ID: 944640059

View in Genome Browser
Species Human (GRCh38)
Location 2:201715748-201715770
Sequence CTGGGCCCTCACAGCCCAGT TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 316
Summary {0: 1, 1: 1, 2: 0, 3: 22, 4: 292}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944640049_944640059 4 Left 944640049 2:201715721-201715743 CCCATGCTTTCCAAACTTCCCCT 0: 1
1: 0
2: 1
3: 32
4: 301
Right 944640059 2:201715748-201715770 CTGGGCCCTCACAGCCCAGTTGG 0: 1
1: 1
2: 0
3: 22
4: 292
944640054_944640059 -6 Left 944640054 2:201715731-201715753 CCAAACTTCCCCTTGGCCTGGGC 0: 1
1: 0
2: 4
3: 20
4: 239
Right 944640059 2:201715748-201715770 CTGGGCCCTCACAGCCCAGTTGG 0: 1
1: 1
2: 0
3: 22
4: 292
944640050_944640059 3 Left 944640050 2:201715722-201715744 CCATGCTTTCCAAACTTCCCCTT 0: 1
1: 0
2: 7
3: 46
4: 374
Right 944640059 2:201715748-201715770 CTGGGCCCTCACAGCCCAGTTGG 0: 1
1: 1
2: 0
3: 22
4: 292
944640048_944640059 19 Left 944640048 2:201715706-201715728 CCACAGCAATATTGTCCCATGCT 0: 1
1: 0
2: 1
3: 6
4: 106
Right 944640059 2:201715748-201715770 CTGGGCCCTCACAGCCCAGTTGG 0: 1
1: 1
2: 0
3: 22
4: 292

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944640059 Original CRISPR CTGGGCCCTCACAGCCCAGT TGG Exonic
900357128 1:2270406-2270428 TTGGTCCCTCACAGGCCAGGGGG + Intronic
901187720 1:7385934-7385956 AGAGGCCCTCACAGCCCAGAAGG - Intronic
903331893 1:22600800-22600822 CTTGGCACTCACATCCCGGTTGG - Exonic
904010577 1:27387746-27387768 TGGGGGCCTCACAGACCAGTGGG - Intergenic
904256416 1:29257714-29257736 CTGAGGCCTCACAGCCTGGTGGG + Intronic
904418463 1:30376728-30376750 CTGGGCCCTAACAGATGAGTAGG + Intergenic
905908131 1:41633341-41633363 GTGGGCCCTCACTGCCCGGCTGG - Intronic
906606329 1:47174908-47174930 CTGGGCTCACCCAGCCCAGCTGG + Intergenic
907416963 1:54321187-54321209 CTGGGCCCCCAAGGCCCTGTGGG - Intronic
909352010 1:74665141-74665163 CTGGGCCCTCACATGGCAGAAGG - Intronic
913280883 1:117184010-117184032 CTGGGGACTCACTGCCAAGTAGG + Intronic
913549555 1:119903942-119903964 CTGGGTCCTCACATGACAGTAGG - Intergenic
914000988 1:143694080-143694102 CTGGGATCTCCCAGCCCAGGAGG + Intergenic
914198371 1:145462596-145462618 CTGGGATCTCCCAGCCCAGGAGG + Intergenic
914213731 1:145605932-145605954 CTGGGGACTCAGAGCCCAGATGG + Intergenic
914465674 1:147926337-147926359 CTGGGGACTCAGAGCCCAGATGG + Intergenic
914477476 1:148035724-148035746 CTGGGATCTCCCAGCCCAGGAGG + Intergenic
914510961 1:148331455-148331477 CTGGGATCTCCCAGCCCAGGAGG + Intergenic
915074555 1:153297756-153297778 CTGGGCATTCACAGCCCTCTTGG - Intergenic
915515128 1:156408246-156408268 CATGGCCCTCACAACCCAGGAGG + Intronic
915631081 1:157154647-157154669 GTGGGCCCTGCCAGCCCAGAAGG - Intergenic
916725397 1:167518216-167518238 CTGCTCCGTCACAGCCGAGTTGG - Intronic
918163977 1:181926787-181926809 CTGGGCCATCACAGGACAGGAGG + Intergenic
919767195 1:201135114-201135136 CTGGGCCCCCTGAGCCCACTGGG - Exonic
920255247 1:204650156-204650178 CTGAGCCCTCACCTGCCAGTGGG - Intronic
920440170 1:205975621-205975643 CTGGGACCGCACAGTCCAATGGG - Intergenic
922741947 1:228019003-228019025 CTGGCCTCTCACAGCCCTGATGG - Intronic
923631101 1:235649929-235649951 CTGGGCCCCCACGGCACAGGGGG - Exonic
923744433 1:236686923-236686945 CTGTGCCCTCGCAGCCCCGGGGG + Intronic
1062831264 10:607324-607346 CTGTGCCTTCTTAGCCCAGTGGG - Intronic
1064078216 10:12287193-12287215 GTGACCCCTCACAGCCCAGTAGG - Intergenic
1066294234 10:34040362-34040384 CTGAGCCCTCAAAGTCAAGTAGG + Intergenic
1066745608 10:38602716-38602738 TTGGGACCTAACAGCTCAGTAGG - Intergenic
1067665277 10:48272305-48272327 ATTGGCTCTCACAGGCCAGTAGG - Intronic
1069566060 10:69464308-69464330 CAGGGCCCTCCCTGCTCAGTTGG - Intronic
1069614272 10:69796942-69796964 CTGGGAACTCACAGCTCAGGAGG + Intergenic
1069911224 10:71761031-71761053 CTGGGCCAACACTGCCGAGTAGG - Intronic
1071299412 10:84245203-84245225 CTGGGTCCTCAGAACCCACTGGG - Intronic
1071601964 10:86962752-86962774 CTGGGCCCTGGGAGCCCAGGAGG - Intronic
1072249549 10:93570694-93570716 CTGGGCACCCACAGCCCACATGG - Intronic
1073320587 10:102613932-102613954 CTGGGGCCTTAAAGCCCAGCAGG + Intronic
1073330349 10:102666392-102666414 CCAGGCACTCACAGCCTAGTTGG - Intergenic
1073484858 10:103810346-103810368 CCAGGCCCTCACAGCCCAGCAGG + Intronic
1073844433 10:107537638-107537660 CTGGGACCTAACAGACCAATGGG - Intergenic
1074289499 10:112127793-112127815 CTAGGCCATCATAGCCCAGATGG - Intergenic
1075291792 10:121237079-121237101 CTGGGCCACCACAGAGCAGTGGG + Intergenic
1076000480 10:126908797-126908819 CTTTTCTCTCACAGCCCAGTAGG + Intronic
1076676186 10:132148882-132148904 CTGGAGCCTCACAGTCCAGCTGG + Intronic
1078467463 11:11560763-11560785 TTGGGCCCTCAGACCCCACTGGG + Intronic
1079119600 11:17672446-17672468 CTGGGCCCTATCAGACGAGTGGG - Intergenic
1079240696 11:18720526-18720548 CTGGGAGCTCACAGCCAAGGGGG - Intronic
1079348077 11:19670310-19670332 CCGGGCCATCACAGCCTTGTTGG + Intronic
1080063410 11:27981569-27981591 CTGGCCTCCCTCAGCCCAGTGGG + Intergenic
1082793133 11:57361083-57361105 CTGGGTCCACACATCCCAGCTGG - Intronic
1083252214 11:61475646-61475668 CTGAGCCCTCCCAGCCCAGGAGG - Intronic
1083282577 11:61636332-61636354 CTGGAACCTCAGAGCTCAGTAGG - Intergenic
1083294949 11:61710239-61710261 CTGGGACCTCACTCCCCAGATGG - Intronic
1083778487 11:64906245-64906267 CTGGGGCCTCACCGCGCACTGGG + Intronic
1084113777 11:67030168-67030190 CTGGGCACTCACCGCTCAGATGG - Exonic
1084301234 11:68254007-68254029 CTGGGCTGTGACAGCCCACTAGG + Intergenic
1084331723 11:68434269-68434291 CTGGGCCCTCTCTGACCAGCAGG + Intronic
1084594455 11:70108727-70108749 CTTGACCCTCACGGTCCAGTGGG + Intronic
1084660085 11:70541606-70541628 CCGGGCTCTCAGAGCCAAGTTGG - Intronic
1084936655 11:72590415-72590437 CCGGGCCCTCACCGCACAGTTGG + Exonic
1084973218 11:72782365-72782387 CTGGGTTTGCACAGCCCAGTGGG - Intronic
1085299248 11:75448941-75448963 CAGGGTCCTAACAGCCCCGTTGG - Intronic
1085307482 11:75496162-75496184 CTGGGCCCTCCCAGCCTAGCCGG - Intronic
1085703782 11:78768220-78768242 CAGGGCCCTCTCAGTTCAGTGGG - Intronic
1087795963 11:102454761-102454783 CTGTGCCCTCACAGTACAGAAGG - Intronic
1090396650 11:126423807-126423829 CTGGGGTCACACAGCCCAGGAGG + Exonic
1090478340 11:127045558-127045580 ATGGGGCCTCATGGCCCAGTGGG + Intergenic
1090478632 11:127047921-127047943 CTGGGGCCTCATGGCCCAATGGG + Intergenic
1091126503 11:133104075-133104097 CTGCTCAGTCACAGCCCAGTGGG + Intronic
1091143710 11:133258786-133258808 AGGAGCCCTCACAGCCCAGGGGG + Intronic
1091316164 11:134615484-134615506 AGGGGCCCTCAGAGCCCAGAGGG - Intergenic
1092365506 12:7873310-7873332 CTGGGCCTTCCCAGCCCAGCCGG - Intronic
1094500675 12:31018279-31018301 CTAGGCCCACTCAGCCCAGCTGG - Intergenic
1098234564 12:68406281-68406303 AAGGGCCCTGACAGCCCAGCTGG + Intergenic
1099682262 12:85844079-85844101 CGGTGCTGTCACAGCCCAGTCGG + Intergenic
1102182579 12:110923626-110923648 CTGGGCCCCCAGAGTCGAGTGGG + Intergenic
1103254001 12:119524546-119524568 CTGGGAGCTAACAGTCCAGTAGG + Intronic
1103274104 12:119697266-119697288 GATGGCACTCACAGCCCAGTGGG - Intronic
1103575355 12:121873369-121873391 CTGGTCCCTTTCAGCCCAATGGG + Intergenic
1103618513 12:122171103-122171125 CTAGGCCCTGAAAACCCAGTGGG + Intronic
1104003536 12:124875687-124875709 CTGGGCCCCCTCTGCACAGTGGG + Intronic
1104260507 12:127177787-127177809 CAGGTCCCTCACAGCTCAGATGG - Intergenic
1104503603 12:129309926-129309948 CCGGGCCCTTCCAGCTCAGTCGG - Intronic
1105061124 12:133151940-133151962 CTGGCACCTCACAGCCCATCTGG - Intronic
1105237219 13:18568154-18568176 AAGGGCCCTCACAGCGCAGGGGG + Intergenic
1105501244 13:20974793-20974815 CGGTGCCCTCACAGGCCAATAGG - Exonic
1105750887 13:23420913-23420935 CTGGGGCCTCAGTGCCCACTTGG + Intronic
1106757616 13:32838561-32838583 CTGCGACCTCACAGCCCAGCTGG - Intergenic
1107239794 13:38218740-38218762 CTGTGTCCTCACAGGGCAGTAGG + Intergenic
1108561116 13:51645291-51645313 CAGGGCCTTCAAAACCCAGTGGG + Intronic
1111319737 13:86611482-86611504 CTAGCCCCTCACTGCCCAATAGG - Intergenic
1112098441 13:96160854-96160876 CAGGGCCATCCCAGCCCTGTGGG - Intronic
1112466823 13:99652164-99652186 GTGGGCCCTATTAGCCCAGTTGG - Intronic
1113778450 13:112962445-112962467 CTGGCTCCTCACAGCACAGCAGG - Intronic
1114615564 14:24066382-24066404 CTGGGCCCTGAAAGAACAGTGGG - Exonic
1115545626 14:34462565-34462587 CGGGGCCCCCGCAGCCCAGCGGG + Intronic
1119955684 14:78796345-78796367 CTGTGCCATTACAGCCCAGTTGG - Intronic
1120019082 14:79507902-79507924 CTGGGCCCAGGCATCCCAGTAGG - Intronic
1120979644 14:90278748-90278770 CTGGGCTCTCACAGCCAGGCTGG + Intronic
1121688462 14:95857119-95857141 CAAGGCACTCACAGCCCAGTGGG - Intergenic
1121743019 14:96267225-96267247 CTGGGCCCTCACAGGCAGGCGGG + Intronic
1122124300 14:99570867-99570889 CTGGGACCACCCAGGCCAGTTGG - Intronic
1122699592 14:103578985-103579007 CTGGGGCCACACAGCCAGGTGGG + Intronic
1123886092 15:24729529-24729551 CTGGTCCCTCAGAGGTCAGTGGG + Intergenic
1125984460 15:44036456-44036478 CTGGGCCCTTGCAGCCGATTGGG + Intronic
1126215354 15:46147258-46147280 CTGGGCTCTTTCAGCCCACTTGG - Intergenic
1126857074 15:52848859-52848881 CTGGGGTCTCACAGCACAGTAGG - Intergenic
1129470297 15:75750031-75750053 CTGGGCACCCCCAGCCCAGAGGG + Intergenic
1130328172 15:82898056-82898078 CTGCCCACTCACAGCCCTGTTGG - Intronic
1130381722 15:83377795-83377817 CTGGGCATTCCCAGTCCAGTGGG - Intergenic
1130607646 15:85332117-85332139 CAGTGACCTCACAGCCCGGTGGG + Intergenic
1130696840 15:86139810-86139832 CTGGGCCCTCTCACCCAGGTGGG - Intergenic
1132198052 15:99928648-99928670 CTGCGGCCTCTCAGCCCAGAAGG + Intergenic
1132612769 16:825453-825475 CCGGGCCCGCCCAGCCCAGGGGG + Intergenic
1133730008 16:8570647-8570669 CTGGACACTCACAGGCCACTGGG - Intronic
1134046004 16:11101510-11101532 GTAGGACCTCACAGCCCAGTAGG - Intronic
1135870043 16:26141416-26141438 CTTGGTACTCCCAGCCCAGTGGG + Intergenic
1136355939 16:29744865-29744887 CATGGCCCTCACTGCCCTGTGGG - Exonic
1136737456 16:32476933-32476955 TTGGGACCTAACAGCTCAGTAGG + Intergenic
1137288461 16:47035651-47035673 CTGGGCCCTCGCAGCCAGGGAGG - Intergenic
1137707447 16:50545362-50545384 CTGGTGCCTCCCAGCCCAGCAGG - Intergenic
1138652225 16:58467105-58467127 CTAGGCTCACACAGCCCACTCGG + Intronic
1139373340 16:66481561-66481583 GGAGGCCCTCACAGCCCACTAGG + Exonic
1139491910 16:67290783-67290805 CTGGGCCAGCACTGCCCAGAAGG - Intronic
1139599381 16:67977405-67977427 CAGGGCCCCCACAGCACAGGAGG - Intronic
1139948890 16:70659801-70659823 CTGGGCCCACCCAGGCCAGCTGG + Intronic
1139952234 16:70678043-70678065 TGGGGCCCACACAGCCCAGAGGG + Intronic
1141252071 16:82368205-82368227 CCTGGCACTCACAGCCCAGCTGG - Intergenic
1141703710 16:85653641-85653663 CTGGGCCCTGACTGGCCAGCTGG - Intronic
1141766372 16:86062461-86062483 CTTGGCCGGCACAGCCAAGTGGG - Intergenic
1141927985 16:87181842-87181864 CTGAGCCCACACAGCACAGGTGG - Intronic
1142182692 16:88678923-88678945 CTGGCCACTCACAGGCAAGTGGG + Intronic
1203015615 16_KI270728v1_random:352644-352666 TTGGGACCTAACAGCTCAGTAGG - Intergenic
1203033950 16_KI270728v1_random:625802-625824 TTGGGACCTAACAGCTCAGTAGG - Intergenic
1142693066 17:1618585-1618607 TTCGGGGCTCACAGCCCAGTGGG - Intronic
1142847625 17:2689920-2689942 CTGGGCCCTCAGAGCCCAGTGGG - Exonic
1142959309 17:3542745-3542767 CTTGGCCCTCCCAGCCCAGAGGG + Intronic
1143332226 17:6146068-6146090 CTGGGACTTTCCAGCCCAGTCGG - Intergenic
1143375083 17:6462579-6462601 CTGTGCTCTCACAGTGCAGTGGG + Intronic
1143441769 17:6980139-6980161 CTTGGCTTTCACAGCTCAGTTGG - Intronic
1145976576 17:28987363-28987385 CTGGGGCCTCACAGTACAGAGGG - Intronic
1146896444 17:36545203-36545225 CTGGGCGCACCCCGCCCAGTCGG - Intronic
1147193612 17:38750592-38750614 CAGGGCGCTCACAGGCCGGTGGG + Exonic
1147772812 17:42879405-42879427 TTGCGCCCTCAGACCCCAGTGGG - Intergenic
1148149990 17:45391285-45391307 CTGTGAGCCCACAGCCCAGTGGG + Intergenic
1151572069 17:74931465-74931487 CGGGGTCCTCACCCCCCAGTGGG + Intronic
1151726284 17:75886650-75886672 CAGGGACCTCACAGGCCAGCTGG - Intronic
1151885063 17:76918617-76918639 CTGGTCCCTGACAGACCAGATGG - Intronic
1152423393 17:80205776-80205798 CTGGGTCCCAACAGCCCAGCAGG + Intronic
1153572753 18:6489500-6489522 CTGGGTCCACCCAGCCCAGGCGG - Intergenic
1156346697 18:36263520-36263542 CTGGGATCTCAGAGCCCACTTGG - Intronic
1156474465 18:37397036-37397058 CTGGGCCTCCAGAGCCCAGGGGG + Intronic
1157335248 18:46733062-46733084 CAGGGCCAGCACAGCCCAGGGGG + Intronic
1158215562 18:55097340-55097362 CAGAGCCCTCAGAGCCCAGCTGG + Intergenic
1160763422 19:797017-797039 CTTTGCCCTCACGGCCCAGGCGG + Intergenic
1160804380 19:985552-985574 CTGGGGCCCAAGAGCCCAGTAGG - Intronic
1160878413 19:1308554-1308576 CTGGGCACACACAGCCTGGTGGG - Intergenic
1162722841 19:12672764-12672786 CTGTGCCTTCCCAGCCCAGTGGG - Intronic
1163584552 19:18156754-18156776 CTGAGGCCACACAGCACAGTGGG + Intronic
1165324173 19:35104568-35104590 CTTGGCCATCACAGTCCAGGTGG + Intergenic
1165922133 19:39305754-39305776 CTGAGACCTCACAACTCAGTGGG - Intergenic
1166068003 19:40371325-40371347 CTGGGCTCTCACAGTCCCTTGGG - Intronic
925515451 2:4675624-4675646 CTGGGCCCACTCAGCCTGGTAGG - Intergenic
928089726 2:28366723-28366745 CAGGAGCCTCACAGCCCAGAGGG - Intergenic
928118610 2:28565703-28565725 CTGAGCCCTAGCTGCCCAGTTGG + Intronic
928401040 2:30979021-30979043 CTGAATCCTCACAGCACAGTCGG + Intronic
929007809 2:37412444-37412466 CTGGCCTCACACAGCCCAGCTGG - Intergenic
932559900 2:72857830-72857852 GTGGGCACTCACTGACCAGTGGG - Intergenic
934036872 2:88095649-88095671 CTGGGACCTCCCTGCCTAGTAGG - Intronic
934188587 2:89766046-89766068 TTGGGACCTAACAGCTCAGTAGG + Intergenic
937087271 2:119179731-119179753 CAGGGCCCTCACAACACAGGTGG + Intergenic
937868867 2:126773404-126773426 CTGGACCCTCACAGGCAAGAGGG + Intergenic
938512560 2:131966359-131966381 AAGGGCCCTCACAGCGCAGCGGG - Intergenic
940152053 2:150613446-150613468 CTGGGACCTAACAGCCCTGCAGG + Intergenic
941432465 2:165428008-165428030 CTGGGCTCTTTCAGCCCACTTGG - Intergenic
944640059 2:201715748-201715770 CTGGGCCCTCACAGCCCAGTTGG + Exonic
946310675 2:218880946-218880968 TGGGGGGCTCACAGCCCAGTGGG - Exonic
948439868 2:237979729-237979751 CAGGGTCCTCCCTGCCCAGTGGG - Intronic
948444300 2:238020168-238020190 CTCAGGGCTCACAGCCCAGTGGG - Intronic
948543230 2:238704581-238704603 CTGGGACCTCAAAGCCATGTGGG - Intergenic
1169170608 20:3461667-3461689 CTCAGCCCTCACAAGCCAGTGGG - Intergenic
1170569601 20:17625367-17625389 CTGGACCCCCACAGCACAATGGG + Intronic
1170800435 20:19585675-19585697 TTGGGACCTCACATCCCAGGAGG + Intronic
1172010294 20:31842513-31842535 CTGGGCTCCCCCAGCCCAGCCGG + Intergenic
1172037694 20:32021303-32021325 CAAAGCCCTCACAGTCCAGTGGG - Intronic
1173652877 20:44678521-44678543 CTGTGCTCTCACGGCCCTGTGGG - Intergenic
1173704793 20:45101621-45101643 CTCTGCCCTCACAACCCACTTGG - Intergenic
1174169456 20:48606998-48607020 CTGGGCTCCCCCAGCCCAGGTGG - Intergenic
1175187795 20:57190539-57190561 CTGGGGTCTCCCAGCCCAGTGGG + Intronic
1175227266 20:57451876-57451898 CCGGGCCCGCACAGCCCATGGGG + Intergenic
1175726189 20:61320365-61320387 CTGGGGGCTCACAGCCTGGTGGG + Intronic
1175834159 20:61982728-61982750 CTGGGCCCTCGCAGTGCATTGGG - Intronic
1175864990 20:62170758-62170780 CCTGGCTCTCACACCCCAGTGGG - Intronic
1175924701 20:62466031-62466053 CTGTGTCCTCACAGCCCTGGTGG + Intronic
1176062788 20:63179513-63179535 CCGGGGCATCACAGCCCAGCCGG - Intergenic
1176781204 21:13196436-13196458 AAGGGCCCTCACAGCGCAGGGGG + Intergenic
1178478173 21:32956042-32956064 CAGGGTCCTGACAGCCCAGAGGG + Intergenic
1178737928 21:35169459-35169481 CTGGGAGCTCACAGACCACTGGG + Intronic
1178821528 21:35979504-35979526 CTGGGTCCTCACAGGGCAGAAGG - Intronic
1179276807 21:39899451-39899473 CTGGGGCCTCACAACCCCTTTGG + Intronic
1179647309 21:42783907-42783929 CTGGGCTCTCTCAGCCCTGGAGG - Intergenic
1179979659 21:44889439-44889461 CTGAGCCCTCAAAGCCCGGGTGG + Exonic
1180009655 21:45040904-45040926 GTGTGCCCTCACAGCTCAGGCGG - Intergenic
1180535091 22:16388990-16389012 TTGGGACCTAACAGCTCAGTAGG - Intergenic
1181482959 22:23212540-23212562 CAGGCCCCACAGAGCCCAGTGGG - Intronic
1181495234 22:23283897-23283919 TTCGGCCCTCCCAGCCCAGCAGG - Intronic
1182278852 22:29206595-29206617 GTGGAGTCTCACAGCCCAGTGGG + Intronic
1183079020 22:35444494-35444516 CTGGGCCGCGACAGCCCAGGAGG - Intergenic
1183242351 22:36667419-36667441 CATGGCCCTCACTGTCCAGTGGG - Intronic
1183943091 22:41307449-41307471 CTGGGCCTCCATAGCCCGGTGGG - Intronic
1184310465 22:43637977-43637999 CTGGCACCTCACAGCCCTCTAGG - Intronic
1184769004 22:46587212-46587234 CTGGCTCATCACAGCCCAGCGGG - Intronic
949848563 3:8397996-8398018 CGTGGAGCTCACAGCCCAGTGGG + Intergenic
950426642 3:12928001-12928023 CTGGGGCTTCTCAGCCCACTCGG - Intronic
951550246 3:23870082-23870104 GTGGGCCTTCCCAGCCCAGGTGG - Intronic
953885103 3:46710550-46710572 CTGGGACCTCCCAGCACAGCTGG - Exonic
954277848 3:49554288-49554310 CAGGGCCCTCGCAGCCCCGCCGG + Intergenic
955325957 3:58009345-58009367 CTGGGGCCTCCCTGCCCAGGTGG + Intronic
955361019 3:58275017-58275039 CTGGGCAGACACAGTCCAGTGGG + Intronic
960949027 3:122987067-122987089 CTGGGCCCTCACAGAACCGGCGG + Intronic
961167019 3:124770387-124770409 CTGTGCCCCCACAGGCCTGTGGG + Intronic
963643225 3:147882916-147882938 CTAGTCCCCCACAGCCCACTAGG - Intergenic
964707019 3:159629871-159629893 CAAGGACCTCACAGCCCAGGAGG + Intronic
967155705 3:186690111-186690133 CTGGGCCCTCAGACTCCAGCTGG - Intergenic
967156994 3:186702276-186702298 CTGGGCCCTCAGACTCCAGCTGG - Intergenic
969160620 4:5255055-5255077 CCCAGACCTCACAGCCCAGTAGG + Intronic
976390110 4:84498017-84498039 CTGGGCACCCACAACCCAGGCGG - Exonic
978855821 4:113393663-113393685 CGGGGCACTCATAGGCCAGTGGG + Intergenic
982773643 4:159420822-159420844 AGGGGCCCCCACAGCGCAGTGGG - Intergenic
984713148 4:182902781-182902803 CTGGGGCATCGCAGCCCAGCTGG - Intronic
985330080 4:188822569-188822591 CTGAGCCCTCACGGCCGAGGGGG + Intergenic
985576827 5:677491-677513 CTGGCTCCTCTCAGCCCCGTGGG - Intronic
985715919 5:1461496-1461518 CTCTGCCCTCACACCCCAGCAGG + Exonic
987861991 5:23500631-23500653 CTGGGGCTTCACAGAACAGTGGG + Intergenic
988776697 5:34483344-34483366 CTCTGCCGTCACAGCCCATTTGG + Intergenic
989192712 5:38686841-38686863 CTGGGCCAGCACAGTCCATTTGG + Intergenic
990204471 5:53414126-53414148 CTGGGTCCTCCAAGCCCAGGAGG + Intergenic
991571218 5:68055193-68055215 CTGTCCCTTCACAGACCAGTGGG - Intergenic
992075276 5:73187172-73187194 ATGTGTCCTCACAGCCCTGTGGG + Intergenic
997615785 5:135245408-135245430 TGGGGCCTCCACAGCCCAGTTGG - Intronic
997801436 5:136866423-136866445 CAAGGAACTCACAGCCCAGTAGG - Intergenic
997979041 5:138457776-138457798 TTGGCAGCTCACAGCCCAGTGGG - Intergenic
998476573 5:142427245-142427267 CTAGGCCCTTCCAGCCCCGTTGG + Intergenic
1001307605 5:170586943-170586965 CATGGAGCTCACAGCCCAGTGGG + Intronic
1001669995 5:173465888-173465910 CTGGGCGCACACAGAGCAGTGGG - Intergenic
1002330555 5:178437621-178437643 CTGGGCCCTGAGAACTCAGTGGG - Intronic
1002552726 5:180008328-180008350 CTGGTCTCACAGAGCCCAGTGGG + Intronic
1003189918 6:3865593-3865615 CTGGGCTCGCACATCCCAGATGG - Intergenic
1005090664 6:22053650-22053672 TTGGGCCCTCCCTGCCCACTTGG - Intergenic
1006294171 6:33162547-33162569 CTGGGCCCTGACACCCCAGCTGG + Intergenic
1006523202 6:34583928-34583950 CTTCTCCCTCACAGCCCAGCAGG + Intergenic
1010731664 6:79397670-79397692 CAGGGCTTGCACAGCCCAGTAGG + Intergenic
1015050734 6:128836347-128836369 ATGGGCCCTCACAGTCCTCTAGG - Intergenic
1015842008 6:137487293-137487315 CTGTGCCCTCAGAGCCTAGAGGG - Intergenic
1017411563 6:154172888-154172910 CTGGAGCCTCACCTCCCAGTAGG + Intronic
1019544211 7:1565380-1565402 CTGCGGGTTCACAGCCCAGTTGG - Intergenic
1019667416 7:2258831-2258853 CTGTGCACTCACTGCCCTGTTGG - Intronic
1019701997 7:2478529-2478551 CTGGGCTCACACAGCCCTTTTGG - Intergenic
1020106902 7:5426506-5426528 CTGGGCGCACAAAGCCCAGGCGG - Intergenic
1026142039 7:67714573-67714595 CTGGGCCCCCACCCCACAGTAGG - Intergenic
1026812807 7:73482913-73482935 CTGGGCAGTCACAGCCAAATGGG + Intronic
1027607397 7:80317489-80317511 CCGGGTCCTCTGAGCCCAGTGGG + Intergenic
1030007772 7:105135413-105135435 CTGGTCCCTCACTGACCAGTTGG - Intronic
1033435050 7:141325590-141325612 CTGGGCCCTGTCAGTGCAGTAGG - Intronic
1033527938 7:142234849-142234871 CTCGGCCCCCTCAGCACAGTAGG + Intergenic
1036522682 8:9506708-9506730 CAGGGAGCTCACAGCCTAGTGGG + Intergenic
1038498649 8:28025071-28025093 CATGGAGCTCACAGCCCAGTGGG - Intronic
1039424771 8:37476870-37476892 CAGGACTCTCACAGACCAGTGGG + Intergenic
1039473395 8:37827125-37827147 CATGGGCCTCACAGCCCAGTGGG - Intronic
1040302418 8:46194923-46194945 CTGGGGCATTACAGCCCATTTGG - Intergenic
1040315410 8:46258294-46258316 CTGGGGCTTCACAGCCCACCAGG - Intergenic
1040317434 8:46272327-46272349 CTGGGACTTTACAGCCCACTTGG - Intergenic
1040324155 8:46333166-46333188 CTGGGCCCTTACAACCCACTAGG - Intergenic
1040330819 8:46384902-46384924 CTGGGGCTTTACAGCCCAGCTGG - Intergenic
1041360639 8:57049799-57049821 CTTGGCCCTGGCAGCCAAGTGGG + Intergenic
1041784546 8:61616856-61616878 CAGGGAACTCACATCCCAGTAGG - Intronic
1042367709 8:67955496-67955518 CTGAGCCTTGAAAGCCCAGTAGG - Intronic
1047367742 8:124227911-124227933 CCAGGGACTCACAGCCCAGTGGG + Intergenic
1048044063 8:130756752-130756774 CTTGGCCCTAACAGCCAAGTCGG + Intergenic
1048645352 8:136413682-136413704 CTGTGCCCTCACATACCAGAAGG - Intergenic
1049355783 8:142187402-142187424 CTTGCCCCTTACAGCCCAGTTGG - Intergenic
1049599350 8:143499882-143499904 ACCGGCCCTCACAGCCCAGGAGG + Intronic
1051359387 9:16268684-16268706 CTGGCCCTGCACAGCCCACTCGG - Intronic
1052854875 9:33401082-33401104 CTGGGACCTCAGAGGCGAGTGGG + Intronic
1053143682 9:35697709-35697731 TTGGGCCCCGACAGCCCAGAAGG + Exonic
1053433441 9:38059156-38059178 ATGGGCTCTCACAGCCCCCTGGG + Intronic
1053543506 9:38998816-38998838 CTGGGACCTCACAACCCTGCTGG - Intergenic
1053682894 9:40497411-40497433 CTGGGACCTCAGAGGCGAGTGGG + Intergenic
1053932875 9:43125725-43125747 CTGGGACCTCAGAGACGAGTGGG + Intergenic
1054280820 9:63127517-63127539 CTGGGACCTCAGAGGCGAGTGGG - Intergenic
1054394010 9:64637406-64637428 CTGGGACCTCAGAGGCGAGTGGG + Intergenic
1054428659 9:65142618-65142640 CTGGGACCTCAGAGGCGAGTGGG + Intergenic
1054501720 9:65878924-65878946 CTGGGACCTCAGAGGCGAGTGGG - Intronic
1056091414 9:83209073-83209095 CTGGGACCAGAGAGCCCAGTGGG - Intergenic
1056328264 9:85500282-85500304 CTGGGCCCACTCAGCCCTGATGG - Intergenic
1060405462 9:123370850-123370872 CTCGGCGCTCACAGCCCAGGAGG - Exonic
1060664737 9:125426084-125426106 CAGGGCTTTCACTGCCCAGTGGG + Intergenic
1060884989 9:127145108-127145130 CTGGGCCCTGACACTCCAGCTGG + Intronic
1060970928 9:127737410-127737432 CTGGGAGCTCACAGACCAGCGGG - Intergenic
1061180749 9:129023751-129023773 CTGGGCCCTCCCAGCCCTGCAGG - Intronic
1061577220 9:131514550-131514572 CAAGGCCCTCACAGCCCTCTGGG - Intronic
1061806763 9:133141264-133141286 GTGGGGCCACACTGCCCAGTGGG - Intronic
1062094545 9:134696024-134696046 CTGGACCCTGGCAGCCCAGGAGG - Intronic
1062254630 9:135615143-135615165 CTGGGGCCTGAGAGCCCAGAGGG + Intergenic
1062527840 9:136985457-136985479 ATGGGCCCTCCCAGCTCGGTGGG + Exonic
1062581137 9:137229754-137229776 TTGAGGTCTCACAGCCCAGTTGG + Intergenic
1062623173 9:137431644-137431666 CTGGTCACTCGCACCCCAGTGGG - Intronic
1186202537 X:7168827-7168849 GAGGACCCTCACTGCCCAGTTGG - Intergenic
1190733889 X:53242593-53242615 GGGGGCACTCACAGACCAGTCGG - Intronic
1196660515 X:118264266-118264288 CTGGGCCCTCAATAACCAGTAGG + Intergenic
1198318902 X:135498856-135498878 CAAGGACCTCACAGCCTAGTAGG + Intergenic
1200111213 X:153741841-153741863 TTGGGACCTAACAGCTCAGTAGG - Intronic