ID: 944637607

View in Genome Browser
Species Human (GRCh38)
Location 2:201689924-201689946
Sequence CCCTGTTTATGAAGGGCAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 172
Summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 160}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944637603_944637607 1 Left 944637603 2:201689900-201689922 CCGAGAATTATTACTATAACATT 0: 1
1: 1
2: 2
3: 53
4: 431
Right 944637607 2:201689924-201689946 CCCTGTTTATGAAGGGCAAATGG 0: 1
1: 0
2: 2
3: 9
4: 160
944637602_944637607 20 Left 944637602 2:201689881-201689903 CCAGGCTAGAGATATAAATCCGA 0: 1
1: 0
2: 0
3: 15
4: 85
Right 944637607 2:201689924-201689946 CCCTGTTTATGAAGGGCAAATGG 0: 1
1: 0
2: 2
3: 9
4: 160

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944637607 Original CRISPR CCCTGTTTATGAAGGGCAAA TGG Intronic
900347862 1:2219277-2219299 CCCAGTCCATGAAGGGGAAATGG - Intergenic
901066796 1:6498102-6498124 GGCTGTTTCTGTAGGGCAAAGGG - Intronic
901098770 1:6703058-6703080 ACCTGCTTATGAAGGGCAACGGG - Intergenic
902282588 1:15385098-15385120 TCCTGTTTGTCAAGGGAAAAAGG + Intronic
903877622 1:26486309-26486331 ACCTCTTTCTGAAGGGCTAAGGG + Intergenic
906710413 1:47925284-47925306 CTTTGTTTATGAAGGATAAAAGG - Intronic
907035183 1:51210200-51210222 CCAAGTTTGTGAAGGCCAAAAGG + Intergenic
907803921 1:57799443-57799465 CCCTGTTTGGGAATGACAAATGG + Intronic
909960496 1:81834972-81834994 CTCTGTTCGTGAAGGGAAAAAGG - Intronic
910502236 1:87905928-87905950 CCCTTTTCCTTAAGGGCAAATGG + Intergenic
918105810 1:181414085-181414107 CTCTGTTTGTGTAGGGCAAAAGG + Intronic
918790662 1:188823159-188823181 ACCTATTTATTAAGGGAAAATGG - Intergenic
919944874 1:202311831-202311853 CACAGTGTATGGAGGGCAAATGG + Intronic
923900332 1:238319624-238319646 ACCTTTTTATCAAGGGAAAAGGG - Intergenic
1063034236 10:2269373-2269395 CCCTCTTAGTGAAGGGCCAATGG - Intergenic
1064106933 10:12508217-12508239 CGCTATTCATGAAGGCCAAAAGG + Intronic
1065313447 10:24438645-24438667 TCCTGGTTATTTAGGGCAAAGGG + Intronic
1069743635 10:70701035-70701057 GCCTGTTTATGAAGCACAGAAGG + Intronic
1069780356 10:70951552-70951574 CCTTATTTATGGAGGGCAGAGGG - Intergenic
1071820130 10:89271502-89271524 TCCTGGCTATGAAGGGAAAATGG + Intronic
1075442656 10:122492306-122492328 ACATGTTTATGAAGGACAACGGG - Intronic
1078949440 11:16113125-16113147 CCCTGGCTATGAAGGGAACAGGG - Intronic
1080042006 11:27768975-27768997 CCCTGTTGATTAAGGTCAATGGG - Intergenic
1082108051 11:48242323-48242345 GCCTGATTAGGAAGGGGAAAGGG + Intergenic
1085715820 11:78872333-78872355 GCCTGACTATGAAGGGCAGATGG - Intronic
1086417947 11:86607877-86607899 TTCTGTTTCTGAAGGTCAAAAGG - Intronic
1088859223 11:113784277-113784299 CTCTCTTTATAAAGGACAAAAGG + Intergenic
1094011135 12:25811009-25811031 CACTGTTTATGATGGACAAAAGG - Intergenic
1095766687 12:45903230-45903252 CTCTGCTTTTGATGGGCAAATGG + Intronic
1097721682 12:63028909-63028931 CCCTGCTGATGAAGAGCAAATGG - Intergenic
1098782655 12:74706450-74706472 CCCCATTTATGAAGGGCGAGAGG - Intergenic
1099478090 12:83132647-83132669 CCCTTTTTAAGAATGCCAAAAGG - Exonic
1100220972 12:92504355-92504377 CCCTGTGTATGGAGCTCAAAGGG - Intergenic
1100736772 12:97543726-97543748 CCTTTTTTATGAATGGAAAATGG + Intergenic
1101954226 12:109199303-109199325 CCCCCTTTAGGAAGGGGAAATGG + Intronic
1102459565 12:113091941-113091963 ACCTGTTTATGCAGGGGAACTGG - Intronic
1102600346 12:114025029-114025051 CCCTACTTATGAAGGGGAAAGGG - Intergenic
1104175445 12:126326824-126326846 ACCTGTTTGTGAATGTCAAATGG + Intergenic
1109323827 13:60843151-60843173 ACATGTTTATGAATGACAAAAGG - Intergenic
1110097697 13:71550552-71550574 CCCTGTAAATGATGGGCAATTGG - Intronic
1115128512 14:30025278-30025300 ACCTTTTCATGAGGGGCAAAAGG + Intronic
1120330099 14:83081802-83081824 CCCTTTTTTTAAAGAGCAAAAGG - Intergenic
1120886961 14:89459389-89459411 CCCTGTTCCTGAAAGGCTAATGG - Intronic
1127613033 15:60655715-60655737 ACCTGCTGAAGAAGGGCAAAGGG + Intronic
1127750329 15:62033129-62033151 GCCTGTTTATTTTGGGCAAATGG - Intronic
1128818199 15:70629607-70629629 CACTGGTTTTGAAGGGGAAAGGG - Intergenic
1129457519 15:75683618-75683640 CCCTCCTTATGTTGGGCAAAGGG + Intronic
1132612324 16:823483-823505 CCCTGTGTATCACGGGCAGAAGG + Intergenic
1133189822 16:4125414-4125436 CCTAGGTTACGAAGGGCAAAGGG - Intergenic
1135094721 16:19555623-19555645 CCATGTTTGTGAAGGGCAGCTGG - Exonic
1137881753 16:52056375-52056397 CTCTGTTGCTGTAGGGCAAAAGG + Intronic
1139369327 16:66456673-66456695 CCCTATTTCTGCAGAGCAAATGG - Intronic
1140106340 16:71963964-71963986 CCCTGATGATGAAAGGCAGATGG - Intronic
1146470384 17:33119828-33119850 TCCTGATTGGGAAGGGCAAAGGG - Intronic
1146905891 17:36617750-36617772 CCCAGGCTAGGAAGGGCAAAGGG - Intergenic
1148111497 17:45147127-45147149 CCCTGTTTATGGAGGGCTGGGGG + Intergenic
1149309785 17:55382771-55382793 CCTTGGTTATGAAGGGAAAGAGG - Intergenic
1149423700 17:56534610-56534632 CCCTGTCTTTGGAGGGAAAATGG + Intergenic
1150825126 17:68467657-68467679 CTCTCTTTATGAAGCTCAAATGG + Intergenic
1154463749 18:14622739-14622761 CCCTGGCTAGCAAGGGCAAAGGG - Intergenic
1155178421 18:23321901-23321923 CCCTGTATCCGAAGGGAAAAAGG - Intronic
1155837184 18:30600523-30600545 CCCTCTTTATGAGGGTTAAATGG + Intergenic
1156071041 18:33209562-33209584 CCCTGTTTAGGAAGTGGTAAAGG - Intronic
1157497911 18:48169625-48169647 TCTTCTTTATCAAGGGCAAATGG + Intronic
1157521722 18:48349933-48349955 CCCTGTTTATGAAGGGCAGGTGG - Intronic
1162393584 19:10403910-10403932 CCCCGTTTACGAAGGGCAGGGGG - Intronic
1168270234 19:55245793-55245815 CCCTGTCCAGGAAGGGGAAAGGG + Intronic
1168641859 19:58035956-58035978 CCATGTTGATGAAGGTCACATGG + Exonic
928007740 2:27578949-27578971 CTTTGATTATGAAGGGCCAAAGG - Exonic
930653070 2:53981585-53981607 CCCTTTTTATGCGTGGCAAATGG - Intronic
930932597 2:56905392-56905414 CCTTGGATATGAAGGGCCAATGG + Intergenic
937305590 2:120868597-120868619 CTTTGTTTCTGAATGGCAAAGGG - Intronic
938817812 2:134922061-134922083 CCCTGTTCTTTTAGGGCAAAGGG + Intronic
940798168 2:158102807-158102829 CTCTGTTTGGGATGGGCAAATGG - Intronic
941605562 2:167592348-167592370 CCCGTTTCATGGAGGGCAAAGGG - Intergenic
942115895 2:172729019-172729041 CCCTGTTTAAAAAGGAAAAAAGG - Intergenic
944012936 2:194995862-194995884 CCCTATTAAAGATGGGCAAAGGG - Intergenic
944637607 2:201689924-201689946 CCCTGTTTATGAAGGGCAAATGG + Intronic
944716334 2:202378410-202378432 CTTGGTTTATGATGGGCAAATGG + Intronic
945011906 2:205473219-205473241 CCCTTTTTATTAATGGGAAAGGG - Intronic
945205935 2:207332387-207332409 CCCAGTTTGTCAAAGGCAAAGGG - Intergenic
945400628 2:209378045-209378067 CCTTTTTAATGAAGGCCAAATGG + Intergenic
947866341 2:233400411-233400433 CACTGGGTGTGAAGGGCAAAGGG - Intronic
1169323441 20:4654899-4654921 CCCTGTAAATGCTGGGCAAAAGG + Intergenic
1175169305 20:57068857-57068879 TCATGGTTATGAAGGGGAAATGG + Intergenic
1179579334 21:42330518-42330540 CCCTGTTTGTGCAGAGAAAAGGG + Intergenic
1182983996 22:34699369-34699391 CCATGGTTAAGAATGGCAAAGGG - Intergenic
1183688415 22:39375032-39375054 GGCTGCTTCTGAAGGGCAAAGGG - Intronic
1184324549 22:43773502-43773524 CCCTGTCTTTGAAAGGGAAATGG - Intronic
953575830 3:44112473-44112495 CTCTGTGTCTGAGGGGCAAAAGG - Intergenic
955494580 3:59518485-59518507 CTCTGTTTATCAAGGGCCAGAGG - Intergenic
956173059 3:66448044-66448066 TTCTGTTTATTAAGGACAAATGG + Intronic
956455619 3:69417975-69417997 CCCTGTGAAAGAAAGGCAAAGGG - Intronic
956760465 3:72438909-72438931 CGCTGTGTATGGAGGGCAGACGG + Intronic
956885081 3:73551109-73551131 CCCTGTATGTGCAGGGCCAAAGG + Intronic
958263779 3:91413353-91413375 CCTTGTGGATCAAGGGCAAATGG + Intergenic
961578922 3:127861990-127862012 TACTGTTGATGAAGGGGAAAAGG - Intergenic
961682694 3:128609417-128609439 CCCGTTTTATGAATGGAAAATGG + Intergenic
962275922 3:134013441-134013463 CCCTGTTGGTGGGGGGCAAAGGG - Intronic
965427673 3:168547233-168547255 CCATGTTTGTGAAGGGAAAGTGG + Intergenic
967713146 3:192732338-192732360 AACTGTTTTTGATGGGCAAAGGG - Intronic
968561654 4:1286345-1286367 CTCTGCTGGTGAAGGGCAAAGGG + Intergenic
968600390 4:1505990-1506012 CCCTGCTTCTGGAGGGCACAGGG - Intergenic
970741462 4:19243169-19243191 CAGTGTTTATGAAGATCAAATGG - Intergenic
970903464 4:21187377-21187399 TAATGTTTATTAAGGGCAAAGGG + Intronic
972798715 4:42449411-42449433 CACTGTTTGTGGATGGCAAAAGG + Intronic
975616626 4:76253401-76253423 CCCTCTTTAAGAATTGCAAAAGG - Intronic
976857316 4:89620059-89620081 CACTCTTTATGAAGGAGAAAAGG + Intergenic
977456178 4:97262878-97262900 CTCTGTGTATGAAGGGCCCATGG - Intronic
980979423 4:139641507-139641529 CCCTGATTATCAAGGGGAATGGG - Intergenic
981228390 4:142323816-142323838 CCCTTTTTATGTGAGGCAAATGG + Intronic
983004758 4:162470248-162470270 TTTTGTTAATGAAGGGCAAAAGG - Intergenic
985571180 5:646365-646387 CCCAGTTTCTGTAAGGCAAAGGG - Intronic
987535636 5:19184377-19184399 CCCTGTTTCATGAGGGCAAAGGG - Intergenic
990036102 5:51321985-51322007 TCCTGTTTATGAACTACAAAAGG - Intergenic
992404255 5:76441800-76441822 CCCTCTTTATGGATGGCACAGGG - Intronic
993564120 5:89452081-89452103 CCCTGATTATCAAGTTCAAAGGG - Intergenic
994870870 5:105349217-105349239 CCTTGTTCCTGAAGGTCAAAGGG + Intergenic
996347788 5:122506073-122506095 CCCTGTTTATGGAGGGAAGATGG - Intergenic
999728361 5:154455724-154455746 CCCTGGGGAGGAAGGGCAAAGGG + Intronic
999982649 5:156972641-156972663 TCATGTTTGGGAAGGGCAAAGGG + Intergenic
1000774185 5:165396475-165396497 CCATGTTTATGATGGTCTAAAGG + Intergenic
1003623273 6:7721024-7721046 CCCTGGTTTTGAAGGGGAAGAGG - Intergenic
1005827327 6:29641882-29641904 CACTGTTAGTGAAGGGCAGAAGG - Intergenic
1006116219 6:31777409-31777431 CCCTGGTTCTGGAGGGCAGAGGG - Intergenic
1008242725 6:49131417-49131439 ACCTGGTGATGAAGTGCAAATGG + Intergenic
1008876381 6:56334201-56334223 CCATGTTTCTGGAGGGCAGATGG - Intronic
1010730461 6:79385339-79385361 TACTGTTTCTGTAGGGCAAAGGG - Intergenic
1012924203 6:105251210-105251232 TTCTGTTTAAGTAGGGCAAATGG + Intergenic
1014012474 6:116492278-116492300 CCCTGTTTATGAGAGACAAAAGG - Intergenic
1014334315 6:120113422-120113444 CCCTGGTTACGAAGGGCCAGGGG + Intergenic
1014690349 6:124555652-124555674 CCCAGTTTTTCAAAGGCAAATGG + Intronic
1014825527 6:126045515-126045537 GCCTGTTAATGAGGAGCAAATGG + Intergenic
1015294128 6:131571001-131571023 CCCTATTTAGGAAAGGCAGAGGG + Intergenic
1015471168 6:133607903-133607925 TCCTGTGTGTGAAGAGCAAAAGG - Intergenic
1017537750 6:155366565-155366587 CCCAGAGAATGAAGGGCAAAGGG - Intergenic
1022107076 7:27204353-27204375 CCCTCTTTCTTAAGGGGAAAGGG + Intergenic
1023595043 7:41820668-41820690 CTCTGTTTATGTAGGGGGAAGGG + Intergenic
1024601519 7:50985768-50985790 GCCTGTTTAAGAATGGGAAAGGG + Intergenic
1024683961 7:51724797-51724819 CCCCCTTGATGAAGGACAAATGG + Intergenic
1028057903 7:86271219-86271241 CCCAGTTTAGGAAGTGCTAATGG - Intergenic
1028989266 7:97032645-97032667 CCATGTCTATGAAAGACAAATGG + Intergenic
1029431429 7:100533464-100533486 CCCTGATTATGAAGGGAAAATGG + Intergenic
1031342091 7:120615361-120615383 CTCAGTTTCTGAAGGCCAAATGG + Intronic
1032914816 7:136478028-136478050 CTCTGTTTGTGTAAGGCAAATGG + Intergenic
1034735148 7:153422063-153422085 TTCTGATTATGAAGGGAAAAGGG + Intergenic
1035472775 7:159120747-159120769 CCCTATTTATGACGGGTAAGAGG + Intronic
1037829686 8:22180139-22180161 CCCTGTTTGTGAAGGCAATATGG - Intronic
1038003855 8:23413467-23413489 CACTGTGTATGAGGGGCATATGG - Intronic
1039897069 8:41724230-41724252 CCATTTTTAGGATGGGCAAATGG + Intronic
1040555571 8:48474946-48474968 CCCCATTTATAAGGGGCAAATGG + Intergenic
1040587112 8:48754719-48754741 GCCTGTTTATGAAAAGGAAATGG - Intergenic
1043918207 8:85949300-85949322 CCTTGTTTATGTGGGACAAAGGG - Intergenic
1046801999 8:118438944-118438966 CACTGTTTGTGCAGGGAAAAGGG + Intronic
1046970987 8:120223168-120223190 CCCAGATTATGAAGGCCAAGAGG + Intronic
1047480612 8:125278515-125278537 CCCTGAGTGTGAAGGGCAAGTGG - Intronic
1047566220 8:126046969-126046991 CCCTGAGTATGAAGGAAAAAGGG + Intergenic
1048303386 8:133267281-133267303 CCCTGTTCCTGAATGGCACAGGG + Intronic
1052444108 9:28537349-28537371 CCGTGCTAATGAAGGGGAAAGGG - Intronic
1058055948 9:100448957-100448979 CCCTGTTAATAAAAGGAAAATGG - Intronic
1061283103 9:129608665-129608687 CCCTGTAGATGCAGGGCCAAGGG - Intergenic
1186917874 X:14243671-14243693 ACTTGTTTATGAAGAGGAAACGG + Intergenic
1188038079 X:25340753-25340775 CTTTCTTTATGAAGGGCAAAGGG - Intergenic
1192171229 X:68856105-68856127 CCCTATTTGTAAAGGGCCAAGGG + Intergenic
1193473546 X:81935373-81935395 CACTGGTGGTGAAGGGCAAAGGG - Intergenic
1193504962 X:82330685-82330707 TCCTGTTTATGAAAAGCAGAGGG - Intergenic
1194295158 X:92118204-92118226 CAGTGTTTCTGAAGGGCATATGG - Intronic
1194839800 X:98726450-98726472 TCCTGTTTATTCAGGGCCAAGGG + Intergenic
1195155080 X:102115101-102115123 CCCTGTTTTAGAAGGTTAAATGG + Intergenic
1200049854 X:153422983-153423005 CCCTGTTTCTGCAGGGCTAAGGG - Intergenic
1200612658 Y:5342728-5342750 CAGTGTTTCTGAAGGGCATATGG - Intronic
1201428393 Y:13879827-13879849 TACTGTTTCTGATGGGCAAAAGG + Intergenic