ID: 944638086

View in Genome Browser
Species Human (GRCh38)
Location 2:201694141-201694163
Sequence GGTTAAGAGTAGGCACCACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 87
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 81}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944638086 Original CRISPR GGTTAAGAGTAGGCACCACA GGG (reversed) Intronic
903367403 1:22813578-22813600 GGTCAGCAGTAGGCACCACGAGG + Intronic
904745298 1:32707054-32707076 GGCTAAGAGTAGCCAGCCCAGGG - Intergenic
906814705 1:48866979-48867001 AGTCAAGAGGAGGCAGCACAGGG + Intronic
917436680 1:175029255-175029277 GGTAAAGATTAGACACCAAAAGG - Intergenic
919946625 1:202323859-202323881 GGCTAATTGTGGGCACCACAGGG - Intergenic
920719636 1:208375103-208375125 GGCCAAGAGTAGGCACCTGAGGG + Intergenic
924805529 1:247358570-247358592 GGTTAGGAGAAGACATCACAAGG + Intergenic
1064229834 10:13520349-13520371 GGTGCAGAGGAGGCACCACAGGG - Intronic
1065918658 10:30372405-30372427 GTTTAAGAGTAGGGAACATAGGG - Intronic
1074415944 10:113266676-113266698 CGTTCAGAATAGGTACCACAGGG - Intergenic
1077471754 11:2766470-2766492 GGGTAAGAGTAGATGCCACAAGG + Intronic
1077852105 11:6083168-6083190 AGGAAAGAGTAGGCACGACAAGG + Intergenic
1082647439 11:55745774-55745796 AGTTAAGAATAGGGACTACAGGG + Intergenic
1084245242 11:67852508-67852530 GGTAAAGAGAGGGCACCACTGGG + Intergenic
1084861690 11:72022981-72023003 GGTTAAGAGAAGGCCCTGCAGGG + Intronic
1091140625 11:133231401-133231423 GGGTGAGAGTTGGCAGCACAGGG + Intronic
1098915083 12:76249008-76249030 GGTGAAGAGGATGGACCACATGG + Intergenic
1100372008 12:93976938-93976960 GTGTAAGAGTAGGCACAAGATGG - Intergenic
1102884445 12:116511071-116511093 GGGTAAGAGGAGGCACCCCCGGG - Intergenic
1106909874 13:34452219-34452241 GGTTCAGGGAAGGCACTACATGG + Intergenic
1108020355 13:46121796-46121818 GGTTAAGAGTAGACACTGCAGGG + Intergenic
1115747153 14:36449556-36449578 GGTCAAGAGTACCCACCTCAGGG - Intergenic
1118671196 14:68129455-68129477 GGTTCAGTGTAGATACCACAGGG + Intronic
1119492634 14:75050265-75050287 GGTTAAGTATAGTCACCTCAGGG + Intronic
1129752323 15:78074933-78074955 GGAAAATAGTAGGCACTACATGG - Intronic
1135073121 16:19369809-19369831 CCTTAAGTGTAGGCAGCACACGG + Intergenic
1145289444 17:21531515-21531537 GGTTGAGAGTAGGAACAAGAAGG - Exonic
1150730489 17:67688796-67688818 GGTAAAGAGGAGACACCAGATGG + Intronic
1150785147 17:68156793-68156815 GATTAAGGGTAGACAGCACAAGG + Intergenic
1164671433 19:30074285-30074307 GGTTGAGTGTGGGCACCCCAAGG - Intergenic
1165424188 19:35736986-35737008 GGTAAGGAGTGGGCCCCACAGGG + Exonic
1168048151 19:53808967-53808989 GGTTAAGAGCATGAACCTCAAGG + Intronic
924963708 2:57249-57271 GGCTATGAGGGGGCACCACAGGG + Intergenic
928398969 2:30964440-30964462 GGTTAAGTGTGGGGACAACAGGG - Intronic
936149412 2:110006123-110006145 GTTTTAGAGTATGCACCACGTGG + Intergenic
936195267 2:110365247-110365269 GTTTTAGAGTATGCACCACGTGG - Intergenic
940977856 2:159966379-159966401 GGTTCAGAGTAGGAAGAACAGGG + Intronic
941280861 2:163549106-163549128 AGAGAAGAGTGGGCACCACAAGG + Intergenic
944638086 2:201694141-201694163 GGTTAAGAGTAGGCACCACAGGG - Intronic
948121755 2:235536025-235536047 GGTCTAGAGGAGGCACCACCAGG - Intronic
1170722831 20:18899536-18899558 TGTTAAGAGTAAACACCACAGGG - Intergenic
1171036405 20:21715523-21715545 GGGTAGGAGTAGGGAGCACAGGG + Exonic
1172921989 20:38491141-38491163 GGTTAAGGGTAGGAAATACATGG - Intronic
1174026371 20:47579972-47579994 GAATAAGAGCAGACACCACATGG - Intronic
1181056984 22:20264987-20265009 GGTCAAGAGCAGGAAGCACACGG - Intronic
1181574052 22:23782885-23782907 GGTTAGGAGCAGGGACCACCAGG - Intronic
1184942807 22:47781426-47781448 GCCTAAGAGTAGGCCCCTCATGG - Intergenic
950636996 3:14322560-14322582 GGTTAAGGGTTGGCACCAACTGG - Intergenic
953280825 3:41554647-41554669 TGTTAACTGTAGGCACCATATGG - Intronic
954471450 3:50699636-50699658 GCTTAAGTGTATGCACCATATGG + Intronic
954705487 3:52478405-52478427 TGTTAAGAGAAGGGACCAAAGGG + Intronic
955480258 3:59382719-59382741 GGGGAAGAGCAGGCACCACCTGG - Intergenic
961205309 3:125076730-125076752 GGTAATGTGTAGCCACCACATGG + Intergenic
964327502 3:155563125-155563147 GATTAGGAGTAGGGAGCACAAGG - Intronic
964903589 3:161691439-161691461 GGTTCAGAGTACCCAGCACAAGG + Intergenic
965665652 3:171090795-171090817 GGATAAGGGTATGCACTACAAGG + Intronic
971785355 4:31095317-31095339 GATTAAGGGTAGGAACCAAAAGG + Intronic
976314208 4:83642198-83642220 TTTTAAAAGTAGGCACTACATGG + Intergenic
985102190 4:186469571-186469593 GGCTAAGAGTAGGCAACAACCGG + Intronic
987690430 5:21259400-21259422 GCTTAAGTGTAGTCACCACTTGG - Intergenic
1003610426 6:7609275-7609297 GGTAAACAGTAGTCACCACTGGG - Exonic
1010087372 6:71936728-71936750 GATAAAGAGTAGTCACCAGAAGG - Intronic
1010742814 6:79527792-79527814 GGTTAAGAGCAGACATCACAGGG + Intronic
1010938457 6:81888080-81888102 GGTTCAGAGTATGACCCACAAGG - Intergenic
1013078671 6:106793312-106793334 GGTCAACAGTAGACACCACAGGG + Intergenic
1019861235 7:3659851-3659873 GGTTAAAAGTAGAATCCACAGGG + Intronic
1021619960 7:22541583-22541605 GGCTAAGAGGAGGCACCAATGGG + Intronic
1022707064 7:32811980-32812002 GGGTAAGAGTAGGAACTAGATGG - Intergenic
1022744611 7:33157910-33157932 GGTAAAGAGAAAGCATCACATGG + Intronic
1022915806 7:34950648-34950670 GGGTAAGAGTAGGAACTAGATGG + Intronic
1024228599 7:47346947-47346969 GGTCAAGAGTGGGGACCCCAGGG - Intronic
1029812762 7:103065903-103065925 GCTGAAGAGTGGGCACCACTGGG + Intronic
1031250369 7:119372603-119372625 ATTTTAGAGTATGCACCACATGG - Intergenic
1035399567 7:158555933-158555955 GGTACAGAGTTGGCACCAAATGG + Intronic
1035867519 8:3100907-3100929 GGATAATAGCAGGCATCACAAGG - Intronic
1041428264 8:57748172-57748194 GCTTTAGAGAAAGCACCACAGGG + Intergenic
1044218052 8:89635969-89635991 TCCTAAGAGTAGCCACCACAAGG - Intergenic
1048817857 8:138350856-138350878 GGTGGTGGGTAGGCACCACAAGG - Intronic
1049233037 8:141494119-141494141 AATTAAGACTCGGCACCACACGG + Intergenic
1055294256 9:74818093-74818115 GGTCAAGAGAAGGCAGCAAAGGG - Intronic
1061064966 9:128272002-128272024 GTTTAAGAGTAGGGAACAAAGGG - Intronic
1061950380 9:133932767-133932789 GGATGAGAGGAGGCACCAGAAGG + Intronic
1190687646 X:52888738-52888760 GGTTATGAGTCTGCACCGCAGGG + Intergenic
1190698336 X:52967054-52967076 GGTTATGAGTCTGCACCGCAGGG - Intronic
1195670038 X:107461916-107461938 GGATAAGAGTAAGCACCAAGTGG - Intergenic
1196066171 X:111466999-111467021 GCTTCAGAGTAGCCACCACCTGG - Intergenic
1196676009 X:118420606-118420628 AGTTAAGATTAGGCAATACAGGG - Intronic