ID: 944645342

View in Genome Browser
Species Human (GRCh38)
Location 2:201774270-201774292
Sequence ATGCCATCCAGAATATATGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 160
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 148}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944645340_944645342 -4 Left 944645340 2:201774251-201774273 CCAGACAAAGTGAAGGAGGATGC 0: 1
1: 0
2: 1
3: 13
4: 144
Right 944645342 2:201774270-201774292 ATGCCATCCAGAATATATGTGGG 0: 1
1: 0
2: 0
3: 11
4: 148
944645339_944645342 -3 Left 944645339 2:201774250-201774272 CCCAGACAAAGTGAAGGAGGATG 0: 1
1: 0
2: 0
3: 23
4: 234
Right 944645342 2:201774270-201774292 ATGCCATCCAGAATATATGTGGG 0: 1
1: 0
2: 0
3: 11
4: 148
944645336_944645342 4 Left 944645336 2:201774243-201774265 CCAAAGTCCCAGACAAAGTGAAG 0: 1
1: 0
2: 0
3: 18
4: 233
Right 944645342 2:201774270-201774292 ATGCCATCCAGAATATATGTGGG 0: 1
1: 0
2: 0
3: 11
4: 148

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944645342 Original CRISPR ATGCCATCCAGAATATATGT GGG Intronic
912366994 1:109141978-109142000 TTGACATCCAGAATACATGCTGG + Intronic
912571004 1:110620899-110620921 ACGCCAGCCAGAAGCTATGTTGG - Intronic
914326371 1:146620941-146620963 AGGGCATCCAGAATATATGATGG - Intergenic
919415366 1:197301585-197301607 GTGCCATTCAGAACATTTGTAGG + Intronic
920884095 1:209909594-209909616 ATGACATCCAGAATAACTGTAGG - Intergenic
923959949 1:239068882-239068904 ATGCCAATCAGAATATTTCTAGG + Intergenic
1063045706 10:2390422-2390444 ATACCCTTCAGAATCTATGTGGG + Intergenic
1063230533 10:4061969-4061991 ATGACTTCAAGAAAATATGTTGG + Intergenic
1067690137 10:48496670-48496692 GTGCCTGCCAGAATATCTGTAGG + Intronic
1068819625 10:61359391-61359413 ATGCCAGCAAGAATAGAAGTAGG - Intergenic
1070851459 10:79565588-79565610 AAGGCATCAAGAACATATGTTGG - Intergenic
1070925251 10:80216648-80216670 ATGAGATCCAGAATATTTGCAGG - Intergenic
1073967916 10:109012833-109012855 AAACAATCCAGAATATATGAAGG - Intergenic
1074091879 10:110267862-110267884 AGACAATACAGAATATATGTTGG + Intronic
1074259406 10:111836645-111836667 ATTCCATCCACACTATATTTTGG - Intergenic
1079915143 11:26360320-26360342 ATGCTACCCAGAATGTCTGTGGG + Intronic
1080058895 11:27936100-27936122 ATGCCATGCATAATTTTTGTTGG + Intergenic
1082031064 11:47603910-47603932 ATGCCATCCAGACTTTATTCTGG + Intergenic
1085214138 11:74813014-74813036 ATGCCATCCAGCTTACCTGTTGG + Intronic
1085671498 11:78468717-78468739 ATGTCATTCAGAATATATTTTGG + Intronic
1088101216 11:106158364-106158386 ACTCCATCCAGAATATCTCTGGG - Intergenic
1093220014 12:16409331-16409353 ATTCCTTTCAGAATATATATAGG - Intronic
1097570219 12:61322933-61322955 ATGTCAACCAGAATAAAGGTGGG - Intergenic
1097634234 12:62102956-62102978 GTACTACCCAGAATATATGTGGG - Intronic
1098270548 12:68765706-68765728 ATACCATCCCATATATATGTGGG + Exonic
1098856288 12:75656497-75656519 ATGCCATAAAGAAGATTTGTTGG - Intergenic
1102769194 12:115458743-115458765 ATGCAAGTCAGTATATATGTTGG + Intergenic
1110644452 13:77866268-77866290 ATGCCATCTAAAATAGCTGTTGG - Intergenic
1113405375 13:110033978-110034000 ATGCAATCCAGCATCTAAGTAGG + Intergenic
1115688483 14:35821162-35821184 ATACCACACAGTATATATGTGGG - Intergenic
1116965909 14:51015047-51015069 TTGCCATCCAGAACAGATGGTGG - Intronic
1117292357 14:54345735-54345757 ATGCCCTCCATAATATGGGTGGG + Intergenic
1119679740 14:76583818-76583840 GTGGCTTCCAGAATTTATGTGGG + Intergenic
1126518904 15:49566483-49566505 AAGCCATACAAAATATATTTAGG + Intronic
1130743215 15:86623308-86623330 ATCCCATCCAGCATTTATGATGG - Intronic
1131379055 15:91948797-91948819 ATGCCACCCAGAATATCTTTGGG - Intronic
1131884025 15:96890251-96890273 CTGCCATCCAGAAGAATTGTAGG + Intergenic
1132283907 15:100645424-100645446 ATGCCCCCCGGAATATCTGTAGG + Intronic
1133148465 16:3808318-3808340 ATGCCCTGGAGAACATATGTTGG + Intronic
1135251263 16:20902154-20902176 ATTCCATTCAGCATATATTTGGG + Intronic
1137816666 16:51404584-51404606 ATGCCATCCACAAGATCTGAAGG - Intergenic
1140007194 16:71090008-71090030 AGGGCATCCAGAATATATGATGG + Intronic
1140924964 16:79573480-79573502 ATGCTTTCCAGAAGATATGGGGG - Intergenic
1141538263 16:84698893-84698915 ATGCCATGAAAAATATAAGTGGG - Intergenic
1144174525 17:12692298-12692320 CTGCCATCCAGAAAATAGGTGGG + Intronic
1144236865 17:13270186-13270208 ATGCCATCCATCATGTGTGTAGG + Intergenic
1149405819 17:56349990-56350012 AAGCCATCCACAATAACTGTGGG - Intronic
1149589145 17:57815593-57815615 ATGGCATCCAGGGTATGTGTGGG - Intergenic
1157542796 18:48524097-48524119 ATGCCAGCCAAAAGATATGTAGG - Intergenic
926792702 2:16591300-16591322 ATCCCATCCAGAACATTTGTTGG + Intronic
929540481 2:42815809-42815831 GTACCATCTAGAATATATTTTGG - Intergenic
930257601 2:49109931-49109953 ATGCCATCCAGAATGAGAGTTGG + Intronic
932208863 2:69910128-69910150 GTCCCATCCACAATATATGAGGG + Intronic
934964253 2:98706108-98706130 ATGCTATCCACCATGTATGTAGG + Intronic
935453911 2:103243403-103243425 GTGCCCTCCAGAATATATGGTGG + Intergenic
935966073 2:108477634-108477656 AATCCATCCAGAATACATTTTGG - Intronic
936341487 2:111637393-111637415 ATTCAATCCAGTATCTATGTGGG + Intergenic
938374227 2:130795080-130795102 ATGACATCTTGAATATCTGTTGG + Intergenic
938592189 2:132750324-132750346 ATGGTATCAAGAATATGTGTTGG + Intronic
940326066 2:152426239-152426261 ATGCTCTCCAGAATAGCTGTAGG + Intronic
940428522 2:153558452-153558474 ATGCCATCGCTAAGATATGTGGG - Intergenic
941230678 2:162908153-162908175 ATGGCATTCAGAATAGATATTGG - Intergenic
941923671 2:170875378-170875400 ACCCCATCCAGAAGATATGGGGG - Intergenic
942858062 2:180575796-180575818 TTGCCATACAGTTTATATGTTGG + Intergenic
944645342 2:201774270-201774292 ATGCCATCCAGAATATATGTGGG + Intronic
945161151 2:206892198-206892220 ATTCCATCAACAATATATGAGGG + Intergenic
945896963 2:215494339-215494361 ATACTATCCAGAACATATGCTGG - Intergenic
1169900654 20:10548972-10548994 ATGCCATCCAAAAGGTATGCTGG + Intronic
1170760085 20:19241255-19241277 ATGCCATCCAGAAAGAATCTTGG - Intronic
1174697628 20:52576408-52576430 ATTCCATCCAGAATTTCAGTGGG - Intergenic
1176697865 21:10002388-10002410 AGGCCCTCCATAATACATGTGGG - Intergenic
1184525238 22:45018954-45018976 AAGTCACCCAGCATATATGTTGG + Intergenic
949437905 3:4049399-4049421 GTGCCATCCAGCAAATATTTTGG - Intronic
949761719 3:7478370-7478392 ATGCCATTAAAAATTTATGTTGG + Intronic
953477911 3:43221607-43221629 ATGGTATCTAGAATAAATGTGGG - Intergenic
955522077 3:59784775-59784797 ATGCCAACTAGATTCTATGTTGG - Intronic
955986904 3:64583152-64583174 TTGCCATGCAGAATGTCTGTTGG + Intronic
956491538 3:69777709-69777731 ATCCCATCAAAAATATATGGGGG + Intronic
958669776 3:97188133-97188155 ATGCCATCAGGAATACATGTGGG - Intronic
958746770 3:98145223-98145245 CTGCTATCCAGAATATATAAGGG + Intergenic
963015726 3:140822083-140822105 ATGGCATCCAGAATCTTTGAAGG + Intergenic
963243122 3:143030743-143030765 ATGCCATTAAGAACATTTGTGGG + Intronic
964245905 3:154653066-154653088 CTGCCCTCCATAATATAGGTAGG - Intergenic
965929643 3:174027665-174027687 GAGCCATCCTGAATATATTTGGG - Intronic
966081668 3:176011533-176011555 ATGCCAGCCAGAATACAAGAAGG - Intergenic
966150307 3:176861033-176861055 TTCCCCTCCAGAATGTATGTAGG - Intergenic
966233258 3:177672095-177672117 CTGCCCACCAGAATTTATGTAGG - Intergenic
966859755 3:184224045-184224067 TTGCCCTCCAGAATATGGGTGGG + Intronic
967206793 3:187130758-187130780 CTGCCATACAGAAGATATTTAGG - Intronic
971128676 4:23781772-23781794 AAGCCATGGAGAATATATTTTGG + Intronic
974433432 4:61828077-61828099 ATGCCTGCCAGAATTTATTTAGG + Intronic
976036707 4:80831965-80831987 ATGCCATTCATAATAAATCTAGG + Intronic
978417698 4:108494562-108494584 ATGACATCCAAAATGTATGGGGG + Intergenic
981499718 4:145436988-145437010 AAGCCAGCCAGAATTTATGGGGG + Intergenic
983502833 4:168519401-168519423 AAACCATCCAGAAAATATCTTGG + Intronic
983710627 4:170711629-170711651 ATGTCAACCAGAATACAAGTGGG - Intergenic
983818907 4:172168822-172168844 ATGACATCGAAAATATTTGTAGG - Intronic
984197220 4:176672694-176672716 TTGCCCTCCAGAAAATATGGTGG - Intergenic
985151488 4:186951688-186951710 AAGGCATCAAGAATATATGCTGG - Intergenic
987338788 5:16921172-16921194 ACACCATCCAAGATATATGTGGG + Intronic
987607170 5:20151931-20151953 ATGGAATCCAGAATATATACTGG + Intronic
988861399 5:35284141-35284163 AGGCCATTCAGATTTTATGTGGG + Intergenic
990162763 5:52961254-52961276 ATGGCAACCAGAATCTGTGTAGG - Intergenic
990418053 5:55605655-55605677 ATGCCTTTAAGAATATTTGTGGG + Intergenic
990811886 5:59735585-59735607 ATTCCATCTAAAATATATTTTGG - Intronic
991031594 5:62087498-62087520 TTGCCATCCAGAATAAAACTGGG - Intergenic
991112722 5:62919306-62919328 TTGCCCTCCACAATATAGGTGGG + Intergenic
991423948 5:66471130-66471152 ATGCAAACAAGAATATATGCTGG + Intergenic
992704239 5:79371916-79371938 AAGCCACCCAGATTATATCTGGG - Intergenic
995683780 5:114748803-114748825 ATGACATGGAGAATATCTGTTGG + Intergenic
995755759 5:115502357-115502379 TTGCCTTCCATAATATAGGTGGG + Intergenic
996947126 5:129083849-129083871 ATGGTATCCAGAATCTAGGTGGG + Intergenic
999592708 5:153166438-153166460 ATCCTCTCCAGAATAGATGTTGG - Intergenic
999973208 5:156885427-156885449 ATTCCATCTATAATATCTGTGGG + Intergenic
1002800574 6:518514-518536 ATGCAATGAAGAAAATATGTAGG + Intronic
1002952971 6:1833648-1833670 AGGTCATCCAAAATATGTGTGGG - Intronic
1003868998 6:10387006-10387028 ATGCCATTCAGAAAACAGGTCGG - Intergenic
1005246605 6:23892879-23892901 CTGCCATACAAAATATATCTAGG + Intergenic
1008401527 6:51069022-51069044 ATGCTATCCAGAATAACTGAAGG + Intergenic
1010690460 6:78905543-78905565 ATTACTTCCAGAATATATGGAGG + Intronic
1011180635 6:84616096-84616118 ATGCCATTTGAAATATATGTAGG - Intergenic
1020726651 7:11823219-11823241 AAGCCAACAAGAACATATGTTGG - Intronic
1021316439 7:19153798-19153820 ATGCCATCTAAAATATGTGTGGG - Intergenic
1022006480 7:26270626-26270648 ATGCCATTAAGAACATTTGTGGG - Intergenic
1024119572 7:46223029-46223051 ATACCATGCAGAAGAAATGTTGG + Intergenic
1024549403 7:50549350-50549372 ATGCCATTAAGAACATTTGTGGG + Intronic
1026643863 7:72151178-72151200 TTGCCATCAAGGTTATATGTAGG + Intronic
1026667160 7:72351819-72351841 ATGCAATTCACAATATATTTAGG - Intronic
1027850478 7:83445414-83445436 ATGTCATCAAGAGTATAGGTGGG + Intronic
1030083677 7:105799266-105799288 ATGTCATCCAGAACATGTGATGG + Intronic
1030277203 7:107734154-107734176 ATGCCTTGCAAAATATATTTGGG + Intergenic
1030926176 7:115457569-115457591 ATGCCATACAGTATATCTCTAGG - Intergenic
1032703215 7:134399788-134399810 TTGCCCTCCATAATATAAGTGGG - Intergenic
1032741947 7:134748298-134748320 ATGTCATCCAAATTAGATGTGGG - Intronic
1040540501 8:48349268-48349290 CTGCAAACCAGAATATATCTGGG + Intergenic
1041262228 8:56031594-56031616 AAGGCACCAAGAATATATGTTGG + Intergenic
1043045449 8:75317234-75317256 TTACCATCCTGAATATAGGTTGG - Intergenic
1043292967 8:78627116-78627138 AAGTCATCAAGAATATATATTGG + Intergenic
1044057316 8:87587159-87587181 TTGCCCTCCAGAATATGGGTGGG - Intronic
1044158741 8:88885763-88885785 AAGCTATCCTGAATATATGCAGG - Intergenic
1045035834 8:98176003-98176025 ATGCCATACAGAATCAATTTTGG + Intergenic
1047296294 8:123573292-123573314 ATGCCTTGAAGAACATATGTTGG + Intergenic
1057045728 9:91885120-91885142 ATGCCTTCCAGAGAATATTTTGG - Intronic
1186132222 X:6480232-6480254 CTGCCATCCAGAAACTGTGTAGG + Intergenic
1186704282 X:12125612-12125634 ATGCCTTCCAGAACATAGCTGGG - Intergenic
1187578429 X:20582415-20582437 AAGACATCTAGAATATCTGTGGG + Intergenic
1191930498 X:66366371-66366393 ATGACACCCAGAATATAAGAAGG - Intergenic
1192052331 X:67736021-67736043 CTCCCATTCAGAATAAATGTGGG + Intergenic
1192257197 X:69471668-69471690 ATGTCTTCCAGAACATATATAGG - Intergenic
1193018527 X:76763480-76763502 AAGCCATCAGGAATATATATTGG + Intergenic
1193259166 X:79385143-79385165 ATGCCATTCAGGACATAGGTAGG + Intergenic
1193401150 X:81044374-81044396 ATGCCTACAAGAATATATCTAGG - Intergenic
1194166229 X:90520783-90520805 ATGTCATCAACAATATAAGTAGG - Intergenic
1195157331 X:102137148-102137170 ATGCCATATATGATATATGTTGG + Intergenic
1195927127 X:110037531-110037553 AAGCCCTCCACAATATATGGTGG - Intronic
1197494662 X:127163007-127163029 AAGGCATCAAGAACATATGTTGG - Intergenic
1197651571 X:129071269-129071291 ATGACATCCACAACATAAGTAGG - Intergenic
1199859766 X:151790741-151790763 ATGGTATTCATAATATATGTTGG - Intergenic
1200512499 Y:4098564-4098586 ATGTCATCAACAATATAAGTAGG - Intergenic
1201309095 Y:12578633-12578655 ATGCCATTCAGGACATAGGTAGG - Intergenic