ID: 944648660

View in Genome Browser
Species Human (GRCh38)
Location 2:201806571-201806593
Sequence CTGCTGACCTCTGGCAAAAA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 193
Summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 165}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944648655_944648660 17 Left 944648655 2:201806531-201806553 CCAGGCAGAGCCATCATGTGAGT 0: 1
1: 0
2: 1
3: 9
4: 145
Right 944648660 2:201806571-201806593 CTGCTGACCTCTGGCAAAAAGGG 0: 1
1: 0
2: 1
3: 26
4: 165
944648656_944648660 7 Left 944648656 2:201806541-201806563 CCATCATGTGAGTCATATGAAAG 0: 1
1: 0
2: 1
3: 4
4: 144
Right 944648660 2:201806571-201806593 CTGCTGACCTCTGGCAAAAAGGG 0: 1
1: 0
2: 1
3: 26
4: 165

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944648660 Original CRISPR CTGCTGACCTCTGGCAAAAA GGG Exonic
900337815 1:2173402-2173424 CTGCTGTCCTTGGGCAAAACGGG + Intronic
902817923 1:18926649-18926671 CTGCTGGCCTCTGGGGAAAAGGG + Intronic
902856948 1:19214339-19214361 GTGGTGACCTCTGGGAAACATGG + Intergenic
905209101 1:36361193-36361215 CCTCTGACCTTTGGGAAAAATGG - Intronic
905417598 1:37815102-37815124 GTGCTCACCTCTGGGAAAAGCGG - Exonic
905789102 1:40781019-40781041 CTGCTGCTCTCTGGCCCAAAAGG + Intergenic
906120277 1:43385230-43385252 CTTCTGACCTCTGTCAAACAGGG - Intronic
907287865 1:53393499-53393521 CTGCTGGCCACAGACAAAAACGG + Intergenic
908711234 1:67017916-67017938 CTGATGACCTCTGGCCCAAATGG + Intronic
909702647 1:78544453-78544475 TAGCAGACATCTGGCAAAAAGGG - Intergenic
910379745 1:86613734-86613756 CTGGTGACATCAGGCAAACAGGG - Intergenic
914984117 1:152441796-152441818 CTGCTGACCAGAGGCTAAAACGG + Intergenic
915004783 1:152625903-152625925 CTACTGACCTGTGGCAGCAACGG + Intergenic
915140996 1:153768486-153768508 GTGCTGACCTTTGGCCAAAGAGG - Intronic
915895079 1:159805811-159805833 CCACAGAGCTCTGGCAAAAAGGG - Intronic
919030387 1:192234829-192234851 CTGCTGACCCCTGGTAGACATGG + Intergenic
922493265 1:226035866-226035888 CTGCTGCCCACAGGCAAAGAGGG - Intergenic
923069991 1:230554511-230554533 CTGGTTATCTCTGGTAAAAATGG - Intergenic
923712161 1:236395981-236396003 CTGCAAACCTCTGGCAGAAATGG + Intronic
1064790365 10:18951531-18951553 CTGCTGGCCCCAGGCAATAAGGG - Intergenic
1068053982 10:51987354-51987376 CTGCAGTCATCTGGCAAAGAAGG + Intronic
1068902108 10:62280485-62280507 CTGCTGGCCCCGGGCAAAGAGGG + Intergenic
1069598188 10:69686406-69686428 CTGCTCAGCTCTGGCCAGAAAGG - Intronic
1070388573 10:75949214-75949236 CAGCTGGCCACTTGCAAAAAAGG + Intronic
1077552741 11:3208576-3208598 TTGCTGACCTCTGGCCCAAGGGG + Intergenic
1079639034 11:22781147-22781169 CTGCTGTCCTTTGGCAAACAAGG + Intronic
1081088099 11:38825601-38825623 ATGTTGACCTCTAGCAAAATTGG - Intergenic
1085529097 11:77181246-77181268 CTCCTGACCGCTGGGAAGAATGG - Intronic
1086588659 11:88485476-88485498 CTGCTGACAGCAGGCCAAAATGG + Intergenic
1090399520 11:126440206-126440228 CTGCTGAGCTCTGACATGAACGG - Intronic
1093883365 12:24431791-24431813 CTGCTGACACCTGACTAAAAAGG + Intergenic
1097205139 12:57314602-57314624 CTGCTAACCTCTGGGAAAACTGG + Intronic
1099453744 12:82839367-82839389 CTGATCACCTGTGGAAAAAAGGG - Intronic
1102720808 12:115014332-115014354 CTCCTGACCTCTGGTAAAAGAGG + Intergenic
1107761050 13:43679276-43679298 CTGCTGACCACAGGAAGAAATGG - Intronic
1110846896 13:80200012-80200034 CAACTCACCTCTTGCAAAAATGG + Intergenic
1117324302 14:54654735-54654757 TTGCTGACCTGTGGCTAAATAGG - Intronic
1121328801 14:93036818-93036840 ATGCTGACAGCTGCCAAAAAGGG + Intronic
1122835206 14:104427417-104427439 CTGCTGGCCTCTGCCCAAGATGG - Intergenic
1129393144 15:75230608-75230630 CTGCTCTCCGCTGGCAAATATGG + Intergenic
1130584105 15:85166678-85166700 CTGCTGAGCTCTGGTACAGATGG - Intergenic
1130953278 15:88609171-88609193 CCGCTGAACTCTGGCACAGATGG - Intergenic
1131396713 15:92092081-92092103 CTCCTGCCCTCTTGCAGAAAAGG - Intronic
1132245808 15:100295348-100295370 CTGCTGAGCTCTGTCAATAGGGG + Intronic
1132942880 16:2516977-2516999 CTGCTGCCCTCTGTAGAAAAGGG + Intronic
1133702921 16:8325995-8326017 ATGCTGAGCACTGGCAAAGAGGG - Intergenic
1134658010 16:15962180-15962202 CTCCTGACCTCTGGAAAGTAAGG - Intronic
1135047298 16:19166455-19166477 CTCCTGACCTCAGGTGAAAAAGG + Intronic
1135274529 16:21100627-21100649 CTGCTGCTCTCTGCCATAAAAGG - Intronic
1136156867 16:28388890-28388912 CTGCCAACCTCTGCCAATAAGGG + Intronic
1136206219 16:28726391-28726413 CTGCCAACCTCTGCCAATAAGGG - Intronic
1136483161 16:30555349-30555371 CGGCTGACTTCTGGCCAAAGCGG + Exonic
1136995133 16:35183916-35183938 TTTCTGACCTTTGGCAAAAATGG + Intergenic
1140963395 16:79939996-79940018 CTCCTGTCATCTGGCAAACACGG - Intergenic
1141009034 16:80380209-80380231 CTCATGACCTCTGACAACAAGGG + Intergenic
1141699765 16:85636952-85636974 CTGCTGCCCTCTGGCGCAGATGG - Intronic
1143902538 17:10184865-10184887 CTGCTGACCTCCAGGAAAAGGGG + Intronic
1144867224 17:18344354-18344376 CAGCTGACCTCCAGTAAAAATGG + Intronic
1146401957 17:32506654-32506676 GTGCAAACCTCTGGCTAAAAGGG + Intronic
1146539993 17:33685856-33685878 CTGCTTAGCTATGTCAAAAAAGG + Intronic
1148948179 17:51283926-51283948 TTGATGACTTATGGCAAAAAAGG - Intronic
1153073894 18:1140708-1140730 CTGCTGTCTTCTGGCATACATGG + Intergenic
1155128105 18:22900871-22900893 CTTGTGATCTCTGGCAACAAAGG - Intronic
1157938273 18:51896903-51896925 CTGCTTACCTCTGACATTAAGGG + Intergenic
1159762559 18:72446502-72446524 CTGGTGATCTCTTTCAAAAAAGG + Intergenic
1161067596 19:2246329-2246351 CTGCTGAGCTCTGGCGGGAAGGG + Intronic
1161281999 19:3450829-3450851 TTGCTGACCCCTGGCCCAAATGG - Intronic
1161336797 19:3718762-3718784 CTGCTTAGGTCTGGCAAAATCGG - Intronic
1162571721 19:11478319-11478341 CCGCTAAGCTCTGGCACAAATGG - Intronic
1163249109 19:16115662-16115684 CTGCAGCCCTCTTGCCAAAATGG - Intronic
1163603820 19:18263690-18263712 CTGCTGGCCTCTGGCCACTAAGG + Intronic
1164023666 19:21330939-21330961 CTCCTCACCTCCGGCAGAAAAGG - Intergenic
1164042305 19:21504542-21504564 CTCCTCACCTCTGGCAGAAAAGG + Intronic
1164272798 19:23687952-23687974 CCCCTCACCTCTGGCAAAAAAGG - Intergenic
1164402763 19:27912930-27912952 TTGCCAACCTCTGGCAGAAATGG - Intergenic
1168465399 19:56597232-56597254 CTGCTGTGATCTGGCAAAATGGG + Intronic
925098983 2:1229851-1229873 CTGCCGGCCTCGGGCAATAAGGG - Intronic
927250144 2:20989590-20989612 CTTCTGACATCTGGGGAAAAGGG - Intergenic
930751278 2:54936935-54936957 CTGCTTAGCTCAGGCTAAAACGG + Intronic
931096502 2:58946523-58946545 CTGATGGCCTCTAGCAGAAATGG + Intergenic
932130612 2:69183918-69183940 CTGCTGAGGTCTGGAAAACAAGG + Intronic
932675848 2:73780200-73780222 CTACTGGCCTCTGGCTAAAGAGG - Intergenic
934603090 2:95673318-95673340 ATGCTGACCTCTTGAAGAAAGGG + Intergenic
941673709 2:168321899-168321921 CTTGTGACCTCTGGCAACAATGG + Intergenic
941757720 2:169205968-169205990 CTGCTTATTTCTGGAAAAAATGG - Intronic
942022771 2:171883434-171883456 CTGCTGCCCTCTGGATGAAAAGG + Intronic
944609671 2:201389494-201389516 CTGTTGGGCTCTGTCAAAAAAGG + Exonic
944648660 2:201806571-201806593 CTGCTGACCTCTGGCAAAAAGGG + Exonic
945872419 2:215242392-215242414 CTGCTGAGGACTAGCAAAAAAGG - Intergenic
946087827 2:217192188-217192210 CTGAGGAACTCTGGCAAGAAGGG - Intergenic
947179309 2:227398029-227398051 CTGAAGACCTCTGGAAAGAATGG - Intergenic
948607060 2:239142579-239142601 GTGCTGAGCTGTGGCATAAAGGG - Intronic
1169423037 20:5474840-5474862 CTGCTGATATCTGCCAGAAAAGG + Intergenic
1169446660 20:5677466-5677488 CTGCAAACCCCTGGCAAAGAGGG + Intergenic
1169947143 20:11001260-11001282 CTCCTGACCTCTGGCAGAATAGG + Intergenic
1170568298 20:17618921-17618943 CTGATTATCTCTGGCAAAAAAGG + Intronic
1174353724 20:49984892-49984914 CTGCTAAACTCTCACAAAAATGG + Intronic
1174933626 20:54843425-54843447 CTGGTAATCTCTGGAAAAAATGG - Intergenic
1175210057 20:57348504-57348526 CTGCTGGCCCCTGGCAATGAGGG + Intergenic
1176269557 20:64228782-64228804 GAGCTGACATCTGGCAAAATGGG + Intronic
1178087519 21:29126803-29126825 GTGCTGACCTCTGGATATAATGG + Intronic
1178421821 21:32449382-32449404 CTCCTGACCTCTGGCAACCATGG + Intronic
1178983360 21:37283437-37283459 CTGCTGGCCCCGGGCAATAAGGG - Intergenic
1179528320 21:41999061-41999083 CTGCTGATCTCTGTAAAAGATGG - Intronic
1180729830 22:17973000-17973022 CTGCCCACCTCTGGCTACAAGGG + Intronic
1183229658 22:36573855-36573877 GAGCTGACCTCTGGCGAATAAGG + Intronic
1184415406 22:44349268-44349290 CTGCTGGCCTCTGGCACAGGTGG + Intergenic
1184953444 22:47862607-47862629 CTGCTGACCTCTTGGCCAAATGG + Intergenic
950929387 3:16773824-16773846 CTGCTGGCCCCGGGCAATAAGGG + Intergenic
951238683 3:20265106-20265128 CGGCTGCCCTCTGGCAGTAAGGG - Intergenic
951489495 3:23253922-23253944 CTTCTGACCTCTCTCAAATAGGG + Intronic
951900858 3:27656372-27656394 CTGCTGATTTCTGGCAGAAATGG + Intergenic
954858507 3:53667127-53667149 CTACAGACCTCTGGCAGAAAGGG + Intronic
955344193 3:58149001-58149023 CTCATGACCATTGGCAAAAATGG + Intronic
955745860 3:62139856-62139878 CTCCAGGCCTCTAGCAAAAAAGG + Intronic
956704376 3:71986745-71986767 CTTCTGACCTCTGATCAAAACGG + Intergenic
957049457 3:75400170-75400192 CTGCTGACCTCTGGCAACCGTGG - Intergenic
959749152 3:109812755-109812777 CTGCTAACCTCTGACAGAAACGG - Intergenic
961601307 3:128064232-128064254 CTGCTGAACTCTAGCTGAAAGGG - Intronic
961881775 3:130066622-130066644 CTGCTGACCTCTGGCAACCATGG - Intergenic
966087067 3:176080602-176080624 CTTCTTTCCTCTGGCAGAAAAGG + Intergenic
969625690 4:8304212-8304234 CTGCTGACCTCTGGGAAGTCCGG - Exonic
969677001 4:8619808-8619830 CAGCTGCCCTCAGGCAACAAGGG - Intergenic
971705053 4:30030729-30030751 CTGCTGACTTCGGGGAAAAGTGG + Intergenic
972591925 4:40496077-40496099 CTGCTTTCCTCTGAGAAAAAAGG + Intronic
974033193 4:56794635-56794657 CTCCTGGCCTCTAGAAAAAATGG + Intergenic
975765739 4:77665862-77665884 ATGCTGACCTCATGGAAAAATGG + Intergenic
977684676 4:99834956-99834978 CTGGTGTCCTCTTGTAAAAAGGG - Intronic
979814005 4:125075981-125076003 CAGCTGACCTATGACAAAACTGG - Intergenic
980140751 4:128913698-128913720 CTGCTGACCTCTTCTAAAATGGG + Intronic
980628588 4:135406727-135406749 CTGCTGGCCTCGGGCAATGAGGG + Intergenic
980835652 4:138188502-138188524 CTGCTCTCCTCTGTCAATAATGG - Intronic
984948729 4:184990340-184990362 CTGCTGGCCCCGGGCAATAAGGG - Intergenic
986339237 5:6775348-6775370 CAGCTCACCTCTGTCAACAAGGG - Intergenic
988357809 5:30200180-30200202 CTGCTGACCTCTGTTATAGAAGG + Intergenic
989276767 5:39598810-39598832 CTGCTGACCTGTGGAGAACATGG + Intergenic
989484081 5:41967990-41968012 CAGGTGGCCTCTGGCAACAAAGG - Intergenic
989672555 5:43935968-43935990 CAGCTGAGCCCTGGCAAAATAGG + Intergenic
997416370 5:133731942-133731964 CTCCTGCCCTCTGGAAAAAAGGG - Intergenic
998160662 5:139811134-139811156 CTACTGACCTCTGGAAGGAAAGG - Intronic
1003218886 6:4139018-4139040 CTGCTTAGCACTGGCAAATAAGG + Intergenic
1004553244 6:16670143-16670165 CTGCTGACCTGTGGAATAAGGGG - Intronic
1005999917 6:30956600-30956622 CTGCTGACCTCTGGCTGGGAGGG + Intergenic
1006003934 6:30987840-30987862 CTGCTGACCTGCGGGAAAAGGGG + Intronic
1006021682 6:31121219-31121241 CTGATGACCTCTGTCAAAGCTGG + Intronic
1006033630 6:31195570-31195592 CTGCTGGCCCCTGGCAATGAGGG + Intergenic
1007219902 6:40270195-40270217 CTGCTGACCCCAAGCAATAATGG - Intergenic
1013095758 6:106943593-106943615 CTCCCGAACTCTGGCAAAAAGGG + Intergenic
1013643667 6:112113528-112113550 CTGCTGTCATCTGCCAAGAATGG - Intronic
1016046101 6:139482227-139482249 CTGGTCACCTCTGACAAAGAAGG + Intergenic
1016393708 6:143600364-143600386 GTGCTGACTATTGGCAAAAAAGG - Intronic
1016970871 6:149761126-149761148 CTGCTGACCTCCTGCCAAGATGG - Intronic
1016970881 6:149761538-149761560 CTGCTGACCTCCTGCCAAGATGG + Intronic
1020215496 7:6186963-6186985 CCTCTGACCTCTGTCCAAAAGGG + Intronic
1020316716 7:6910654-6910676 CTCCTGACCTCTGGAAACCATGG - Intergenic
1022140122 7:27486591-27486613 CTCCTGCCATCTGGCAAAAAGGG + Intergenic
1022468992 7:30670473-30670495 CTGCTGACCCCTGGGAAAGCAGG + Intronic
1026254381 7:68697992-68698014 CTGCAGACCTCTTGCAACAAGGG + Intergenic
1026335890 7:69393936-69393958 CTGCTGGCCTCGGGCAATGAGGG + Intergenic
1026502227 7:70952545-70952567 CTGCTGGCCTCAGGCAGGAAAGG + Intergenic
1030930625 7:115519893-115519915 CTGATTATCTCTGGCAGAAATGG - Intergenic
1032917563 7:136509691-136509713 CAGCTGCCCTCTGCCAATAAGGG + Intergenic
1035043781 7:155950982-155951004 TTGCTGACCTCAGGCAGAACAGG + Intergenic
1037311766 8:17563615-17563637 ATGCTGAACGCTGGCAAAAATGG - Exonic
1039063821 8:33592649-33592671 ATGCAGATCTCTGGCAAAAGGGG + Intronic
1039915874 8:41859939-41859961 CTGTTGACCTCTGCCACCAAGGG + Intronic
1041014164 8:53573989-53574011 CTGTTGACATCTGGGAAGAAGGG - Intergenic
1042293096 8:67190382-67190404 CTGCTGGCCCCGGGCAAACACGG - Intronic
1043924132 8:86017599-86017621 CAGCGGCCCTCTGCCAAAAATGG + Intronic
1046641165 8:116733352-116733374 CCACTGACCTCTGGGAAAGAGGG - Intronic
1046995430 8:120515538-120515560 CTGCTGACTTCTGTTAGAAAGGG - Intronic
1048221614 8:132547162-132547184 CTGCTGACTTCAGACAAGAATGG - Intergenic
1050541634 9:6675309-6675331 CTGCTTATAGCTGGCAAAAATGG - Intergenic
1052789315 9:32859834-32859856 CTGCTGACATCTGGTGAAGAAGG - Intergenic
1056501770 9:87216602-87216624 CTGCTGAACTGTAGAAAAAATGG + Intergenic
1056637987 9:88347288-88347310 CTGGTGACCTCTGGGACTAAGGG - Intergenic
1057092433 9:92270977-92270999 CTTCTGACCTCCAGCAAAAAGGG + Exonic
1058364986 9:104198872-104198894 CTGCGTATCTCTGGCAAAAAGGG + Intergenic
1059085702 9:111300323-111300345 CTGATGACCTCTGGCCACCAGGG + Intergenic
1060144757 9:121242438-121242460 CTGCTGTCCTCTGGAAAAAGGGG + Intronic
1185983952 X:4809913-4809935 CTGCTGACTTCTGATATAAAAGG - Intergenic
1188048190 X:25452151-25452173 CTGGTGACCTGGGGAAAAAAAGG + Intergenic
1189561344 X:42194383-42194405 CTGGTGACCACAGGCAAGAATGG - Intergenic
1189586711 X:42469139-42469161 CTGCTGACCTTTGGACTAAAAGG - Intergenic
1191055861 X:56239763-56239785 ATGATTACATCTGGCAAAAAGGG - Intronic
1193286995 X:79724873-79724895 CTTTTGACCTCTGGCCAAAGAGG - Intergenic
1194121216 X:89965899-89965921 CTGCTGGCCCCGGGCAATAAAGG - Intergenic
1194302727 X:92207783-92207805 TAACTGACTTCTGGCAAAAAAGG + Intronic
1196193242 X:112815442-112815464 CTGCTGGGCTCTGGAAACAATGG + Exonic
1199814855 X:151388258-151388280 ATGCTGACCTCTGCCACCAATGG + Intergenic
1200474073 Y:3623350-3623372 CTGCTGGCCCCAGGCAATAAAGG - Intergenic
1201458256 Y:14194525-14194547 CAGCTGCCCTCTGGCAGCAAGGG - Intergenic
1201715791 Y:17043214-17043236 CTGCTGGCCCCAGGCAATAAGGG + Intergenic