ID: 944647233

View in Genome Browser
Species Human (GRCh38)
Location 2:201792077-201792099
Sequence TAAGGTGTTAAGTAGAGTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 143
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 130}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944647226_944647233 24 Left 944647226 2:201792030-201792052 CCCAAAGTGCTGGGATTACGGGT 0: 689
1: 75612
2: 305539
3: 247475
4: 150846
Right 944647233 2:201792077-201792099 TAAGGTGTTAAGTAGAGTTCAGG 0: 1
1: 0
2: 0
3: 12
4: 130
944647227_944647233 23 Left 944647227 2:201792031-201792053 CCAAAGTGCTGGGATTACGGGTG 0: 646
1: 71746
2: 207097
3: 251626
4: 205354
Right 944647233 2:201792077-201792099 TAAGGTGTTAAGTAGAGTTCAGG 0: 1
1: 0
2: 0
3: 12
4: 130
944647223_944647233 28 Left 944647223 2:201792026-201792048 CCTACCCAAAGTGCTGGGATTAC 0: 67
1: 2879
2: 4109
3: 3380
4: 3260
Right 944647233 2:201792077-201792099 TAAGGTGTTAAGTAGAGTTCAGG 0: 1
1: 0
2: 0
3: 12
4: 130
944647230_944647233 -7 Left 944647230 2:201792061-201792083 CCACGCCCGGACAAATTAAGGTG 0: 1
1: 0
2: 1
3: 8
4: 107
Right 944647233 2:201792077-201792099 TAAGGTGTTAAGTAGAGTTCAGG 0: 1
1: 0
2: 0
3: 12
4: 130

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944647233 Original CRISPR TAAGGTGTTAAGTAGAGTTC AGG Intronic
907021540 1:51071271-51071293 TATGTTTATAAGTAGAGTTCTGG - Intergenic
912061681 1:105680390-105680412 TAAGGTGTAAGGAAGAGGTCCGG + Intergenic
912239505 1:107890735-107890757 TAAGGTATTTACTAGAGTTGGGG - Intronic
915129408 1:153686550-153686572 TAAGGAGTTAAGAAGAGTGAGGG + Intronic
921876334 1:220200651-220200673 CAAAGTGTTAAGTTCAGTTCAGG - Intronic
1076409743 10:130237778-130237800 TAAGGTGTAAGGTAGGGTTGAGG + Intergenic
1079582037 11:22077630-22077652 TAAGGTATTCAGTAGATTTCTGG - Intergenic
1079746857 11:24143276-24143298 TAAGATTTTAAGAAGAGTTTTGG - Intergenic
1079917459 11:26387404-26387426 TAAAGAGATAAGTAGAGTACTGG - Intronic
1084143132 11:67247595-67247617 TTTTGTGTTAAGTAGAGTTGGGG + Intronic
1087442261 11:98201573-98201595 TAAGGTGTTAGGAAGGGGTCAGG + Intergenic
1088607795 11:111548077-111548099 ACAGGTATTAAGTAGAGGTCTGG - Intronic
1091131282 11:133149105-133149127 TAAGCTGCTAAGTAGAATTGAGG - Intronic
1092219929 12:6706078-6706100 TAAGGTGTTGAGTTGAGGCCAGG - Intergenic
1093131331 12:15394877-15394899 TCAGTTGATAAGTAGAGTTTGGG - Intronic
1093323426 12:17742376-17742398 TGAGGTGCTAAGTAGAATTTTGG + Intergenic
1093537569 12:20240261-20240283 TAAAGTGTTAAATAGATTTTGGG - Intergenic
1098434650 12:70455645-70455667 TAAGGTGTAAGGAAGAGGTCCGG + Intergenic
1102162040 12:110777211-110777233 TAAGGTGTTAAGATGGGATCTGG + Intergenic
1109485544 13:63014506-63014528 TATGGTGTTACGTAGAGCTAAGG + Intergenic
1110424378 13:75349760-75349782 AAAAGTGTTAAGTAAAGTTCTGG + Intronic
1110571227 13:77006710-77006732 TAAGGTGTTTAATATAGCTCAGG - Exonic
1111179509 13:84644597-84644619 TAAGGGGTTTAGTAGTGTTGAGG + Intergenic
1112027869 13:95428724-95428746 TAAGGTGTAAGGAAGGGTTCCGG + Intergenic
1116001721 14:39249885-39249907 TAAGGTATTACGTATAGTTCTGG - Intronic
1116606479 14:47003275-47003297 TAAGTTGTTAAGTAGACTTATGG + Intronic
1118069530 14:62231213-62231235 TAAGGTGTCAGGTAGAGATGAGG + Intergenic
1119617459 14:76108109-76108131 GGAAGTGTTAAGTAGAGTCCCGG - Intergenic
1120355853 14:83432669-83432691 AGATGTGTTAAGTAGAATTCAGG + Intergenic
1123819130 15:24009757-24009779 CAGCGTGTTAATTAGAGTTCTGG + Intergenic
1129824684 15:78626918-78626940 TGAGGTCTTCAGAAGAGTTCAGG + Intronic
1131102806 15:89706582-89706604 TATGGTGTGAAGTAGAGTTGAGG - Intronic
1136985891 16:35104226-35104248 TTATGTGTTAAGTAGTGTTCTGG + Intergenic
1138089705 16:54164241-54164263 TAAGGTGATAAAGAAAGTTCTGG + Intergenic
1138369909 16:56518827-56518849 GAAGGTGTTTAGTAGAAGTCTGG + Intronic
1140711684 16:77684580-77684602 CAAGGTTTTTAGTAGAGTTAAGG - Intergenic
1141925335 16:87164889-87164911 TGAAGTGTTAAGAAGAGTGCTGG - Intronic
1144402971 17:14924700-14924722 TTAGGTGTTAAGAGGAGTTTGGG - Intergenic
1145819166 17:27818067-27818089 TAAGGTGTGAGGTTGAGCTCTGG - Intronic
1146775266 17:35608866-35608888 TAAGGTGTTAAGCTATGTTCTGG - Intronic
1150017961 17:61578535-61578557 AGAGGTGTTAAGGAGAGTTATGG + Intergenic
1155016003 18:21840430-21840452 TAAGTTGTGAAGTAAAGTTAAGG - Intronic
1155326568 18:24670932-24670954 TAAGGTGTTGAGTTGAGCTGAGG + Intergenic
1156578889 18:38351966-38351988 TAAGGTGTTTCATAGAGTTTGGG + Intergenic
1157425859 18:47583781-47583803 AAAGGGGTCAAGAAGAGTTCAGG - Intergenic
1162657402 19:12141251-12141273 CAAGGAGTGAAGTGGAGTTCTGG - Intronic
927403520 2:22741900-22741922 TCAGGTGATAAATGGAGTTCTGG - Intergenic
928189719 2:29152440-29152462 TCAGGTGTTAAGTGAAATTCAGG - Intronic
930431774 2:51286626-51286648 TAGAGTGTTAAGTAGTGTTTTGG + Intergenic
930513235 2:52372784-52372806 GAAGGTGTTGAGGAGGGTTCTGG + Intergenic
931260542 2:60614745-60614767 GAAGGAGGTAGGTAGAGTTCAGG + Intergenic
931934508 2:67181461-67181483 CAAGGGATGAAGTAGAGTTCGGG - Intergenic
934705562 2:96475854-96475876 TATGGTGTTAGGTAGAGATTTGG + Intergenic
936229333 2:110686245-110686267 TAAAATGTTTTGTAGAGTTCAGG + Intergenic
938844486 2:135194898-135194920 TTAGTAGTTAAGTAGAGGTCAGG - Intronic
940091669 2:149926582-149926604 TAAGATGTTTAGTACAGTACTGG + Intergenic
941586084 2:167361513-167361535 TCAGGTGTTAATCAGAGTACTGG + Intergenic
943184705 2:184592822-184592844 TAAGATGTTAAGTAAAGATGGGG - Intergenic
943574136 2:189610973-189610995 TAAGTTATGAAGTAGAGTTCAGG - Intergenic
944647233 2:201792077-201792099 TAAGGTGTTAAGTAGAGTTCAGG + Intronic
944764770 2:202853015-202853037 TAAGGTGTAAGGAAGGGTTCTGG - Intronic
945369387 2:208998004-208998026 TAAGGATTAAAATAGAGTTCAGG - Intergenic
945623063 2:212166905-212166927 TAAGGTGTAAGGAAGAGGTCCGG - Intronic
946803833 2:223450122-223450144 TTAGATTTTAAGTAGAATTCAGG - Intergenic
1173020032 20:39259504-39259526 TAAGGGGTTAAGAAAAGTGCTGG - Intergenic
1175656199 20:60773060-60773082 TTAGGTGTTAACCAGAGTTAGGG + Intergenic
1177427834 21:20948148-20948170 TATGGTGGGAAGTAGAGCTCAGG + Intergenic
1185206764 22:49543713-49543735 TAAGGTGTAAGGTGGATTTCCGG + Intronic
949295255 3:2514260-2514282 TAAGCTGTTAAGGAGGGTTAGGG - Intronic
951129572 3:19025759-19025781 AAAGGTGATAAATAGAGTCCTGG - Intergenic
952802147 3:37304263-37304285 TAAGGTGTTAAGGAGGGGACTGG + Intronic
955258297 3:57357801-57357823 TAAGGTGTTAACTCGTGTACTGG + Intronic
957951137 3:87128339-87128361 TAAGGTTTTAATTTGAGGTCTGG - Intergenic
959630935 3:108506510-108506532 TCAGGTGTTCATAAGAGTTCTGG - Intronic
960659462 3:120042198-120042220 TAAGGAGTTAAGTGGAGAACAGG - Intronic
960979104 3:123204950-123204972 TAAGGTCTTAAGGAGGGTTGTGG - Intronic
961576254 3:127838945-127838967 TATGGTGTTAGGTAGAGATTTGG - Intergenic
962634388 3:137315411-137315433 TAAGGTGTAAGGAAGAGATCTGG + Intergenic
962682971 3:137819472-137819494 TAAGGAGTGAAATAGAGATCAGG - Intergenic
963662189 3:148141137-148141159 TAAGGTCTTCAATTGAGTTCTGG - Intergenic
964323697 3:155524455-155524477 TAAGATGTTAGGTAGATTTTAGG + Intronic
966318174 3:178672204-178672226 GAAGGTGATCAGTAGAGTCCTGG - Intronic
967673690 3:192270529-192270551 TAAGATGTTAAGTACATTGCAGG + Intronic
969976197 4:11104438-11104460 TAAGGTGTAAGGAAGAGATCAGG - Intergenic
971341560 4:25774157-25774179 TAAGGAGTTAGGTAGGATTCCGG + Intronic
972914591 4:43860198-43860220 TAAAGTGTTATTAAGAGTTCAGG - Intergenic
973618117 4:52700918-52700940 TAAGCTTTTTATTAGAGTTCTGG - Intergenic
975704490 4:77098571-77098593 TGAGGTGTTAATTAGGGTACTGG + Intergenic
977028167 4:91847435-91847457 TGAGGTGATAAATGGAGTTCTGG + Intergenic
978339745 4:107709713-107709735 TAGTGTGTTAAGTACACTTCTGG - Intronic
978911102 4:114065037-114065059 TAAGGTATTAACTAGTGTTTGGG + Intergenic
980061889 4:128139833-128139855 TCAGATGGTAAGTAGAGTTTGGG + Intronic
982152515 4:152476291-152476313 TAAGTTATGAGGTAGAGTTCAGG - Intronic
984891095 4:184493779-184493801 GAAGTTGTGAAGCAGAGTTCTGG + Intergenic
987186639 5:15427312-15427334 TCAGGTGTTAAGGAGAGGTGAGG - Intergenic
987373034 5:17210521-17210543 TATGGTGTTAAAAAGAGTCCAGG + Intronic
987850392 5:23345209-23345231 TAAAAAGTTAAGTAGACTTCAGG + Intergenic
989232235 5:39099670-39099692 AAATGTGTTTAGTACAGTTCTGG - Intergenic
992608793 5:78489568-78489590 TAAGTTTTTAAGTAGAGATGAGG + Intronic
994844896 5:104975983-104976005 TTAGGTGTTATGTAGAGTGATGG + Intergenic
995066058 5:107864435-107864457 TATGTTATTAAGGAGAGTTCTGG - Intronic
995546322 5:113235692-113235714 TAAGGTGTAAAGAAGATTTCTGG + Intronic
995710047 5:115026173-115026195 TTAGGTGTTAGGTAGATGTCTGG + Intergenic
997594993 5:135101322-135101344 TAAGGTGTAAGGGAAAGTTCAGG - Intronic
998872213 5:146563903-146563925 TAAGGTGTGCAGTAGATTTATGG - Intergenic
1001334186 5:170783968-170783990 TTAGGTGTTCAGCAGAGTCCAGG - Intronic
1001966767 5:175915091-175915113 TAAGTTGTGAAGTAGAATTAGGG - Intergenic
1002250182 5:177924113-177924135 TAAGTTGTGAAGTAGAATTAGGG + Intergenic
1008883727 6:56409680-56409702 TAGGGCATCAAGTAGAGTTCAGG + Intergenic
1009194589 6:60668725-60668747 TAAGGAGTGAGGCAGAGTTCAGG - Intergenic
1010751516 6:79620933-79620955 TAAGTTTTTAAATAGAGTTGGGG + Intergenic
1012259323 6:97069365-97069387 TAGGGAGTTAAGGAGAATTCTGG + Intronic
1013764253 6:113556159-113556181 TAAGGAGTTGAGCAGAGTTTGGG - Intergenic
1014808899 6:125863262-125863284 TATTGTGTTAATTAGAGTGCTGG - Intronic
1015731188 6:136349832-136349854 TAAGGTGAGGAGTAGGGTTCAGG + Intronic
1020242390 7:6405784-6405806 TAAAATGTTTAGTAGAGTTGGGG + Intergenic
1025101498 7:56139155-56139177 TGAGGTGTTAAATAGAGTCAAGG - Intergenic
1026317876 7:69242981-69243003 TGAGGTGTTAAATAGAGTCAAGG + Intergenic
1028260117 7:88653799-88653821 TCAAATGTTAAGAAGAGTTCAGG - Intergenic
1030267609 7:107636365-107636387 TAAAATCTTAATTAGAGTTCTGG - Intergenic
1030546679 7:110905039-110905061 GCAGGTGGTAAGTAGAGTTTAGG - Intronic
1031478574 7:122251569-122251591 TAATGTGTTAAGTTCAATTCAGG + Intergenic
1031784335 7:126009926-126009948 TAAGGTGTAAAGAAGGGATCTGG + Intergenic
1032176961 7:129638317-129638339 TAAAGTGTCAAGTATAATTCTGG - Intronic
1036079320 8:5536911-5536933 GAAGATGTTAAGTAGATTTAAGG - Intergenic
1036739697 8:11348798-11348820 TGAGGGTTTAAGAAGAGTTCAGG + Intergenic
1039303127 8:36231711-36231733 TTACGTCTTAAGTAGAATTCAGG + Intergenic
1040637472 8:49291595-49291617 TAAGATTTTAAGCAGAGGTCTGG - Intergenic
1041373858 8:57192871-57192893 TTTGGTATTAAGTAGAATTCCGG + Intergenic
1041422025 8:57677697-57677719 AAAGATGTTTAGTAGAGTTCAGG - Intergenic
1047879993 8:129182598-129182620 TATGGTGTGAAGTAGAGGTCTGG - Intergenic
1050880753 9:10697241-10697263 TAAAGAGTTAAGAAGTGTTCCGG + Intergenic
1055584765 9:77747028-77747050 TCAGGTGTAAAATACAGTTCTGG + Intronic
1057789506 9:98114788-98114810 TCAGGTTTTTATTAGAGTTCTGG - Intronic
1058537109 9:105973061-105973083 TAAAGTGTTAAGAAGAGTTTGGG - Intergenic
1060187930 9:121575193-121575215 GGGGGTGTTAAGTACAGTTCAGG - Intronic
1061617206 9:131788093-131788115 TCAGGCGTTACGTAGAGTTCAGG - Intergenic
1186669676 X:11757005-11757027 AAAGGGGTTAAGCAGAGTCCTGG + Intergenic
1187030135 X:15478404-15478426 TAAGGTGGTAAGTGGAGCTATGG + Intronic
1189845240 X:45130255-45130277 TAAGGTGTGAGGTAGGGATCAGG + Intergenic
1195491368 X:105474038-105474060 TAAGGTTGTAAGTAGAATTATGG + Intronic
1196265440 X:113639264-113639286 ACAGGTGTTAAGTAGAGTCATGG - Intergenic
1201522328 Y:14889020-14889042 TAAGGTGTAAAGAAGGGGTCCGG + Intergenic