ID: 944640754

View in Genome Browser
Species Human (GRCh38)
Location 2:201723058-201723080
Sequence AAGGAGAATTTTCAGATGAC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 315
Summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 288}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944640754_944640756 -2 Left 944640754 2:201723058-201723080 CCAGTCATCTGAAAATTCTCCTT 0: 1
1: 0
2: 2
3: 24
4: 288
Right 944640756 2:201723079-201723101 TTCATAGATAGTATCATCTTCGG 0: 1
1: 0
2: 1
3: 10
4: 174

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944640754 Original CRISPR AAGGAGAATTTTCAGATGAC TGG (reversed) Exonic
900686160 1:3948980-3949002 AAGGAAGATTTTCAGAGGGCAGG - Intergenic
900695327 1:4006126-4006148 CAGGAGAAATTGCAGATGGCAGG - Intergenic
904092852 1:27957212-27957234 AAGGACAAATCCCAGATGACAGG + Intronic
905602899 1:39269335-39269357 AAGAACAATTTTCAGAGGGCTGG + Intronic
907967985 1:59352039-59352061 AATAAGAATTGTCAGATGAAAGG + Intronic
908751275 1:67426134-67426156 GAGGCGAATTTTCAGTTGATAGG - Exonic
909821232 1:80064405-80064427 AATCAGAAGTGTCAGATGACAGG + Intergenic
910396589 1:86800135-86800157 AATGAGAATTAACAGATGAAGGG - Intergenic
910525263 1:88170656-88170678 AAGTAAAATTTTCAGACAACTGG + Intergenic
910755833 1:90689433-90689455 AGGGGGAATTTTCAGAAGGCAGG + Intergenic
910988744 1:93032537-93032559 AAGGGAAATGTTCAGATAACAGG + Intergenic
912268345 1:108182950-108182972 AAGGAGAACAATCAGAAGACAGG + Intronic
912653583 1:111464291-111464313 GAGAATAATATTCAGATGACAGG + Intergenic
913003372 1:114603945-114603967 AAGCAGAAATTACAGATCACTGG - Intronic
913018033 1:114758858-114758880 TAGGAGAGTTCTCAGAAGACTGG - Intergenic
914298715 1:146357769-146357791 AAGGAGAGATTCCAGATGTCTGG - Intergenic
914325094 1:146605609-146605631 AAGGAGAAATTTGAGATAAGAGG - Intergenic
914528467 1:148496320-148496342 AAGGAGAGATTCCAGATGTCTGG - Intergenic
915927987 1:160038874-160038896 AAGGGGAGATTTCAGAAGACGGG - Exonic
916796196 1:168169813-168169835 AAAGTGAATTTTCAGCTGTCTGG - Intergenic
917081114 1:171257911-171257933 AAGGAAAATGTTCAGGTCACTGG - Intronic
917418220 1:174834080-174834102 AAGGAGCATTTTTAGAAGCCAGG + Intronic
917666578 1:177230848-177230870 AAAGAGAATTTTGAGTTCACTGG - Intronic
917700972 1:177580700-177580722 AATCTGAATTTGCAGATGACTGG + Intergenic
918707730 1:187689098-187689120 AATAAGAATTTTGAGATGAGGGG - Intergenic
918893568 1:190309552-190309574 AAAAATAATTTTCAAATGACTGG + Intronic
919154648 1:193748302-193748324 CAGGAGTATTTTCAGATAAATGG - Intergenic
921719883 1:218459803-218459825 CACGACACTTTTCAGATGACAGG - Intergenic
921936053 1:220798254-220798276 AAGGAGAATTCTGAGTTGACAGG + Intronic
922638697 1:227204559-227204581 AAGGATAATTTTTACATGAAGGG - Intronic
923580385 1:235205535-235205557 AAGGAAAATTTTCAGAACACTGG + Intronic
924121695 1:240806364-240806386 CACAAGAATTTTCAGATGATGGG - Intronic
924566862 1:245206041-245206063 AAGGAGACTTTTCTGATTGCTGG + Intronic
1062821217 10:535979-536001 AAAGAGTATTTTCAGATGGATGG + Intronic
1063839812 10:10057842-10057864 AAAGAGAACTTGCTGATGACAGG - Intergenic
1063957189 10:11278120-11278142 AAAGAGAAATTTTAGACGACTGG + Intronic
1064201853 10:13291315-13291337 TTGCTGAATTTTCAGATGACTGG - Intronic
1064889294 10:20150916-20150938 ATGGGGAATTTCAAGATGACAGG + Intronic
1066196581 10:33106232-33106254 AAGGAGAGTTGTTAGATCACAGG + Intergenic
1066967916 10:42286692-42286714 AAGGAGAAAATTTGGATGACTGG - Intergenic
1068133512 10:52925558-52925580 AAGGAGTATATTCAAATGAATGG - Intergenic
1068428671 10:56903356-56903378 AAGAAGAATTTTTGGAAGACAGG - Intergenic
1068578997 10:58717751-58717773 AAGTAGAATTTTTAGGTCACAGG + Intronic
1068852112 10:61754701-61754723 AAGGAGAAATTTAAGTTGGCAGG - Intronic
1071738962 10:88335029-88335051 AGGAAGAATTTGAAGATGACTGG - Intronic
1071817212 10:89244891-89244913 AAGTAGAATTTTTGGATCACAGG - Intronic
1073666897 10:105543851-105543873 AAGGAACATTCTCAGATGACAGG + Intergenic
1074665008 10:115712234-115712256 ATGGAAAATTTTCAGAGCACTGG + Intronic
1075805981 10:125189157-125189179 AAGGAGAGTTTTCAGACCAGAGG - Intergenic
1075974602 10:126684680-126684702 AATCAGAATTTCCAGATGAGTGG + Intergenic
1077352307 11:2098667-2098689 AAGGTGAATTTTCAGCTTTCAGG - Intergenic
1077716406 11:4585368-4585390 AAGGAGTATTCTCACATGGCTGG + Intergenic
1077717101 11:4592565-4592587 AAGGAGTCTTCTCAGATGGCAGG + Intergenic
1078866799 11:15305252-15305274 ATGGAGCATTGTCACATGACCGG + Intergenic
1079183134 11:18211461-18211483 AAGGAGAGTTTTAAGAGAACAGG - Intronic
1079556675 11:21767232-21767254 AATGAGAATTTCCAAATGAATGG + Intergenic
1079709401 11:23662708-23662730 AAAGAAAATTTTCACTTGACTGG + Intergenic
1080210361 11:29778934-29778956 AAGGAGAAGTGGCAGATCACAGG + Intergenic
1080226707 11:29969846-29969868 AGGGAACATTTTCAGATGTCTGG - Intergenic
1080580555 11:33639467-33639489 AAGGAGAATTACCAGGTGAGAGG - Intronic
1080913546 11:36630450-36630472 AAGGAGAATTTTAAAAAGAGTGG + Intronic
1081101125 11:39003895-39003917 ATGGAGATTTTACAGATTACTGG + Intergenic
1085586972 11:77717780-77717802 GATGAGAATTTTAATATGACTGG - Intronic
1086174300 11:83871506-83871528 AAGGAGAGTTTTCAAATAATGGG + Intronic
1089280023 11:117367410-117367432 AAAGAAAATTTTCACATGATGGG - Intronic
1089973862 11:122715937-122715959 CTGGAGCATTTTCAAATGACAGG - Intronic
1093444732 12:19243629-19243651 AAGGAGAATTTGTAGATGGTGGG + Intronic
1094500027 12:31012771-31012793 AAGGAGAATATTCTGAAAACGGG - Intergenic
1094555859 12:31498988-31499010 AAAGAGAATTTAGAAATGACTGG + Intronic
1094595024 12:31857358-31857380 AAAAAGAACTTTAAGATGACAGG + Intergenic
1095689620 12:45072048-45072070 AAGTACAATATTCAGATGAGAGG + Intergenic
1097246029 12:57608147-57608169 TAGGAGTATTTTCAGGTGAAGGG + Intronic
1097449725 12:59721687-59721709 AAAGAGCAATTTCAGATGAGGGG - Intronic
1097539956 12:60928801-60928823 AAGTACAATTTTCAGATGCTTGG + Intergenic
1098363245 12:69675912-69675934 AAGTAGAATTTTCAAATGTTTGG - Intronic
1098498465 12:71164238-71164260 AAAGAGAATTCTCAGAGGAATGG - Intronic
1098868014 12:75784274-75784296 AAGGAGAGATTTCTGGTGACTGG - Intergenic
1100537394 12:95523861-95523883 AAGAAAAATGTTGAGATGACAGG - Intronic
1101676079 12:106917827-106917849 AAGCAGAATTTGCAAATTACTGG + Intergenic
1101933691 12:109037803-109037825 AGGCAGAGTTTTCAGCTGACAGG - Intronic
1105264603 13:18804841-18804863 AAGGAGATGTTTCATATGGCAGG + Intergenic
1105906803 13:24820007-24820029 ATGTATAATTTTCAGTTGACAGG + Intronic
1106657767 13:31765259-31765281 ATGGAGAATTCTCTGATGACTGG - Intronic
1108064097 13:46559838-46559860 AACAAGAATTTTTAAATGACAGG - Intronic
1110803074 13:79723243-79723265 AAGGAGAGCTTTCACATGTCAGG + Intergenic
1110832086 13:80043416-80043438 GAGGAGAAGATTGAGATGACTGG - Intergenic
1111110175 13:83697574-83697596 ACAGAGAATTTTCAGATTACAGG - Intergenic
1111618165 13:90688589-90688611 AAAGACCATTTTCAGATAACAGG - Intergenic
1111683915 13:91478082-91478104 AACGACAATTTTCATATGAAAGG - Intronic
1115094096 14:29614042-29614064 ATGGAAAATTTTCAGACCACAGG - Intronic
1117055613 14:51909333-51909355 AAGGTGAATTTTCAAGTGAAAGG + Intronic
1118044653 14:61954018-61954040 AAGGAGAACTTTCAGGTTAATGG + Intergenic
1118380374 14:65213064-65213086 GAGGAGAACTTTCAGGTCACAGG + Intergenic
1118571002 14:67195384-67195406 AAGGAGAATTCTCAGATGCAAGG + Intronic
1119904239 14:78286852-78286874 AAGGATATTTTGCAGATGAGAGG + Intronic
1120752749 14:88213106-88213128 TAGGATAAGTTTTAGATGACTGG - Intronic
1121773378 14:96572828-96572850 AAGTAGAATTTTCACATGTTAGG + Intergenic
1124075501 15:26440217-26440239 AAGGAGGTTTTTCAGGTGAAAGG - Intergenic
1124716557 15:32068321-32068343 AAGTAGAATTTACAGCTAACAGG - Intronic
1125403764 15:39331959-39331981 AAGGAGAGTTTTAGCATGACAGG - Intergenic
1125906648 15:43399023-43399045 AAAGATAATTTTTAGATAACTGG - Intronic
1126982129 15:54255922-54255944 ATGGAGCATTTTCAGGTGATGGG + Intronic
1127014396 15:54667164-54667186 AAGGAGACATTTCACATTACTGG - Intergenic
1127759514 15:62124479-62124501 AAGAAGCATATTCAGCTGACAGG + Intergenic
1131343194 15:91621926-91621948 AAGGAGAATTTTCAGTGACCAGG - Intergenic
1137625350 16:49904258-49904280 AAGCAGAGGTCTCAGATGACAGG - Intergenic
1138059319 16:53873150-53873172 AGGCAGATTTTTCAGATGAAAGG + Intronic
1138766786 16:59614576-59614598 AAGCAGAACTTTGAGATGCCAGG - Intergenic
1138778491 16:59754492-59754514 AAGGAGAACTTTCAAAAGCCAGG - Intronic
1140008470 16:71105337-71105359 AAGGAGAAATTTGAGATAAGAGG + Intronic
1140271088 16:73466842-73466864 AAGGAGGATGTTCAGGAGACTGG + Intergenic
1140910814 16:79450429-79450451 AAGGAGTATTTTCAGCTTAATGG - Intergenic
1141246346 16:82311397-82311419 AAACAGAATTTCCAGATGAAAGG - Intergenic
1142178590 16:88656400-88656422 AATGGGGATTTCCAGATGACAGG + Intronic
1144313790 17:14039382-14039404 CAGGAGAAGTCTCTGATGACTGG - Intergenic
1146618214 17:34373639-34373661 AGGCAGGATTTTCAGATGCCTGG - Intergenic
1147165635 17:38591737-38591759 AAGGAGCAGTTTCAGCTGACTGG - Intronic
1147488904 17:40845394-40845416 GAGGAGAATTTTGAGAAGATGGG + Intergenic
1148676148 17:49446124-49446146 GAGGAGAATTTTGAGATTGCTGG - Intronic
1150585517 17:66514362-66514384 AAGGAGAGTTCTCAGATGGGTGG - Intronic
1151054187 17:71012803-71012825 AAGGAGAAGCTTCAGTTGATAGG + Intergenic
1151129452 17:71881434-71881456 AAGGAAATTTTTCAGAGGAAAGG + Intergenic
1152185537 17:78854446-78854468 AAGGTGAATTCTCAGATGATAGG - Exonic
1153445249 18:5164862-5164884 AAGGAAAATTGTCACATCACTGG + Intronic
1154423788 18:14256719-14256741 AAGGAGATGTTTCATATGGCAGG - Intergenic
1155936357 18:31758811-31758833 AAGGAGAGTTTTAAGAGAACAGG + Intergenic
1157647544 18:49291641-49291663 AGGAAGGATTTTAAGATGACTGG + Intronic
1158160691 18:54479964-54479986 AATGAGAATTTTCAGACCACAGG + Intergenic
1158273374 18:55740695-55740717 TAAAAGAATTTACAGATGACAGG - Intergenic
1158413806 18:57231838-57231860 AAATAGATTTTTCAGCTGACTGG + Intergenic
1159082364 18:63749849-63749871 AAGGAGATTTTTTTGATGACTGG + Intergenic
1159441887 18:68491379-68491401 AAGCAGAGTATTCAGATGAAAGG + Intergenic
1159765910 18:72488029-72488051 ATGGATAACTTTCAGATGAATGG + Intergenic
1159840714 18:73395372-73395394 AAAGATAATTGTTAGATGACAGG + Intergenic
1159986912 18:74853574-74853596 AAGGTGAATGTTAAGATCACAGG - Intronic
1166627170 19:44368741-44368763 ATGGACATTTTTGAGATGACTGG - Intronic
1167734086 19:51281028-51281050 AAGGACAAATTTTACATGACTGG + Intergenic
1168193503 19:54756795-54756817 GAGGAGAATCTTCAGAGCACAGG + Intronic
1168195566 19:54771533-54771555 GAGGAGAATCTTCAGAGCACAGG + Intronic
925748690 2:7067749-7067771 TAGGAGAAGCTTCAGGTGACTGG - Intronic
925864521 2:8214920-8214942 TGGGAGTATTTTCAGATGATGGG - Intergenic
926356164 2:12042608-12042630 AAGGAGAATTTCCAGGAGCCTGG - Intergenic
926592441 2:14753841-14753863 AAGAATAAATATCAGATGACTGG - Intergenic
927214434 2:20659568-20659590 AAGGAGGATTGACAGATCACGGG - Intergenic
929018210 2:37523435-37523457 AAGGAAAATACTCAGATGCCAGG - Intergenic
929332155 2:40695123-40695145 AACTATAATTATCAGATGACAGG + Intergenic
929987202 2:46746328-46746350 AAGGAGAAGATTCAAATGGCAGG - Intronic
930260759 2:49143467-49143489 AAGAAGAATTTTCAGCTCAGTGG + Intronic
932325017 2:70853419-70853441 AAGGAGTCTTTTAAGATGTCTGG - Intergenic
932876944 2:75462284-75462306 CTGGAGGATTTTCAGAAGACTGG + Intergenic
934494289 2:94783995-94784017 AAGGAGATGTTTCATATGGCTGG + Intergenic
934592300 2:95566242-95566264 AAAGAGAATTATAAGATAACTGG + Intergenic
935499219 2:103818090-103818112 AAGTAGAATTTTCAGGGGTCAGG + Intergenic
935817849 2:106864005-106864027 AAGGAAAGTTTTGACATGACAGG - Intronic
937343090 2:121104481-121104503 AAGGGGAATGATCAGATGCCAGG - Intergenic
937637377 2:124171200-124171222 AAAGAGCATTTGCAGAGGACAGG - Intronic
937742326 2:125370193-125370215 AATGAGAATTTTGAGATGACAGG - Intergenic
938339992 2:130529461-130529483 AAGGAGAATTTGAAGATAAAAGG + Intergenic
938349843 2:130591287-130591309 AAGGAGAATTTGAAGATAAAAGG - Intergenic
938992430 2:136643322-136643344 AAGGAGAATATTCTGATCATGGG - Intergenic
939182909 2:138824718-138824740 AAGGAGAATTATAAAATGACTGG + Intergenic
939245211 2:139614471-139614493 AAGAAGAATTTTCAGAGGATAGG - Intergenic
940191095 2:151040843-151040865 GAAGAGACTTTTCAGAAGACAGG - Intronic
941081173 2:161062278-161062300 GATGAGAATATTCAGATAACAGG - Intergenic
942072615 2:172329344-172329366 CAGGAGACTTTTCAGTTGGCGGG + Intergenic
943222553 2:185128769-185128791 ACAGAGAATTTTCCCATGACGGG + Intergenic
943404933 2:187470317-187470339 AGAGAAAATTTTCTGATGACAGG + Intronic
944640754 2:201723058-201723080 AAGGAGAATTTTCAGATGACTGG - Exonic
947855318 2:233320035-233320057 AAGTAGAATTTTCAGAAGTGGGG + Intronic
948054581 2:235001588-235001610 AAAGATAATTTTCAGAAGCCAGG - Intronic
1169157186 20:3341552-3341574 AAGGAGGCCTTTCAGATGGCTGG - Intronic
1169261607 20:4142975-4142997 AAGGAGAATTTGCAGTTCCCAGG + Intronic
1170244992 20:14210845-14210867 AAAGATATTTTTCAGATGATTGG + Intronic
1170772746 20:19348283-19348305 ACTGAGAATTCTCAGATGATTGG + Intronic
1171315633 20:24191178-24191200 AAGCAGAGTTTCCATATGACTGG - Intergenic
1172322904 20:34010734-34010756 AAGTAGAATTTTTAGCTGAAAGG + Intronic
1175016774 20:55800119-55800141 AAATAGACTTTTCAGGTGACTGG - Intergenic
1176849680 21:13903289-13903311 AAGGAGATGTTTCATATGGCAGG + Intergenic
1177232384 21:18339411-18339433 AAGCAGACTTTTCAGATGAGTGG - Intronic
1180752009 22:18131030-18131052 AAGGAGAATTTTCTGAGGCCAGG + Exonic
1182276544 22:29192849-29192871 AAGGAGGATTTTCAGCTCCCTGG + Intergenic
1184293733 22:43511183-43511205 ACCGAGAATTTCCAGATGCCAGG - Intergenic
949145025 3:689830-689852 ACAGAGAATTTTAAAATGACAGG - Intergenic
949887861 3:8710648-8710670 AGTGAGAATTTTCAGAAGCCTGG - Intronic
950600693 3:14032821-14032843 TAGGAGAATTTGCTGAGGACTGG - Intronic
951463995 3:22981753-22981775 AATGAGAACTTTGTGATGACAGG - Intergenic
951466534 3:23006030-23006052 AAGGAGACTTTTCTGGTGAAAGG - Intergenic
951697898 3:25465077-25465099 AAGTGGAATTTTTAGATCACTGG + Intronic
952004092 3:28822361-28822383 AAGGATAATTTTCAAGTGTCTGG + Intergenic
956609510 3:71108066-71108088 AAGGAAAACTATCAGATGACTGG + Intronic
956754120 3:72368524-72368546 AAGCAAAATCTTCAGATGTCTGG + Intergenic
956920778 3:73926938-73926960 CAGGGGAAGTTTCAGATGTCAGG + Intergenic
957412086 3:79855674-79855696 ACTCAGAATTTTCAGATGTCTGG - Intergenic
958511298 3:95052534-95052556 AACTAGAATTCTTAGATGACAGG - Intergenic
961376749 3:126472166-126472188 CAGGTGAATTTTCAGCCGACAGG + Exonic
963817725 3:149851281-149851303 AAGGAGACTTGACAGATGAAAGG + Intronic
965069535 3:163900847-163900869 TAAGAAAATTTTCATATGACTGG + Intergenic
965074545 3:163959764-163959786 CAGCAGAATACTCAGATGACAGG - Intergenic
965668714 3:171123753-171123775 AAGGAGGATTTTCTGACAACAGG - Intronic
966473711 3:180320915-180320937 CAGCTGGATTTTCAGATGACAGG + Intergenic
971764470 4:30811833-30811855 AAGGAGAAGATTCAGATCACTGG + Intronic
973219465 4:47708879-47708901 AATGAGAATGTTCAAAAGACTGG + Intronic
974447376 4:62002750-62002772 AATGAGAATATTCAAATGATTGG - Intronic
974770625 4:66406869-66406891 AAGAAGAAATTTAAGATTACAGG + Intergenic
974953198 4:68606127-68606149 AAGGAGAATTTCCACTTGAGTGG + Intronic
975183898 4:71378910-71378932 AAGAAGAAGTCTAAGATGACAGG - Intronic
981160001 4:141486600-141486622 ATTGAGATTTTTCAGATGAGTGG + Intergenic
981819998 4:148875415-148875437 AAGTATATTTTTCAAATGACAGG + Intergenic
982112875 4:152072428-152072450 AGGGAGGATTTTCTGCTGACAGG - Intergenic
982474963 4:155839216-155839238 AATGAAAATTCTCATATGACAGG - Intronic
984027220 4:174557582-174557604 AAGGAAAAATATCAGATGGCTGG - Intergenic
984509733 4:180664629-180664651 AAGCAGACTTTTCAAAAGACAGG + Intergenic
986893870 5:12341722-12341744 AAGGAAAATGTCCAGATTACTGG - Intergenic
988728563 5:33947443-33947465 AAGGTGAATCTTCAGAAGAAAGG - Intronic
989162366 5:38403911-38403933 AGGTTGAATTTTCAGTTGACAGG + Intronic
990194000 5:53292513-53292535 AAAGAGATTTTTCAGGTGAATGG + Intergenic
991246863 5:64517795-64517817 AAGTATAATTTTCACAAGACAGG + Intronic
993031562 5:82712558-82712580 TAGGAGAAATTCCAGATGTCTGG + Intergenic
993137392 5:83986862-83986884 AAGGAGAATTTCCATGTGGCTGG + Intronic
995954232 5:117755485-117755507 AAAGAGAATTTTAATATGAAAGG + Intergenic
995991642 5:118247105-118247127 AAAGAGTATTTACAGATGGCTGG + Intergenic
996278381 5:121696677-121696699 AAAGAGTATTTTCAAATGCCTGG + Intergenic
998300824 5:141017912-141017934 AAGGAGAATTCTCAGAAAAAAGG + Intergenic
999374154 5:151075211-151075233 AAGGAGAAATTTCAACTGATTGG + Intronic
999888513 5:155950868-155950890 AAGGAGGATTTTTAGGTGAGAGG - Intronic
999890096 5:155968389-155968411 AAAGAGAAACTTCAGATAACGGG - Intronic
1001010506 5:168093463-168093485 ATGGAGAATGTTCTGATGATAGG - Intronic
1001214338 5:169841366-169841388 AAGAAAAATAATCAGATGACGGG - Intronic
1001717095 5:173825236-173825258 AAGCAGAATTTTCAGAAGCATGG - Intergenic
1002498183 5:179630058-179630080 AAAGAAAATATGCAGATGACCGG + Intronic
1002864614 6:1110022-1110044 AAGGAGAAGTTACAGATGGAAGG + Intergenic
1003015760 6:2466271-2466293 AAGTAGAATTTCCAGGTGAAAGG + Intergenic
1003277885 6:4667791-4667813 AAAGTGAACTTTCAGCTGACAGG + Intergenic
1004073494 6:12324102-12324124 AAGGTGAATATTCAGAGCACAGG + Intergenic
1004114341 6:12751031-12751053 AAAGAGAACCTTCAGATGATGGG + Intronic
1005073396 6:21883561-21883583 AAGGAGAATGATCAGAAGGCAGG - Intergenic
1006256318 6:32835451-32835473 AAGGAGGATGTTCAGAGGAGGGG - Intronic
1006878285 6:37317192-37317214 GAGGAGGATTTTCAGGTGAGTGG + Exonic
1007585237 6:42985067-42985089 AAGGTGCAGTTTCAGATGAGGGG - Intronic
1007951763 6:45878829-45878851 AAAGAGAAATGTCAGATGAATGG - Intergenic
1008022717 6:46599384-46599406 AAAGAGCATGTTCAGATAACAGG + Intronic
1008154021 6:47990767-47990789 AAAAAGTATCTTCAGATGACAGG + Intronic
1008617451 6:53240253-53240275 AAAGAGAATGATCAGCTGACAGG + Intergenic
1010403187 6:75471541-75471563 CAGTAGAATTTTGAGGTGACAGG - Intronic
1012602838 6:101119223-101119245 AAGGAACATTTTTAAATGACCGG - Intergenic
1014496344 6:122128228-122128250 AAGGAGAATTTTCAGGGCACTGG - Intergenic
1016477940 6:144448923-144448945 AAGTAGAATATTCAGAAGACAGG - Intronic
1016626121 6:146171785-146171807 AAGAAGAATGTTCTAATGACTGG + Intronic
1018038794 6:159903920-159903942 TAGGAGTATTTTCAGTAGACTGG - Intergenic
1018280859 6:162183941-162183963 TAAGAGAATTTTCTGTTGACAGG + Intronic
1018645143 6:165941410-165941432 AAGGAGTGTTTTCAAATGACTGG - Intronic
1018693679 6:166371947-166371969 AAGGAGAAACTGCAGATGAGGGG + Intronic
1020176428 7:5885946-5885968 AAAGAAAATTGTCAGATGATGGG - Intronic
1023036040 7:36132141-36132163 GAGGTGAAATTTGAGATGACAGG + Intergenic
1024491745 7:49993915-49993937 AAGGAGAATTTTAATAAGGCAGG - Intronic
1025782964 7:64618023-64618045 AAGGAGCATTTTGACATCACTGG + Intergenic
1026686809 7:72517621-72517643 AATGAGAAATTTCAGATGTCTGG - Intergenic
1027189104 7:75987679-75987701 AAGGGGAATGTCCAGATGCCAGG + Intronic
1027939476 7:84656058-84656080 AAGGAGAATTTTGACAGGAATGG + Intergenic
1029082398 7:97985079-97985101 AAAGAAAATTGTCAGATGATGGG + Intronic
1031016915 7:116585374-116585396 AAGGTGAAGGTTCAGAAGACAGG - Intergenic
1031796756 7:126185111-126185133 AAGGAAAATTATCAGATTAATGG - Intergenic
1033947520 7:146740073-146740095 AAGGCAAATTTTCATATCACAGG - Intronic
1035415780 7:158684447-158684469 AAGGAGACATTTGAGATCACTGG + Intronic
1036076066 8:5501818-5501840 AAGGACACTTTTGAGATGAGGGG - Intergenic
1036523403 8:9513279-9513301 AAGGTGGATTTGCAGATGAACGG - Intergenic
1037197038 8:16203382-16203404 AAGGAGAATTGTTAGAAAACTGG + Intronic
1037438207 8:18886984-18887006 AAGGAGATAATTGAGATGACGGG + Intronic
1037449413 8:19001750-19001772 AAGGAAGGTATTCAGATGACAGG + Intronic
1037632675 8:20672409-20672431 GAGGAGGATTTTAAGGTGACAGG - Intergenic
1037646682 8:20798895-20798917 AAGAAGAATTTTGAGTTGAGAGG + Intergenic
1037836268 8:22216480-22216502 AAGGGGAAGCTTCAGATGCCAGG - Intergenic
1038043161 8:23743870-23743892 AAAGAGAATAATCAGTTGACCGG + Intergenic
1041793447 8:61721957-61721979 AAGGAGGATTTTCTGTTGATTGG - Intergenic
1044469240 8:92547044-92547066 AAGGATAATTTGCAGATGACTGG - Intergenic
1045937273 8:107695309-107695331 AAAGAGACATCTCAGATGACAGG - Intergenic
1046063641 8:109171301-109171323 AAGGAAATTTTGGAGATGACAGG + Intergenic
1047013777 8:120700913-120700935 AAAAAGAATTTCCAGATTACAGG + Intronic
1047888062 8:129274845-129274867 AAGGAGAATTGGCAGTTGATTGG + Intergenic
1048108598 8:131441242-131441264 AAAGACAATTTTCAGAAGGCTGG + Intergenic
1048856247 8:138688994-138689016 ATGGTGAATTTAAAGATGACTGG + Intronic
1050227803 9:3480545-3480567 CAGGCCAATGTTCAGATGACTGG + Intronic
1050449545 9:5765718-5765740 CAGGAACATTTTCAGCTGACTGG - Exonic
1052732641 9:32307556-32307578 AAGAAGAATTTACTGATCACAGG - Intergenic
1053406836 9:37884625-37884647 AAGGAGAGTTTTAAGAGAACAGG + Intronic
1053662833 9:40296371-40296393 AAGGAGATGTTTCATATGGCTGG - Intronic
1053664220 9:40306207-40306229 AAGGAGACATTTCAAATGGCAGG - Intronic
1053695884 9:40638989-40639011 AAGGAGAAATTTCAGATGTGCGG - Intergenic
1053913281 9:42926546-42926568 AAGGAGATGTTTCACATGGCAGG - Intergenic
1054307131 9:63438207-63438229 AAGGAGAAATTTCAGATGTGCGG - Intergenic
1054374962 9:64442595-64442617 AAGGAGATGTTTCATATGGCTGG - Intergenic
1054520396 9:66070078-66070100 AAGGAGACATTTCAAATGGCAGG + Intergenic
1054521781 9:66079913-66079935 AAGGAGATGTTTCATATGGCTGG + Intergenic
1056926409 9:90838549-90838571 AAGGAGGGTTTTCAGGTGTCTGG - Intronic
1057250990 9:93501680-93501702 GTGTAGAATTTTAAGATGACGGG + Intronic
1057851477 9:98570115-98570137 AAGGAGGACTTTCAGATGGGAGG - Intronic
1058326253 9:103701724-103701746 AAGGACAATTTTCAGATGTGTGG + Intergenic
1058846967 9:108970409-108970431 GAGGAGACATTTCAGGTGACTGG - Exonic
1059994318 9:119893932-119893954 AAGGAGGATAATCAGAGGACAGG + Intergenic
1061350192 9:130058159-130058181 AAGGAGTATTTCCTGCTGACAGG - Intronic
1061360479 9:130138694-130138716 AAGGAGAATTTTCTCAAGAGTGG + Exonic
1061757540 9:132825901-132825923 AAGGGTAATTTTGAGACGACTGG + Intronic
1185830234 X:3294618-3294640 AAAAATGATTTTCAGATGACTGG - Intergenic
1188404300 X:29787510-29787532 AAGGACACTTTTCAGGGGACTGG - Intronic
1188602227 X:31981704-31981726 AAGGAGAATGTTCATCAGACTGG + Intronic
1188857730 X:35218276-35218298 AAGGGAAATTTTGAGATGATGGG + Intergenic
1189126294 X:38450704-38450726 AAGGAAAAATTTAAGATTACTGG + Intronic
1190707749 X:53044727-53044749 AAGAAGAAGATACAGATGACTGG + Intergenic
1192267039 X:69546033-69546055 AGAGAGAATTTTTAGAAGACGGG + Intergenic
1192616860 X:72634004-72634026 ATGGATAGTATTCAGATGACAGG - Intronic
1196046341 X:111260181-111260203 AAGGAGCCTCTTCAGATGACAGG - Intronic
1196201408 X:112889982-112890004 AAGGAAAATTTTCTGATAAGAGG - Intergenic
1198328389 X:135596800-135596822 AAGGTGAATTTGGAGCTGACAGG + Intergenic
1199045602 X:143167667-143167689 AAGGAGAAAGTTTAGATGAGAGG + Intergenic
1199857464 X:151772040-151772062 AAGAAGCATTTCCAGGTGACTGG + Intergenic