ID: 944627300

View in Genome Browser
Species Human (GRCh38)
Location 2:201584425-201584447
Sequence GTTAACCAGAGTCCAAGGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 159
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 143}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944627300 Original CRISPR GTTAACCAGAGTCCAAGGAA AGG Intronic
902055398 1:13596460-13596482 ATTTACCAGACTCCATGGAAGGG + Intronic
910881108 1:91923126-91923148 GTTAACAAGAGAACAGGGAAAGG - Intergenic
912649985 1:111429505-111429527 GTTAATATTAGTCCAAGGAATGG - Intergenic
914393717 1:147244362-147244384 GAAAAGCAGAGTCAAAGGAATGG + Intronic
917427578 1:174930922-174930944 AACAACCAGAGTCCAAGTAAAGG + Intronic
917745624 1:178004058-178004080 GTTCACCAAAGTTCAAGAAAAGG + Intergenic
920061248 1:203228480-203228502 ATTAAGCAGAGCCCAGGGAAGGG + Intronic
920118430 1:203637694-203637716 CTCAACCAGAGTCCAAACAAGGG - Intronic
922505659 1:226124013-226124035 GTTAGCCAGATGCCCAGGAAGGG + Intergenic
922516043 1:226209124-226209146 GTTGATCAGAGTCCACGAAAAGG + Intergenic
922611813 1:226936177-226936199 GTTAACCTCAGTACAAGGCAAGG - Intronic
924614298 1:245599999-245600021 GCTATCCAGAGTCCAGGGCAAGG + Intronic
1063243890 10:4198563-4198585 AATAATCAAAGTCCAAGGAATGG + Intergenic
1066337638 10:34495351-34495373 GTTCATCAGAGTCCAAATAAAGG + Intronic
1068343515 10:55740089-55740111 GGTAACCAGAGGACTAGGAATGG + Intergenic
1068647391 10:59482596-59482618 TTTAACCAGATTTCAAAGAATGG - Intergenic
1069568810 10:69481728-69481750 GTCAGCTAGGGTCCAAGGAAAGG - Intronic
1069828604 10:71269362-71269384 GTGCACCAGACTCCCAGGAAAGG - Intronic
1070502781 10:77087163-77087185 GTCAACCCCAGTCCAAGGATAGG - Intronic
1071518420 10:86314407-86314429 GATCACCAGAGCCCAAGGAGTGG - Intronic
1072693238 10:97584962-97584984 TTTAGCCAGAGACCAAGGGAGGG + Intronic
1075015785 10:118909174-118909196 ATTAGCCAGAGGCCAAGGAAGGG + Intergenic
1075258092 10:120940833-120940855 GTTACCCCGAGTGCCAGGAAGGG - Intergenic
1076125805 10:127972759-127972781 GTAATCCACAGTCCAAGGGAGGG - Intronic
1078513279 11:12002708-12002730 ATTCCCCAGAGTCCCAGGAAAGG + Intronic
1080278320 11:30527604-30527626 GTTAATCAGAGTCTAAGGAGAGG + Intronic
1080684532 11:34504235-34504257 GTTAACCAAAGTTCAAGGGAAGG + Intronic
1083097438 11:60266193-60266215 GTTCACCAGAGTGCAGAGAATGG - Intergenic
1083176242 11:60951877-60951899 GTGAACAAGAGTGCGAGGAAGGG - Intronic
1084908948 11:72372151-72372173 ATTATTTAGAGTCCAAGGAATGG - Intronic
1086133672 11:83425369-83425391 GTTAAGCATAATCCAAGTAAAGG - Intergenic
1086895082 11:92302793-92302815 GTTAATAAGATTTCAAGGAAGGG + Intergenic
1086980795 11:93196240-93196262 GTTAACTAAAGTACAATGAAAGG - Intronic
1086999921 11:93407131-93407153 TTTAGCTAGAGTCCAAGGAGTGG - Intronic
1087093617 11:94299829-94299851 GTTGAAGAGAGTCCAAGGAAGGG - Intergenic
1089086326 11:115820315-115820337 TTTAATCAGATTCCCAGGAAAGG + Intergenic
1090344191 11:126054779-126054801 GTTCAGCAGAGTGCAAAGAAAGG + Intronic
1091972216 12:4797029-4797051 AGTAGCCAGAGTCCAGGGAAGGG - Intronic
1092017824 12:5173883-5173905 GGCAACCAGAGTGCAGGGAAGGG + Intergenic
1094193639 12:27722760-27722782 TTTAAACAGTGTTCAAGGAATGG + Intronic
1095184943 12:39190505-39190527 ATGAACCAGATGCCAAGGAAGGG - Intergenic
1096015261 12:48266967-48266989 CATAACCAGAGTTCCAGGAAGGG - Intergenic
1097718009 12:62987671-62987693 GTTGACCAGAGTTGAAAGAATGG + Intergenic
1099040717 12:77651121-77651143 ATTAACCTGAGTCAAAAGAAAGG - Intergenic
1099288491 12:80745680-80745702 GTTAACAAGAAACCAAGGAATGG - Intergenic
1100791299 12:98133115-98133137 GTTTACAACAGTCCAAGGGAAGG - Intergenic
1101618657 12:106362244-106362266 GTTAGCCTTAGACCAAGGAATGG + Intronic
1102351011 12:112192197-112192219 GTTAATGAGAATTCAAGGAATGG + Intronic
1103100758 12:118173151-118173173 GTTAACCAGCGGAAAAGGAAAGG + Intronic
1105852657 13:24349544-24349566 GCTAACCAGTGTCCACAGAATGG + Intergenic
1111931116 13:94514234-94514256 CGTAACAACAGTCCAAGGAAGGG + Intergenic
1114148453 14:20007183-20007205 TTTAACCAGAGGACAAGAAAAGG + Intergenic
1115328809 14:32171273-32171295 GTTAACCAGCCTCCTGGGAAGGG + Intergenic
1115756014 14:36526295-36526317 TTTGACCAGAGTCCAAAGAAGGG - Intergenic
1117120868 14:52567177-52567199 CTTAGCAAGGGTCCAAGGAATGG - Intronic
1118385129 14:65249869-65249891 CTGAACCAGAGTCCAATGTATGG - Intergenic
1122080078 14:99261040-99261062 GTTCACCCGATTCCAAAGAACGG + Intronic
1122268197 14:100556528-100556550 GTGAACCAAAGTTCAGGGAAGGG - Intronic
1123141453 14:106083049-106083071 GTCAACAAGACTCCAGGGAAGGG - Intergenic
1123195166 14:106609464-106609486 GTTAACCAAAGACCAGGAAATGG + Intergenic
1127845794 15:62869344-62869366 GATAACAATATTCCAAGGAATGG - Intergenic
1128291379 15:66481037-66481059 GATAATAAGAGTGCAAGGAAGGG + Intronic
1128519771 15:68367645-68367667 GGGAACAAGAGGCCAAGGAAGGG - Intronic
1128756725 15:70188296-70188318 GTTGACGAGAGCCCAAGGGATGG + Intergenic
1130520852 15:84659574-84659596 GGTATCCAGAGTCCAAGGGGTGG - Intergenic
1135640414 16:24115116-24115138 GCCAAAGAGAGTCCAAGGAAAGG + Intronic
1135971990 16:27078987-27079009 GATAACTAAAGTCCAGGGAAAGG - Intergenic
1137988979 16:53132458-53132480 GTTATCTAGAGTCTAGGGAATGG - Intronic
1139251339 16:65499375-65499397 TCTAACCAGACTCCAAGAAATGG - Intergenic
1140038253 16:71387758-71387780 CTTAATCAGAAGCCAAGGAAGGG - Intronic
1140873496 16:79128538-79128560 GTTAACCTGGGTCCAAGACATGG - Intronic
1141755847 16:85990330-85990352 GTTAACCAGAGCCCATGCAATGG + Intergenic
1144404616 17:14940745-14940767 GTTTTCAGGAGTCCAAGGAATGG + Intergenic
1144462180 17:15467196-15467218 GTAAATCAGAATCCTAGGAATGG + Intronic
1150223064 17:63508033-63508055 GTTCACCAGACTCCAGGGACAGG - Intronic
1153501002 18:5750029-5750051 GTTAACCTGAGTGTTAGGAATGG + Intergenic
1153635439 18:7109192-7109214 GTTATCCAGAGTCCGGGGACCGG + Intronic
1158275662 18:55764580-55764602 GTGAGCCAGAGTTCAGGGAAGGG + Intergenic
1160197749 18:76770692-76770714 GGTAACCAGAGACACAGGAAGGG - Intergenic
1160533811 18:79580689-79580711 GTTAGCCAAAGTCCCAGGACGGG + Intergenic
1164806447 19:31120818-31120840 GTTACCCAGCACCCAAGGAAGGG + Intergenic
1165272189 19:34719929-34719951 GTCAACCAGAGTCCAAACATTGG - Intergenic
1166152084 19:40881927-40881949 GTGGACCAGAGTCTTAGGAAAGG - Intronic
1166170967 19:41027439-41027461 GTGGACCAGAGTCTTAGGAAAGG - Intergenic
1166178084 19:41088733-41088755 GTGGACCAGAGTCTTAGGAAAGG + Intronic
1166337785 19:42118912-42118934 GACAAACAGAGGCCAAGGAAAGG + Intronic
1167038529 19:47008506-47008528 CTGGACCAGAGTGCAAGGAAAGG - Intergenic
927361882 2:22245450-22245472 GTTTACCAGAGTACCAGGCAAGG + Intergenic
928428508 2:31199192-31199214 GTGAAGCAAAGTTCAAGGAAGGG + Intronic
929762068 2:44815011-44815033 GTTAACCAGTCAACAAGGAAGGG + Intergenic
934572100 2:95379291-95379313 GTTAACCGTAGGCAAAGGAAAGG - Intronic
935603350 2:104945238-104945260 GTTAAACAGAGGCAAAGAAATGG + Intergenic
936231642 2:110706416-110706438 GTGAAACACAGCCCAAGGAATGG - Intergenic
944627300 2:201584425-201584447 GTTAACCAGAGTCCAAGGAAAGG + Intronic
946190717 2:218006420-218006442 GTGGACAAGAGTCAAAGGAAAGG - Intergenic
947217389 2:227761645-227761667 GTTAGCGAGAGTCCAAAAAAGGG + Intergenic
948211412 2:236195987-236196009 CTTAACCAGTGTCCAAAGAAAGG - Intronic
1171015093 20:21533443-21533465 GTTTTCCAGAATCCAAAGAAGGG + Intergenic
1174712876 20:52725998-52726020 GGTAAACTGAGTCCAAGAAAAGG - Intergenic
1175294634 20:57899977-57899999 GTTAAGCACAGACCCAGGAAAGG - Intergenic
1176696691 21:9986375-9986397 TGTAACCAGAGTCCAAGGACAGG - Intergenic
1177558404 21:22719584-22719606 GGTCACCTGGGTCCAAGGAATGG + Intergenic
1184170888 22:42759144-42759166 GTTAACTAAAATCCCAGGAAAGG - Intergenic
1184427671 22:44422722-44422744 CATAACCAGAGGCCAGGGAATGG - Intergenic
951483427 3:23186026-23186048 CTGAATCAGAGTCTAAGGAAGGG + Intergenic
955216731 3:56990252-56990274 CTTTAGCAGAGTCCAGGGAAGGG + Intronic
957475908 3:80723809-80723831 GATACCCAGAGTCCAAGCATTGG - Intergenic
958001405 3:87753916-87753938 GTTGAACAGAGTCTGAGGAAAGG - Intergenic
958575632 3:95947533-95947555 GTCTGGCAGAGTCCAAGGAATGG + Intergenic
962778235 3:138684722-138684744 GTTAAACAGAGCCAAAGGGAAGG - Exonic
963689167 3:148477104-148477126 GTTAACCAGTCAGCAAGGAAAGG - Intergenic
964629726 3:158797418-158797440 TTTAACCTGGGTACAAGGAAAGG + Intronic
965354182 3:167653688-167653710 GTTAAACAGAGTATAAGGAAGGG - Intronic
970453722 4:16200089-16200111 GCTAACCAATGCCCAAGGAAGGG + Intronic
971132494 4:23828223-23828245 TTTAACCTGTGTCCAAGGAAAGG + Intronic
971772868 4:30921253-30921275 GTTAAACAGAGAGAAAGGAAAGG + Intronic
973649837 4:52987548-52987570 TTTAAACAGAGTTCATGGAAAGG + Intronic
973867058 4:55124993-55125015 GCAAACCAGAGTCCTAGAAAAGG + Intronic
974398912 4:61375554-61375576 TTTAACCAGTGTGAAAGGAAAGG + Intronic
981972349 4:150679304-150679326 AAAATCCAGAGTCCAAGGAAAGG - Intronic
997244633 5:132336980-132337002 TTTAACCAGGCTCCAATGAATGG + Intronic
998536753 5:142939987-142940009 GTTCACCAGAGTGCAGGGCAGGG + Intronic
1000008400 5:157209019-157209041 TTTAACCACAGTCCAGGGAATGG - Intronic
1002035972 5:176470160-176470182 GTTCCCCACACTCCAAGGAAAGG - Intronic
1003809616 6:9765569-9765591 GATTACCAGAGGCCGAGGAATGG + Intronic
1008740048 6:54595848-54595870 GTAAACCAAAGTGCAATGAAAGG + Intergenic
1009934438 6:70217253-70217275 GAAAACCCAAGTCCAAGGAAGGG - Intronic
1011080620 6:83486689-83486711 GGTAAGCAGAGGCCAAGGAATGG + Intergenic
1011757742 6:90521623-90521645 TCTAACCAGACTGCAAGGAATGG + Intronic
1013930470 6:115524970-115524992 GTAAACCAAACTCAAAGGAAAGG - Intergenic
1014916542 6:127156722-127156744 GTACACCAGAGTCCAGTGAAAGG + Intronic
1014919308 6:127194184-127194206 TGTAACCAGAGCCCAAGAAAAGG + Intronic
1020002788 7:4765261-4765283 GGTAGCCAGAGGCCCAGGAAGGG + Exonic
1020687908 7:11318579-11318601 TCTAGCCAGAGTCCAAGGGATGG - Intergenic
1023760052 7:43456872-43456894 GTTAAACACATTCCAAGGATAGG + Intronic
1024502608 7:50128294-50128316 GGTTACCAGAGGCCAAGAAAGGG + Intronic
1029217885 7:98964798-98964820 GTTCAACAGAGTCTGAGGAAAGG - Intronic
1029264524 7:99327674-99327696 GTTAATCACAGTTAAAGGAAGGG + Intronic
1031369436 7:120946946-120946968 GTTTACCAGAGTCTAAGACAAGG - Intergenic
1036224798 8:6948914-6948936 GTGAACCAGAAACCAAAGAAGGG + Intergenic
1037122237 8:15302608-15302630 GTTAACCAGAATTCAAGAAAGGG + Intergenic
1040455629 8:47594583-47594605 TTTAACCAAGGACCAAGGAAGGG - Intronic
1040974139 8:53171038-53171060 ACAAACCAGAGACCAAGGAAAGG - Intergenic
1041767693 8:61436567-61436589 GTGTACTAGAGGCCAAGGAAAGG - Intronic
1047235796 8:123041195-123041217 GTTATCCATAGGCCAAGTAAAGG + Intronic
1051134047 9:13898031-13898053 GTTATACAGAGTCTAATGAATGG + Intergenic
1052243110 9:26298948-26298970 GTTAACAAGTGTCCAAGTATGGG + Intergenic
1052742620 9:32408108-32408130 TTTGACCAGATTTCAAGGAATGG - Intronic
1053633666 9:39972221-39972243 TGTAACCGGAGTCCAAGGACAGG - Intergenic
1053772083 9:41491279-41491301 TGTAACCGGAGTCCAAGGACAGG + Intergenic
1054210221 9:62278476-62278498 TGTAACCGGAGTCCAAGGACAGG + Intergenic
1054314770 9:63570451-63570473 TGTAACCGGAGTCCAAGGACAGG - Intergenic
1056850968 9:90083550-90083572 GTGCACCAGAGTGCAAGGCAAGG + Intergenic
1188538115 X:31219616-31219638 GTAATCCAGAGCCCAAGGGAGGG - Intronic
1189399168 X:40649170-40649192 ATTAACCACAGTCCAAAGAATGG + Exonic
1191861706 X:65670789-65670811 CAGAAGCAGAGTCCAAGGAATGG - Intronic
1192365956 X:70473342-70473364 TTTAAGCTGAGTCCAGGGAAAGG - Intronic
1195020965 X:100828073-100828095 GTGGACCAGTGTCCATGGAACGG + Exonic
1202110134 Y:21409215-21409237 GTTCCCCAGAGGCCAAGGCAAGG - Intergenic