG + Intergenic
1111252308 13:85618529-85618551 AAAGTGACTAAAAGTGATCTTGG - Intergenic
1111401851 13:87747938-87747960 TAATAGAATTGAAGAGATGTAGG - Intergenic
1111447776 13:88372497-88372519 TATAAGAATTAAAGTGATATCGG + Intergenic
1111609675 13:90587412-90587434 GAATTAAATTGAAGTAATCTGGG - Intergenic
1112219224 13:97471156-97471178 TAATTGAAAGAAAGTGTCCTGGG - Intergenic
1112534912 13:100243501-100243523 TAATTGAAACAAAATGATCTAGG + Intronic
1113776740 13:112952093-112952115 TAATTCAATTTCAGTGACCTTGG + Intronic
1115172339 14:30523859-30523881 TTATTGAATCAAAGATATCTAGG - Intergenic
1117766695 14:59090958-59090980 AAATGGAATTACAGTGTTCTGGG - Intergenic
1117903756 14:60563264-60563286 TAATTTTATTAAAGTTTTCTTGG - Intergenic
1120382539 14:83799264-83799286 TAATTTAATTAAAGTGATTATGG + Intergenic
1120514549 14:85454765-85454787 AAATTGATTTAAAATGACCTGGG - Intergenic
1126662018 15:51042715-51042737 CAATTGTATTAAAATGAGCTGGG - Intergenic
1127406246 15:58650374-58650396 TAACTGGATTAAGGTGATCCAGG - Intronic
1127586338 15:60381786-60381808 TAATTAAATTAAAGGGGACTTGG + Intronic
1128523814 15:68394652-68394674 TAATTTTATTAATGTGTTCTAGG - Intronic
1128687265 15:69696033-69696055 TAATTTAATTAGAGTGGTCCAGG - Intergenic
1130111996 15:80973142-80973164 TAATGGACTCAAAGGGATCTTGG + Intronic
1133134192 16:3698241-3698263 CAATTCAATTAATGTAATCTTGG - Intronic
1135528745 16:23234427-23234449 TAATTGAAATAAAATGAGGTAGG + Intergenic
1137690086 16:50420003-50420025 TAATTAAAGTAAAGTGAGATTGG - Intergenic
1139790690 16:69431924-69431946 TAATTTAATAAGAGTGATCTGGG + Intronic
1140905955 16:79409228-79409250 TATTTGAAATCTAGTGATCTTGG + Intergenic
1143685596 17:8513035-8513057 TAATAGAATTATAGTGTTCAAGG - Intronic
1144198539 17:12918384-12918406 AAATTGAACTAAAATCATCTCGG - Intronic
1147349438 17:39828701-39828723 GAATTGAATTGAAGTGGGCTGGG + Intronic
1148756804 17:49977442-49977464 TAATTCAATTAAAGCAATTTTGG + Intergenic
1151289279 17:73137350-73137372 TAATTGATTTAAAGTGAGTTGGG + Intergenic
1153829365 18:8907897-8907919 TAAATGACTTACAGTGACCTGGG + Intergenic
1154225102 18:12496293-12496315 TGATAGAATTAAAGTAAACTTGG - Intronic
1156098802 18:33568154-33568176 TAATTGAAATAATGTGATATTGG + Intergenic
1156360369 18:36379373-36379395 TAATTTAATTAAAGTAAAATGGG - Intronic
1159223129 18:65491894-65491916 TGATTGGATTTCAGTGATCTGGG - Intergenic
1160973221 19:1779654-1779676 TAATTGTAATAAAGTGGTCAGGG + Exonic
1163686608 19:18715451-18715473 TAATTGAGTTAAAGTCATGTTGG - Intronic
1164644402 19:29847487-29847509 TAATTAAAATAAGGTGATATTGG + Intergenic
1165549975 19:36575519-36575541 TACTTGGCTTAAAGTGATTTAGG - Intronic
925757620 2:7148868-7148890 TCATAGAATTGAAGGGATCTGGG + Intergenic
926816296 2:16801059-16801081 TAATTTAATGATAGTGAACTGGG - Intergenic
928672452 2:33615892-33615914 TAAATGACTTATGGTGATCTTGG + Intergenic
929196094 2:39186266-39186288 TAATTGATTTAAAATGAACAGGG + Intronic
929214266 2:39394256-39394278 CAATTGCATTATAGTAATCTTGG + Intronic
930298614 2:49586592-49586614 TAATGAATTTGAAGTGATCTAGG - Intergenic
931020779 2:58042568-58042590 TAATTGATTTGAAATGATCTTGG + Intronic
931840776 2:66145804-66145826 TTATTGAATTAATGAAATCTTGG + Intergenic
932064044 2:68534436-68534458 TACTTGATTTAAATTGTTCTAGG + Intronic
932938211 2:76131388-76131410 ATATTTAATTAAAGTGATCATGG - Intergenic
933443851 2:82351548-82351570 TAATTAAATTACAGTGACTTAGG - Intergenic
936346316 2:111677913-111677935 TCATTGATTTAAAGTGATAGAGG + Intergenic
936744043 2:115552149-115552171 TACTTTAATTAAAGTCACCTAGG - Intronic
937567883 2:123318177-123318199 TCATTTAATAAAAGTAATCTAGG - Intergenic
939175243 2:138740488-138740510 TAATTAAATTAATTTTATCTAGG + Intronic
939452356 2:142390650-142390672 CTATTGAATTAAGGTCATCTAGG + Intergenic
939551652 2:143623291-143623313 TAATAGAAATAAAGTGCGCTGGG - Intronic
939778446 2:146414354-146414376 TAATTAAATGAATGAGATCTTGG + Intergenic
940472946 2:154122256-154122278 TAAATAAATTTAAGTAATCTAGG + Intronic
941120287 2:161521967-161521989 TAATCTATTTAAAGTGATCAAGG - Intronic
941158806 2:162011691-162011713 TAAATAATTTAAAGTGTTCTGGG - Intronic
941311438 2:163937303-163937325 TATTTGAAATAAAGTGCTTTTGG + Intergenic
942902756 2:181142389-181142411 TAATTGTATTAGAGTTTTCTTGG + Intergenic
943211542 2:184973804-184973826 TGATTGAAAAAAAGTCATCTGGG + Intergenic
943308356 2:186295699-186295721 TCAAAGAATTAAAGTGATTTTGG + Intergenic
943926060 2:193782060-193782082 TAATTGAATTACAGGATTCTGGG + Intergenic
944625472 2:201564233-201564255 TAATTGAATTAAAGTGATCTGGG + Intronic
945509228 2:210679987-210680009 TGAATGAATCAAAGTGATCAGGG - Intergenic
946499839 2:220235943-220235965 GAGTTGAATTAAAATGATCATGG + Intergenic
1171239435 20:23553203-23553225 TAATTGTATTACAGGGATATTGG + Intergenic
1171769560 20:29311929-29311951 TAAATAAATAAAAATGATCTGGG + Intergenic
1171906993 20:30907434-30907456 TAAATAAATAAAAATGATCTGGG - Intergenic
1173671930 20:44804997-44805019 TGATTAAAATAAAGTGGTCTGGG + Intronic
1175353956 20:58347289-58347311 TAAGTCAATGAAAGTGATTTTGG + Intronic
1177034841 21:16028945-16028967 TTATTGAATTAAAAATATCTGGG - Intergenic
1178129278 21:29552518-29552540 TAATTCATTTAAAGTATTCTGGG - Intronic
1178952021 21:36992984-36993006 TTTGTGATTTAAAGTGATCTTGG + Intergenic
1178967005 21:37130030-37130052 GAAGTGAATTAAAGTGATGTTGG + Intronic
1180238255 21:46478997-46479019 TATATAGATTAAAGTGATCTTGG - Intronic
1180340404 22:11613432-11613454 TAAATAAATAAAAATGATCTGGG - Intergenic
1183681398 22:39332177-39332199 TCATAGAATTAAAGAGAGCTAGG + Intergenic
949165619 3:937385-937407 CAATTACACTAAAGTGATCTTGG - Intergenic
949760789 3:7468031-7468053 TAATTGTATTAAACAGATTTTGG - Intronic
950635143 3:14308848-14308870 TGTTTGAATTAAAGAGAACTGGG - Intergenic
951099203 3:18667307-18667329 TAATTGAATTAAAAAATTCTTGG + Intergenic
954593768 3:51806469-51806491 AAATTGGGTTAAAGTGATCCAGG + Intergenic
955756571 3:62230833-62230855 TCATTGGAGTAAAGTGAACTTGG - Intronic
955780723 3:62481674-62481696 CATTTAAATTTAAGTGATCTTGG - Intronic
956304363 3:67807921-67807943 TAATTGAATAAAAATCACCTGGG - Intergenic
958831360 3:99094333-99094355 TAATTGATTTAACATGAACTGGG - Intergenic
959449537 3:106481807-106481829 CAATTGAATTAAAGTAGTCAGGG - Intergenic
959935584 3:112025022-112025044 TAAATGAATGAAAATGAACTTGG - Intergenic
960156411 3:114301161-114301183 GACTTGAATTAAGGTGACCTGGG - Intronic
960204949 3:114885617-114885639 TAATTCAATTAATGTGTTTTGGG + Intronic
960239660 3:115325650-115325672 TAATTGAATTCATGTGGTCAAGG + Intergenic
962321011 3:134390219-134390241 TAATTTAAATAAGGTGATCAGGG - Intergenic
962426597 3:135274145-135274167 GAATTAAATTAAGGTGATCAGGG + Intergenic
962680772 3:137797565-137797587 TAATGGAATTACAGTTATATGGG + Intergenic
964436977 3:156663837-156663859 GGATTGAATTAAGGTGATGTAGG - Intergenic
965553473 3:169995433-169995455 TATTTCAATTAAAGTTACCTAGG - Exonic
965830816 3:172787041-172787063 AAATTCAATGAAATTGATCTGGG + Intronic
966259407 3:177957003-177957025 TAATGGAATTAAAGAAATATTGG - Intergenic
966717457 3:183027781-183027803 TAATTGAATTGAAGAGAGTTAGG - Intronic
967281393 3:187827394-187827416 TAATTTAATTAAAGAGATTCAGG - Intergenic
968109852 3:196035811-196035833 TAATTAAATTAAATTAATGTGGG - Intronic
969383228 4:6822044-6822066 TAATTTTATTATAGTGTTCTAGG + Intronic
970059978 4:12022125-12022147 TAATTGAACATAATTGATCTGGG + Intergenic
970682292 4:18524005-18524027 TACTATAATTAAAGTGATCTGGG - Intergenic
972623880 4:40777196-40777218 CAATTAGATTAAGGTGATCTGGG + Intronic
973169139 4:47117232-47117254 TAGTTGAATTATAGGGATCAAGG + Intronic
974254923 4:59438979-59439001 TAATTGCCTTAAAGTTCTCTAGG - Intergenic
976746802 4:88411183-88411205 TAAATGAATTTAGGTGATATGGG + Intronic
978152286 4:105451121-105451143 TATCTGAATTAAATTGCTCTGGG + Intronic
978895720 4:113885150-113885172 TAATTAAGTTAAAGTGATTCTGG + Intergenic
979779601 4:124633764-124633786 TAGATGAATTAAATTGCTCTAGG + Intergenic
980427303 4:132642900-132642922 TAATTAAAATAAATTTATCTTGG + Intergenic
980585130 4:134803264-134803286 TAAGTGAATTCAATTGATATTGG - Intergenic
981173307 4:141650159-141650181 TAATTGAACTACAGTGAGCCAGG + Intronic
982294219 4:153809905-153809927 TCATTGAATATAAGTAATCTAGG - Intergenic
984496417 4:180503467-180503489 TAATACAATTAAAGTGATAAAGG + Intergenic
984735389 4:183103182-183103204 TAACTGAATAAAAATAATCTTGG + Intronic
985066733 4:186129654-186129676 TGATTGGATTAAGGTGACCTGGG + Intronic
986040152 5:3986272-3986294 TAATTTAATTAAATTTATTTAGG + Intergenic
986499346 5:8382779-8382801 CAACTGAATTAAATTGGTCTTGG + Intergenic
986570976 5:9165899-9165921 CAAATGAATTAAATTGGTCTTGG + Intronic
987047506 5:14121695-14121717 TCATTAAATTATAGTGTTCTGGG + Intergenic
987532522 5:19141035-19141057 TAATTGGATTAAAGTTATCAGGG - Intergenic
987765622 5:22225668-22225690 TATGTGAATTGCAGTGATCTTGG + Intronic
987835685 5:23157900-23157922 TAATTCATTTAAACTGATATGGG - Intergenic
987914537 5:24194637-24194659 TAATGGAATATTAGTGATCTGGG + Intergenic
988156673 5:27461766-27461788 TAATTAAAATAATGTGATATTGG + Intergenic
989300656 5:39888505-39888527 TAGTTGAATTAAAGTAATGGTGG - Intergenic
990425472 5:55684422-55684444 AAACTGGATTAAGGTGATCTAGG - Intronic
990832695 5:59977388-59977410 TCATTGAATTAAAGAGAGTTAGG - Intronic
990910548 5:60847278-60847300 TAATTGTCTTAAAGTTATTTAGG + Intergenic
992105328 5:73445489-73445511 TTATTGAATTTAGGTGATTTAGG - Intronic
992424803 5:76645946-76645968 TAATTGAAATTAAGTGTTTTTGG + Intronic
992861949 5:80920249-80920271 TCAATGACTTAAAGTGAACTAGG - Intergenic
993120720 5:83770965-83770987 TAAATGACTTACAGTGACCTGGG + Intergenic
993123211 5:83800662-83800684 TCATTGAATAACTGTGATCTTGG - Intergenic
993232819 5:85259714-85259736 TAAATGAATCAAAGAGACCTTGG - Intergenic
993263749 5:85694713-85694735 TAATTTAATTAAATTGACCAAGG - Intergenic
993509679 5:88756094-88756116 TAATAGAATACAAATGATCTTGG - Intronic
993788731 5:92178609-92178631 TGAATGAATAAAAGTGATATTGG + Intergenic
994186050 5:96816555-96816577 TAATGGCATTATAGTGAGCTGGG - Intronic
994839389 5:104903221-104903243 TAATTAAATTATAGTAATCATGG - Intergenic
994898035 5:105730612-105730634 TGATTGACTTACAGAGATCTTGG - Intergenic
995096074 5:108237202-108237224 TTGTTGAATTAAAGGGATTTAGG - Intronic
995359991 5:111285144-111285166 AAATTGTCTTAAAGTGATCATGG + Intronic
995799770 5:115981421-115981443 AAATTGAAAAAAAGTGTTCTAGG - Intronic
996227580 5:121019582-121019604 TTATTTAATTAAACTGTTCTTGG - Intergenic
996297267 5:121935857-121935879 GTATTGAATAAAAGTTATCTAGG - Intergenic
1000100353 5:158010458-158010480 TAAATGAATCAAAATTATCTAGG + Intergenic
1000527484 5:162376392-162376414 TCATTGAAGCAAACTGATCTTGG - Intergenic
1000906813 5:166974331-166974353 TAACTGAGTTTAAGTGTTCTTGG + Intergenic
1001393825 5:171402890-171402912 TAATTGACTTACAGTGCTGTAGG - Intronic
1004433932 6:15571888-15571910 TAGTAGAATTAAAGTAATTTTGG - Intronic
1004611240 6:17242061-17242083 TGATTGGATTAAGGTGATTTGGG - Intergenic
1004861510 6:19807995-19808017 TAATGGATATAAAGTGGTCTGGG + Intergenic
1004907425 6:20249329-20249351 TAATTAAATTAAGTTGCTCTTGG - Intergenic
1005782908 6:29211835-29211857 TAATTGATTAAAAAAGATCTGGG - Intergenic
1008153327 6:47983042-47983064 TAATTGAATTAAAGAGATAATGG + Intronic
1009391957 6:63155260-63155282 TAATTAAGTTAAAGTCAACTAGG + Intergenic
1009656656 6:66555315-66555337 TCATTGAATTAATGTGCTGTTGG + Intergenic
1009715221 6:67384287-67384309 TAATAGAATCACAGTGGTCTTGG + Intergenic
1009768137 6:68108286-68108308 TAATTGAATTGAAAAGAACTTGG - Intergenic
1010450237 6:75994275-75994297 CAATAGATTTAAAGTAATCTGGG + Intronic
1011017505 6:82773390-82773412 TAATTGAAGGAAATTGATTTAGG - Intergenic
1011469104 6:87689847-87689869 TAAATGATTTAAAGTAAACTAGG - Intronic
1011548798 6:88509927-88509949 TAGTTGCATTAAAATAATCTGGG - Intergenic
1012864420 6:104600817-104600839 GATTTGTTTTAAAGTGATCTGGG - Intergenic
1012995581 6:105969910-105969932 TACTTGAATTGAAGTTTTCTAGG + Intergenic
1013129151 6:107214912-107214934 TAATAAAATTAAGGTGATGTTGG - Intronic
1013188291 6:107781039-107781061 GAATAGAATAAAAGTGATTTAGG + Intronic
1014294092 6:119596969-119596991 TCATAAAATTAAAGAGATCTAGG + Intergenic
1014461041 6:121695844-121695866 TTAGTAAATTAAAGTGAACTAGG + Intergenic
1014519045 6:122416072-122416094 TAATTGAACCAAAGTTTTCTTGG + Intronic
1014916472 6:127155652-127155674 TAATTGAATTATGATGAACTAGG + Intronic
1015131457 6:129815150-129815172 TAATTAAAATATTGTGATCTTGG - Intergenic
1015743646 6:136486190-136486212 TATTTAAATAAAAGTGATGTGGG + Intronic
1017469444 6:154724904-154724926 TAAAGGAAATAAAGTCATCTTGG - Intergenic
1020344313 7:7146711-7146733 TAATTTTATTAAGGTGATTTGGG - Intergenic
1020820903 7:12966211-12966233 TAATTAAATTATATTAATCTTGG - Intergenic
1021075293 7:16296728-16296750 TAATTGTTTTAAAATGATTTGGG - Intronic
1021229379 7:18067362-18067384 TAACTGCATTAAAGGTATCTAGG - Intergenic
1021398769 7:20184236-20184258 TGACTGAATAAAAGTGGTCTCGG - Intronic
1023236665 7:38097744-38097766 TAATTGAAATAGTGTCATCTAGG - Intergenic
1023298587 7:38743101-38743123 AAATTGAATAAATGTCATCTGGG - Intronic
1023780236 7:43648228-43648250 TAATTACAGTAATGTGATCTGGG + Intronic
1024391725 7:48821108-48821130 TGATTGGATTAAGGTGATCAGGG + Intergenic
1025874117 7:65463944-65463966 TAATTGAAATAAATTTATCATGG + Intergenic
1026114545 7:67485230-67485252 TTCTTGAATTAGAGTGATTTAGG + Intergenic
1027550671 7:79590342-79590364 CAATTGAATTAAAATTATTTGGG + Intergenic
1027882067 7:83852896-83852918 TAGGTGAATTAAAGTGTTATAGG - Intergenic
1027916485 7:84329973-84329995 TAATTCAATAATAGTGATTTTGG + Intronic
1028257516 7:88618081-88618103 TAATTGAAATAAAGATATCTAGG - Intergenic
1029818805 7:103125244-103125266 TAATTGAATTGGAGTTATTTTGG - Intronic
1030838950 7:114323674-114323696 TAATTGCATTTAAGTATTCTTGG + Intronic
1031410014 7:121430299-121430321 AAATTAAATTAAAATTATCTGGG - Intergenic
1031738668 7:125399700-125399722 TATTTGAATGGCAGTGATCTAGG - Intergenic
1031807109 7:126320101-126320123 TATTTGAATTAAAGTGATCCAGG - Intergenic
1032444108 7:131965824-131965846 CTATTGGATTATAGTGATCTGGG + Intergenic
1032445167 7:131976084-131976106 TAATGGGATTAGAGTGATCAGGG + Intergenic
1032746363 7:134790672-134790694 TAATTTAATTTAACTGCTCTAGG - Intronic
1033019926 7:137714201-137714223 TAATTGAATTAAAACAATATTGG + Intronic
1033517441 7:142121893-142121915 TAATGTAATTAAAGTGATGATGG + Intronic
1033956226 7:146851839-146851861 TAAATAAATTAAAATTATCTGGG - Intronic
1035480892 7:159183840-159183862 GGGTTGAATTAAGGTGATCTGGG - Intergenic
1036037032 8:5030904-5030926 TAATTCAGTTAAAATGTTCTTGG - Intergenic
1036116893 8:5968803-5968825 TAATTGAATAAAAAAAATCTAGG - Intergenic
1037095601 8:14982631-14982653 TAAATGAACTAAATCGATCTAGG + Intronic
1037221918 8:16533871-16533893 TGACTGAATTAAAGTATTCTTGG - Intronic
1037501954 8:19494994-19495016 TAATGGGAATAAAGTCATCTAGG + Intronic
1037661837 8:20934498-20934520 TAGTGGAATTAAAGTTATCATGG + Intergenic
1038526665 8:28280244-28280266 TAATTTAATCAAAGTCATATTGG + Intergenic
1039203826 8:35127088-35127110 AACATGAATAAAAGTGATCTAGG + Intergenic
1039371860 8:36992789-36992811 TAATTAAATGAAAGAGAACTAGG - Intergenic
1040666843 8:49643597-49643619 AAATTAAATTAAAATTATCTAGG - Intergenic
1041847403 8:62346488-62346510 TTTTTGCATTAAAATGATCTTGG + Intronic
1042061445 8:64822647-64822669 TCAGTGAACTAAAGTGATTTAGG - Intergenic
1042085369 8:65101828-65101850 TAATTGGATTAATATGATCCAGG + Intergenic
1043480408 8:80646879-80646901 TAAATGAAGTACAGTGTTCTTGG - Intronic
1043557658 8:81451243-81451265 AAATTAAATTAATGTGATCTGGG + Intergenic
1043858738 8:85291073-85291095 TATTTGAATAAATGTGATCTGGG + Intergenic
1044481700 8:92698102-92698124 AAAATGAATTTAAATGATCTTGG - Intergenic
1044810238 8:96053395-96053417 AAATTAAATTAAAGTGAATTAGG + Intergenic
1045399607 8:101800268-101800290 GAATAGAATTAAAGTGTCCTAGG + Intronic
1045682320 8:104675944-104675966 TAATAAAATTAATGTGATATAGG + Intronic
1045750357 8:105476610-105476632 TAATTGAATGGAAGTGATGTGGG + Intronic
1046221198 8:111217681-111217703 TAATTCTTTTAAAGTGATTTAGG - Intergenic
1047066737 8:121292286-121292308 TAATTGAATTAAAATGATATAGG + Intergenic
1047106471 8:121736303-121736325 TCATAGAATTAAAGAGAACTAGG + Intergenic
1048025780 8:130585412-130585434 TAATTGAAATAAATAGATCTAGG + Intergenic
1048102503 8:131369194-131369216 TAGGTGAATTAAATTAATCTAGG + Intergenic
1048418335 8:134251498-134251520 TAATTGACTTCAAGTTATCAAGG - Intergenic
1050659908 9:7873348-7873370 TAATTTAATTCAAGTGATAATGG - Intronic
1052793774 9:32903196-32903218 TAATGGAATCAAAGTAGTCTGGG + Intergenic
1053204173 9:36172436-36172458 TGATTGAATTAAAGCGATCCAGG - Intergenic
1054944508 9:70781738-70781760 TAATTTAATTTAAATAATCTAGG + Intronic
1054986674 9:71269874-71269896 TAATAGAATAAAAGTGATCCAGG - Intronic
1055128038 9:72742242-72742264 TTGTTGAATTAAATTGGTCTGGG + Intronic
1059008661 9:110432683-110432705 TAATACAAATAAAGTGTTCTTGG - Intronic
1059941889 9:119367720-119367742 TAATTGACTTAAACTGCTGTCGG - Intronic
1203363269 Un_KI270442v1:236212-236234 TAAATAAATAAAAATGATCTGGG + Intergenic
1203583937 Un_KI270746v1:45181-45203 TAAAAGAATTAAAGTGTTATAGG - Intergenic
1190956878 X:55204251-55204273 TAAATGACTTACAGTAATCTGGG - Intronic
1191672402 X:63760435-63760457 TTATTGAATTGAACTGATTTTGG - Intronic
1193421344 X:81286338-81286360 TAGTTGAATTAAACTGCTCCAGG + Intronic
1194009487 X:88541884-88541906 TAATTGGATTAAAGCTATCCAGG + Intergenic
1194883569 X:99284363-99284385 TAAATGAATAAAAGTCTTCTGGG + Intergenic
1199016718 X:142825604-142825626 TAGTTGAATTAAATTGATGATGG - Intergenic
1200335828 X:155350465-155350487 TAATTGAATGTAACTCATCTTGG + Intergenic
1200350641 X:155490761-155490783 TAATTGAATGTAACTCATCTTGG - Exonic
1201075038 Y:10180510-10180532 TAAATAAATAAAAATGATCTGGG - Intergenic