ID: 944644135

View in Genome Browser
Species Human (GRCh38)
Location 2:201761521-201761543
Sequence AGGATTTTACAGTTGGCGTG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 110
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 101}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944644135_944644137 -8 Left 944644135 2:201761521-201761543 CCACACGCCAACTGTAAAATCCT 0: 1
1: 0
2: 0
3: 8
4: 101
Right 944644137 2:201761536-201761558 AAAATCCTGACTGCTAACAAAGG 0: 1
1: 0
2: 1
3: 20
4: 224
944644135_944644142 22 Left 944644135 2:201761521-201761543 CCACACGCCAACTGTAAAATCCT 0: 1
1: 0
2: 0
3: 8
4: 101
Right 944644142 2:201761566-201761588 TCAGAATCAGCAATGCTGACAGG 0: 1
1: 0
2: 0
3: 14
4: 165
944644135_944644143 28 Left 944644135 2:201761521-201761543 CCACACGCCAACTGTAAAATCCT 0: 1
1: 0
2: 0
3: 8
4: 101
Right 944644143 2:201761572-201761594 TCAGCAATGCTGACAGGATTTGG 0: 1
1: 0
2: 2
3: 15
4: 177
944644135_944644140 -3 Left 944644135 2:201761521-201761543 CCACACGCCAACTGTAAAATCCT 0: 1
1: 0
2: 0
3: 8
4: 101
Right 944644140 2:201761541-201761563 CCTGACTGCTAACAAAGGGCTGG 0: 1
1: 0
2: 0
3: 7
4: 106
944644135_944644138 -7 Left 944644135 2:201761521-201761543 CCACACGCCAACTGTAAAATCCT 0: 1
1: 0
2: 0
3: 8
4: 101
Right 944644138 2:201761537-201761559 AAATCCTGACTGCTAACAAAGGG 0: 1
1: 0
2: 1
3: 17
4: 168

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944644135 Original CRISPR AGGATTTTACAGTTGGCGTG TGG (reversed) Exonic
902414647 1:16231628-16231650 AGGAGGTGACAGTGGGCGTGGGG - Intergenic
903291701 1:22318351-22318373 AGACTTTTGCTGTTGGCGTGGGG + Intergenic
904510815 1:31005837-31005859 AGGATTTGTAAGTTGGCTTGAGG - Exonic
906817680 1:48895786-48895808 TTAATTTTACAGTTGGGGTGTGG + Intronic
908726884 1:67185952-67185974 CCCATTTTACAGATGGCGTGGGG + Intronic
910997649 1:93125686-93125708 AAGATTTCACAGTTGGGGTGGGG + Intronic
911925266 1:103821916-103821938 ATGATTTTACTGTAGGTGTGTGG - Intergenic
913698951 1:121355758-121355780 ATGATTTTTCAGTAGGAGTGGGG + Intronic
914138594 1:144924287-144924309 ATGATTTTTCAGTAGGAGTGGGG - Intronic
916792079 1:168134239-168134261 AGGAATTTGCAGTTGGCCAGGGG - Intronic
918132958 1:181645216-181645238 ATGATGTTACATTTGGGGTGGGG + Intronic
920486363 1:206374465-206374487 ATGATTTTTCAGTAGGAGTGGGG + Intronic
921512162 1:216045499-216045521 AGGATTTTAAAGTATTCGTGTGG + Intronic
923059354 1:230456153-230456175 AGGACTTTACAGGTAGCATGAGG - Intergenic
1065659146 10:27987702-27987724 AGGATTTAAGAGTTTGAGTGTGG - Intronic
1069202508 10:65638893-65638915 AGGATTTAAAAGGTGGCATGAGG + Intergenic
1079068640 11:17322389-17322411 ATGAGTTTACAGTAGGTGTGTGG + Intronic
1079266095 11:18934492-18934514 AGGATTTTAGAGATGGTATGGGG + Exonic
1083264009 11:61537788-61537810 AGGGATTTCCAGTTGGGGTGGGG + Intronic
1089109377 11:116043201-116043223 AGGATTATAAATTTGGTGTGAGG - Intergenic
1089307504 11:117535883-117535905 AGGATTTTAAACTAGGGGTGGGG + Intronic
1093701223 12:22223752-22223774 GGGATTTTACAGCTGTCGAGAGG - Intronic
1095941585 12:47730836-47730858 AGGATTGTACAGCTGGTGGGTGG - Intergenic
1096975495 12:55697335-55697357 AGGATGTGACAGATGGGGTGGGG - Intronic
1097445397 12:59666044-59666066 ATGATTTTACAATTGGAGTTTGG + Intronic
1099260001 12:80366872-80366894 AGAATTTTACAGTGGGCATTAGG + Intronic
1100311833 12:93402884-93402906 AGGATTCTACAGTTGGTCTTTGG - Exonic
1101047675 12:100827018-100827040 AGGCTTTAAAAGTTGGCCTGGGG - Intronic
1112821767 13:103345988-103346010 AGGAGTTTACAGTGGGAATGTGG + Intergenic
1124569123 15:30844102-30844124 AGGAGTTTACTCTTGGGGTGAGG + Intergenic
1127705614 15:61544704-61544726 AGGATTTTACAGTTCCCTTCAGG - Intergenic
1135984544 16:27174436-27174458 AGGATTTTAGGGTTGGACTGAGG - Intergenic
1139957862 16:70701640-70701662 AGGATTGTCCAGTTGGTGTGTGG - Intronic
1140734931 16:77890113-77890135 TGGATTTTACAGATGAGGTGGGG + Intronic
1141406752 16:83801255-83801277 AGGATGTTACACTTGGAGTGAGG + Intergenic
1147368889 17:39977895-39977917 AGCATTTTCCAGTTTGCCTGAGG - Intergenic
1149891948 17:60397871-60397893 AGAGTTTTACAGTGGGAGTGAGG + Intronic
1159385694 18:67722851-67722873 AGTATTTCACAGTTCTCGTGAGG + Intergenic
1159590843 18:70333487-70333509 AGGATTTTAGAGTTTCCCTGTGG + Intergenic
1160938095 19:1606889-1606911 AGAACTTTCCAGTTGGCTTGGGG + Intergenic
1162275726 19:9652894-9652916 AGGAGTTCACAGGTGGGGTGAGG + Exonic
1163472454 19:17505463-17505485 GAGATTTTCCAGTTGGCCTGGGG - Exonic
1168266323 19:55225584-55225606 AGGAATCCACAGTTGGAGTGAGG - Intergenic
927282423 2:21320941-21320963 AGAATTTTACAGAGGGTGTGAGG - Intergenic
933910628 2:86938027-86938049 AGGATTTTATATTTGGGTTGAGG + Intronic
934022100 2:87965375-87965397 AGGATTTTATATTTGGGTTGAGG - Intergenic
935659769 2:105456124-105456146 GGGATTTTACAGTTGGTTTTGGG + Intergenic
936414586 2:112293254-112293276 AGGATTTTATATTTGGGTTGAGG + Intronic
936553105 2:113467760-113467782 AGGTTTTTACAGATGGAGTAGGG + Intronic
936954201 2:118008262-118008284 AGGAATTTACAGTTTGGGTGGGG - Intronic
937718164 2:125059204-125059226 AGGCTGTAACAGTTGGCATGTGG - Intergenic
938016620 2:127872658-127872680 AGGATTTTTCAGTAGGCTTTGGG - Intronic
941110604 2:161416050-161416072 ATGATTTTATTGTTGGCTTGGGG - Intergenic
941725374 2:168854442-168854464 AGGATGGTAGAGTTGGAGTGAGG - Intronic
941867415 2:170349345-170349367 AGGAATTTACAGTTTGAGTGGGG - Intronic
943942633 2:194019863-194019885 AACATTGTACAGTTGGCCTGTGG - Intergenic
944644135 2:201761521-201761543 AGGATTTTACAGTTGGCGTGTGG - Exonic
948751418 2:240135619-240135641 AGGATTATACAGTCGTCTTGGGG - Intronic
1173562055 20:44013083-44013105 AGGATTTAAAACTTGGAGTGGGG + Intronic
1175304026 20:57963787-57963809 AGGATTTTACATATGGCTTAGGG - Intergenic
1178514720 21:33236805-33236827 AGGATCCTACACTTGGCTTGAGG - Intronic
1181090167 22:20467073-20467095 AGGATTTTAGAGTTTCAGTGGGG + Intronic
1182074409 22:27485217-27485239 AGGATTATACAGTGGGTCTGTGG + Intergenic
1184332075 22:43833550-43833572 AGCCCTTTACAGTGGGCGTGTGG - Intronic
1184405999 22:44301163-44301185 AGGAGGTGACAGTTGGCTTGTGG - Intronic
952685616 3:36144627-36144649 AGGAATTCACAGTTGGAGTATGG - Intergenic
955187098 3:56724840-56724862 AGCAGTTTTCAGTTGACGTGAGG - Intergenic
957573838 3:81984391-81984413 AGGATTTGACAAGTGGAGTGTGG - Intergenic
962330944 3:134477343-134477365 AGGATTTTACAGCTTACTTGTGG - Intergenic
963382023 3:144542507-144542529 AGGATCTTACAGTTGAAATGGGG + Intergenic
966955643 3:184875625-184875647 AGGATATTAGAGACGGCGTGAGG - Intronic
971178926 4:24309343-24309365 AGGATTTTACACTTGGGATTTGG - Intergenic
975272640 4:72454412-72454434 AGCAGTTTACACTTGGTGTGGGG - Intronic
975281488 4:72568124-72568146 AGGATTTGACAGTTGGGGAGGGG - Intronic
975407247 4:74003746-74003768 AGGAGTTTATAGTTGACTTGAGG - Intergenic
978957854 4:114636779-114636801 AGGATGCTACAGTTGGTTTGTGG - Intronic
979690140 4:123550837-123550859 GGGATTTGCCAGCTGGCGTGAGG + Intergenic
980787672 4:137575570-137575592 AGAATCTTATAGTTGGCATGGGG - Intergenic
986530327 5:8730382-8730404 AGGAATTTACACTTGGTTTGTGG - Intergenic
986688177 5:10291940-10291962 AGGAATTTACAGTGGGAATGGGG + Intronic
990991034 5:61684302-61684324 AGGATTTTACAGTGGTATTGGGG - Intronic
994222809 5:97215922-97215944 AGGAGTTTATAGTTGGCATGGGG - Intergenic
1006931207 6:37689595-37689617 GGGCTTTTACAGCTGGTGTGGGG + Intronic
1007180289 6:39924719-39924741 AGGATTTTATAATTTTCGTGTGG + Intronic
1013019232 6:106195682-106195704 AGCATTTGACAGTTTGCATGGGG + Intronic
1013427507 6:110027022-110027044 AGGGTATTCCAGTTGGCCTGAGG - Intergenic
1022385867 7:29898538-29898560 AGGAATTTCCAGTTGACTTGGGG - Intronic
1031228878 7:119078678-119078700 GAGATTTTACAGTTGACTTGTGG - Intergenic
1033830317 7:145243427-145243449 AGGATCTTATAGTTGGCTTTGGG + Intergenic
1037893837 8:22638692-22638714 TGGATTTTACAGTTGAAATGAGG - Intronic
1039357813 8:36840713-36840735 AGAAGTTTACAGTTGGGATGGGG + Intronic
1040491446 8:47926626-47926648 AGGACTTCAGAGTTGGGGTGGGG - Intronic
1045315148 8:101037490-101037512 GAGATCTTACAGTTGGTGTGGGG + Intergenic
1048607435 8:135984363-135984385 AGGAAATTAAAGTTGGGGTGAGG - Intergenic
1049899895 9:149428-149450 AGGCTTTTACAGATGGAGTAGGG - Intronic
1049987011 9:961008-961030 AGGATTCTACACAAGGCGTGGGG - Intronic
1053742944 9:41159719-41159741 AGGTTTTTACAGATGGAGTAGGG - Intronic
1054348221 9:63989543-63989565 AGGTTTTTACAGATGGAGTAGGG - Intergenic
1054445947 9:65315902-65315924 AGGTTTTTACAGATGGAGTAGGG - Intergenic
1054484323 9:65705608-65705630 AGGTTTTTACAGATGGAGTAGGG + Intronic
1054685399 9:68271581-68271603 AGGTTTTTACAGATGGAGTAGGG + Intronic
1059576657 9:115496549-115496571 ATGGTTTTACAGTTGGTGTTGGG - Intergenic
1060598287 9:124861332-124861354 AGGATTTCAAAGTTGGCTTAAGG - Intronic
1062651066 9:137578022-137578044 AAGATTTTAAAGTTGGCCGGGGG + Intronic
1187999994 X:24971880-24971902 AGGATTTTAAAGATGGAGGGGGG + Intronic
1188437871 X:30183295-30183317 AGGATTTAACATTTGGCCTAAGG - Intergenic
1193940816 X:87679254-87679276 AGGATTTTGCAGATAGCCTGGGG - Intergenic
1194431079 X:93806537-93806559 AGGGTTTGACAGTTGGTGTGTGG - Intergenic
1196840587 X:119855457-119855479 AGGCTAATACAGTTGGTGTGGGG - Intergenic
1198234575 X:134725098-134725120 AGGATTATAAAGTTGTTGTGAGG + Intronic