ID: 944651850

View in Genome Browser
Species Human (GRCh38)
Location 2:201838267-201838289
Sequence GGGTATCACTGGCATCTAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1161
Summary {0: 1, 1: 1, 2: 50, 3: 280, 4: 829}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944651850 Original CRISPR GGGTATCACTGGCATCTAGT GGG Intronic
901157549 1:7150564-7150586 GGGTGCTATTGGCATCTAGTGGG - Intronic
901197242 1:7447088-7447110 GGGGCACACTGGCATCTACTAGG - Intronic
901536583 1:9886348-9886370 GGCTGCTACTGGCATCTAGTGGG - Intronic
902127455 1:14227991-14228013 GGGCAGCACTGGCATTTAGTGGG - Intergenic
902145175 1:14392662-14392684 GTGTGCTACTGGCATCTAGTGGG - Intergenic
902170540 1:14606817-14606839 GGGTTCTACTGTCATCTAGTGGG - Intronic
902176216 1:14652900-14652922 GGGTGCCACTGGCATCTGGCAGG + Intronic
902275673 1:15337570-15337592 GGGTGCCCCTGGCATCCAGTGGG + Intronic
902302760 1:15514175-15514197 GGGTGCTACTGGCATCTAGTGGG - Intronic
902532058 1:17096949-17096971 GGATGTTACTGGCATCTGGTAGG - Intronic
902624676 1:17669740-17669762 CTGGATCACTGGCATCTAGCAGG + Intronic
902672795 1:17986521-17986543 GGGTGCTACTGGCATCCAGTGGG + Intergenic
902765002 1:18608117-18608139 GGGTGCCCCTGGCATCTAGCTGG - Intergenic
902792387 1:18778123-18778145 GGGGAGAACTGGCATGTAGTAGG - Intergenic
903354843 1:22740392-22740414 GGGTACCACTGGCATTTCATGGG - Intronic
903749340 1:25611074-25611096 GAGTGCTACTGGCATCTAGTGGG - Intergenic
904190016 1:28736513-28736535 GGGTATCACTTGCAGCTGGAAGG + Intergenic
904257935 1:29268405-29268427 GGGTGTTACTGGCATCTAAAGGG + Intronic
904690566 1:32290711-32290733 AGGTGCTACTGGCATCTAGTGGG + Intergenic
904994211 1:34618301-34618323 GGGTTGCACTGGCATCTAGTGGG + Intergenic
905851829 1:41280388-41280410 GGATGTTACTGGCATCTAGTGGG - Intergenic
905928101 1:41766284-41766306 GGTTACTACTGGCATCTAGTGGG + Intronic
906089652 1:43167880-43167902 GGGTACTACTGGCATCTAGTAGG - Intronic
906370801 1:45251897-45251919 GGGGGCTACTGGCATCTAGTGGG + Intronic
906405144 1:45536071-45536093 GGGTGCTACTGGCATCTAGAGGG - Intergenic
906721009 1:48004586-48004608 AGGTGCTACTGGCATCTAGTGGG + Intergenic
906820030 1:48919707-48919729 GGGTGTTACTGGCATCTAGTGGG - Intronic
906822025 1:48939916-48939938 GGGTGCCACTGGCATCTAGTGGG + Intronic
908064935 1:60392585-60392607 GGTTGCTACTGGCATCTAGTAGG - Intergenic
908330206 1:63063561-63063583 GGGTGCTACTGGTATCTAGTGGG + Intergenic
908674206 1:66583978-66584000 GGGAATCACTGGCTTCCTGTTGG - Intronic
908772175 1:67607285-67607307 AGGTGCCACTGGCATCTAGTAGG - Intergenic
909175804 1:72357186-72357208 GGGTAAATCTGGGATCTAGTGGG - Intergenic
910210289 1:84785262-84785284 GGGTATCACTTGCAACAAGTTGG + Intergenic
910305968 1:85764196-85764218 AGATGTCAGTGGCATCTAGTGGG - Intronic
910439517 1:87238337-87238359 GGATAAGAGTGGCATCTAGTTGG + Intergenic
910457642 1:87414371-87414393 GAGAATCACTTGAATCTAGTAGG - Intergenic
910749579 1:90614326-90614348 GGATGCTACTGGCATCTAGTGGG - Intergenic
910938535 1:92507411-92507433 GGGTGTTACTGGCATCTACTGGG + Intergenic
912163280 1:107012331-107012353 GGGTCTTACTGGTATTTAGTAGG - Intergenic
912351656 1:109019547-109019569 GGATACTACTGGGATCTAGTGGG + Intronic
912923472 1:113892101-113892123 GGGTTCTACTGGCATCCAGTGGG + Intergenic
913072388 1:115311516-115311538 GGGTGCTACTGGCATCCAGTGGG + Intronic
913313738 1:117532280-117532302 GGGTGATTCTGGCATCTAGTGGG + Intergenic
913524123 1:119674984-119675006 GGCTACTACTGGCCTCTAGTGGG + Intronic
913575846 1:120173992-120174014 TGGTACTACTGGCATCTAGAGGG + Intronic
914290525 1:146269387-146269409 GGGTGCTACTGGCATCTAATGGG - Intergenic
914551569 1:148720170-148720192 GGGTGCTACTGGCATCTAATGGG - Intergenic
914558160 1:148789563-148789585 TGGTACTACTGGCATCTAGAGGG + Intergenic
914614674 1:149340667-149340689 TGGTACTACTGGCATCTAGAGGG - Intergenic
914999788 1:152578923-152578945 GAGAATTTCTGGCATCTAGTGGG - Intronic
915495441 1:156279298-156279320 GGTTGCCACTGGCATTTAGTGGG + Intronic
915607473 1:156961895-156961917 CGGTGCTACTGGCATCTAGTGGG + Intronic
915926154 1:160021249-160021271 GGATGTTACTGGCGTCTAGTGGG - Intergenic
916237021 1:162600102-162600124 TGGTACCACTGGCATCTAATAGG + Intergenic
916583624 1:166130538-166130560 AGGTACTACTGGCATTTAGTGGG + Intronic
916850548 1:168698657-168698679 GGGTGCTAATGGCATCTAGTGGG + Intronic
917017595 1:170551201-170551223 GGGAATTACTGGCAACTAATGGG + Intronic
917038168 1:170772614-170772636 TAGTACTACTGGCATCTAGTAGG - Intergenic
917042764 1:170824327-170824349 TGGTAGTAATGGCATCTAGTGGG + Intergenic
917234999 1:172882441-172882463 GAGTATCACCAGCAACTAGTGGG - Intergenic
917833813 1:178923580-178923602 GGGTTCTTCTGGCATCTAGTAGG + Intergenic
917869000 1:179225626-179225648 AGGTGCTACTGGCATCTAGTGGG + Intronic
919522475 1:198605644-198605666 GGCTGCTACTGGCATCTAGTGGG + Intergenic
919754764 1:201059725-201059747 TGTTATCACTGGCTACTAGTGGG + Intronic
920013193 1:202885156-202885178 GTGTGCTACTGGCATCTAGTGGG - Intronic
920104412 1:203541165-203541187 GGCTGTTATTGGCATCTAGTTGG - Intergenic
920245109 1:204582058-204582080 GGGTGCTACTGACATCTAGTAGG - Intergenic
920393257 1:205624760-205624782 CGGTGCTACTGGCATCTAGTGGG - Intronic
920576657 1:207065803-207065825 AGGTGTTACTGGCATCTAGTGGG - Intronic
920758829 1:208762031-208762053 GGGTACTACTTGCATCTAGTGGG - Intergenic
920881636 1:209886326-209886348 GGATAATACTGGCATCTAGTGGG - Intergenic
921389864 1:214606617-214606639 GGGTTGCACTGGCATCTCATTGG - Intronic
921445688 1:215244438-215244460 GGGTACTACTAGCATCTAGTGGG - Intergenic
921468248 1:215517764-215517786 GAGTGCTACTGGCATCTAGTGGG + Intergenic
921553067 1:216562570-216562592 GGGTGCTACTGGCATCTAGTGGG + Intronic
921734251 1:218608849-218608871 AGGTACTATTGGCATCTAGTAGG + Intergenic
922053666 1:222019773-222019795 GGGTGCCACTGGCATATAGAAGG - Intergenic
922160106 1:223073283-223073305 GGGTGCTTCTGGCATCTAGTAGG + Intergenic
922387266 1:225099467-225099489 GGATACTACTGGCATCTAGTGGG + Intronic
923009152 1:230074447-230074469 GAGAACTACTGGCATCTAGTGGG - Intronic
923584378 1:235253359-235253381 GGGTGCTACTGACATCTAGTGGG - Intronic
923609527 1:235477677-235477699 GGGTGATACTGGCATCTAGTGGG - Intronic
923834192 1:237591547-237591569 GAGTGCTACTGGCATCTAGTGGG - Intronic
924331151 1:242941701-242941723 CTGGATCAGTGGCATCTAGTGGG + Intergenic
924430410 1:243991677-243991699 GGGTGCTACTGGCATCTGGTGGG - Intergenic
924599887 1:245479148-245479170 GGGAATCATTGGCATCTAGATGG + Intronic
924684051 1:246269079-246269101 TGGGATTACTGGCATTTAGTGGG - Intronic
1062834840 10:628865-628887 GGGTGCCCCTGGCATCTGGTGGG - Intronic
1063029720 10:2222182-2222204 GAGTGTCCCTGGCATCTAGGAGG + Intergenic
1063476413 10:6332498-6332520 GAGTGTTACTGGCATCTAGTGGG + Intergenic
1063601200 10:7482890-7482912 GTGTGCCACTGGCATCTAGTGGG + Intergenic
1064131799 10:12716299-12716321 GGATGCTACTGGCATCTAGTGGG - Intronic
1064481782 10:15747180-15747202 GGGTATCAGAGGCTTCTAGAGGG + Intergenic
1064741548 10:18439811-18439833 GGAGATCACTGGCATGCAGTAGG - Intronic
1066425578 10:35304758-35304780 GGATGCCACTGGCATGTAGTGGG - Intronic
1066707396 10:38196015-38196037 GGTTACTACTGACATCTAGTTGG - Intergenic
1066982304 10:42428718-42428740 GGTTACTACTGACATCTAGTGGG + Intergenic
1067109599 10:43390897-43390919 GGGTGCTACTGGCATCTAGTGGG - Intronic
1067188832 10:44053011-44053033 AGGTGCTACTGGCATCTAGTGGG + Intergenic
1067418504 10:46126274-46126296 GGTTACTACTGACATCTAGTTGG - Intergenic
1067590732 10:47507151-47507173 GGTTACTACTGACATCTAGTTGG + Intronic
1067637851 10:48015250-48015272 GGTTACTACTGACATCTAGTTGG + Intergenic
1067679209 10:48417065-48417087 GAGTGCTACTGGCATCTAGTGGG - Intronic
1067875640 10:50005095-50005117 GGTTACTACTGACATCTAGTTGG - Intronic
1068059617 10:52050973-52050995 GGGTGCTACTAGCATCTAGTTGG + Intronic
1068109845 10:52667140-52667162 GGTTATCAGTGATATCTAGTTGG + Intergenic
1068484655 10:57642349-57642371 GGGTACAACTAGGATCTAGTTGG - Intergenic
1068550597 10:58403781-58403803 GGGTACTACTGGCATCTAGTGGG + Intergenic
1068559573 10:58498459-58498481 GGGTACTACTGGCATCTAGTAGG - Intergenic
1068578702 10:58714013-58714035 GGGTGCTACTGGCATCTAGAGGG + Intronic
1069090036 10:64189181-64189203 GGATGCCACTGGCATCTAGTGGG - Intergenic
1069447571 10:68487633-68487655 GAGTGCTACTGGCATCTAGTGGG - Intronic
1069482056 10:68792537-68792559 GGGTGCTGCTGGCATCTAGTTGG + Intergenic
1069525646 10:69168236-69168258 GAGTACTACTGGTATCTAGTGGG + Intronic
1069636220 10:69926434-69926456 GGGTGCTACTGGCATCTAGCAGG - Intronic
1069746638 10:70719069-70719091 GGGTGCTACCGGCATCTAGTTGG + Intronic
1069762469 10:70821598-70821620 GGGTTCTGCTGGCATCTAGTGGG + Intronic
1070134448 10:73679674-73679696 GGTTACTACTGACATCTAGTTGG + Intronic
1070587328 10:77776409-77776431 GGGTGTTAATGGCATCTTGTAGG - Intergenic
1071445532 10:85742994-85743016 AGGCACTACTGGCATCTAGTTGG - Intronic
1071471184 10:85985054-85985076 GGATGCTACTGGCATCTAGTGGG - Intronic
1071607271 10:87004735-87004757 GGTTACTACTGACATCTAGTTGG - Intergenic
1071719747 10:88131370-88131392 GAGTGCTACTGGCATCTAGTGGG + Intergenic
1071853316 10:89598125-89598147 TGTTACAACTGGCATCTAGTGGG - Intronic
1072005474 10:91242164-91242186 GGGTGCTCCTGGCATCTAGTAGG + Intronic
1072018561 10:91375542-91375564 GAGTGCTACTGGCATCTAGTGGG + Intergenic
1072271130 10:93778165-93778187 GGATGTAAATGGCATCTAGTGGG + Intronic
1072415206 10:95241504-95241526 GGATGCCACTGGCGTCTAGTGGG + Intronic
1072692890 10:97583394-97583416 GGGTACTACTGGCATCTAGTGGG - Intronic
1073074182 10:100813195-100813217 AGGCTTCACTGGCCTCTAGTGGG + Intronic
1073224728 10:101908486-101908508 ATGTATTACTGGCATGTAGTAGG - Intronic
1074088168 10:110224432-110224454 GTGTGCTACTGGCATCTAGTGGG + Intronic
1074214363 10:111369834-111369856 GGGTTATACTGGCATCTAGTGGG - Intergenic
1074580771 10:114717499-114717521 GGGTGCTACTGGCATCTACTAGG - Intergenic
1074614152 10:115049537-115049559 GGTTGCTACTGGCATCTAGTGGG + Intergenic
1074668513 10:115759407-115759429 GTGTGTTCCTGGCATCTAGTGGG - Intronic
1075270470 10:121044989-121045011 GGGTACTATTGGCATCTAGAGGG + Intergenic
1075279555 10:121128085-121128107 TGGTGCCACTGGCATCTAGTGGG - Intergenic
1075306217 10:121370019-121370041 TGGTGCCACTGGCATCTAGTTGG + Intergenic
1075382412 10:122030007-122030029 GGGTGCCACTGGCATCTGGTAGG + Intronic
1075507563 10:123038175-123038197 GCGTGCTACTGGCATCTAGTGGG + Intronic
1075546051 10:123355508-123355530 GTGTGCTACTGGCATCTAGTTGG - Intergenic
1075754425 10:124799873-124799895 AGGTGCCACTGGCATCTGGTGGG - Intergenic
1076060632 10:127411502-127411524 TGGTGGCACTGGCACCTAGTAGG - Intronic
1076196305 10:128520725-128520747 GGTCATCACTGGCACCTAGCAGG + Intergenic
1078656948 11:13250199-13250221 GAGTGCTACTGGCATCTAGTGGG - Intergenic
1078709389 11:13776326-13776348 GGGTGCTACTGGCATCTAGTGGG - Intergenic
1079047952 11:17125302-17125324 GGGGACAACTGGCATCTAATGGG + Intronic
1079494122 11:21022010-21022032 GGATGTGACTGGCATCTAGTGGG - Intronic
1080210451 11:29779794-29779816 AGGTACCACTGGCATGTAGTGGG - Intergenic
1080284937 11:30599778-30599800 GGGTGCTACTAGCATCTAGTGGG - Intergenic
1080286534 11:30620623-30620645 GGGTGTTACTCACATCTAGTGGG - Intergenic
1080515845 11:33019256-33019278 GGGTATTGCTGGCATCCAGTGGG - Intronic
1080719776 11:34837676-34837698 TGGTGCTACTGGCATCTAGTGGG + Intergenic
1080950420 11:37026035-37026057 GGGTACTACTAGCAACTAGTGGG - Intergenic
1081193297 11:40130593-40130615 GGTTGCTACTGGCATCTAGTGGG - Intronic
1081222232 11:40476017-40476039 GGGTATTACTGGCACCTAGTGGG - Intronic
1081582219 11:44360185-44360207 GGGTTTTCCTGGCATCTAGAAGG - Intergenic
1081591279 11:44424956-44424978 TGGTACTACTGGCATCTAGTAGG + Intergenic
1081688287 11:45057877-45057899 GGGTGCCACTGGCATCTGGTGGG - Intergenic
1081717129 11:45258340-45258362 GAGTGTCACTGGCATCAAGGAGG + Intronic
1081722472 11:45300422-45300444 AGTTATCACTGGCATCTAGTTGG + Intergenic
1081880513 11:46446643-46446665 GGGTGCTACTGGCATCTAGTGGG - Intronic
1082808918 11:57466853-57466875 GGGTGCTGCTGGCATCTAGTGGG + Intronic
1083140924 11:60720905-60720927 GGGTGCTATTGGCATCTAGTGGG + Intergenic
1083323200 11:61860176-61860198 GGGTGCTACTGGCATCTGGTGGG + Intronic
1083407872 11:62471299-62471321 GGCTTCCACTGGCATCCAGTGGG + Intronic
1083560259 11:63667905-63667927 GAGTGTTACTGGTATCTAGTGGG - Intronic
1084567834 11:69941809-69941831 TGGTACCATTGGCATGTAGTGGG - Intergenic
1085481357 11:76825320-76825342 GTGTATCACTGGGTGCTAGTTGG - Intergenic
1085669532 11:78449757-78449779 GAGTATAACTGGCCTATAGTGGG - Intronic
1086507013 11:87515751-87515773 GGGTGCTACTGGCATCTACTAGG - Intergenic
1086525650 11:87722930-87722952 GGGTGCTACTGCCATCTAGTGGG - Intergenic
1086875512 11:92090882-92090904 TGGTATTACTGGCAACTAGTGGG + Intergenic
1087111147 11:94469301-94469323 GGGTACTACTGGCATCTAGTGGG + Intronic
1087140647 11:94762418-94762440 GGTTGCCACTGGCATCTAGTGGG + Intronic
1087204637 11:95381158-95381180 GGATACTACTGGCATCTAGTGGG - Intergenic
1087609565 11:100417762-100417784 GGGTGCCACTGGTATCTGGTGGG - Intergenic
1087988817 11:104721346-104721368 GGGTACTATTGGCATCTAGTTGG - Intergenic
1088400244 11:109415804-109415826 GGGTGCTATTGGCATCTAGTGGG + Intergenic
1089320838 11:117625763-117625785 GGGTGCTACTGGCATTTAGTGGG + Intronic
1089555472 11:119313784-119313806 GGGTGCTACTGCCATCTAGTAGG - Intronic
1090150557 11:124379281-124379303 GAATATCACTGGCATCTAATGGG - Intergenic
1090347290 11:126081819-126081841 GGGTGCTACTGGCATCTAGTGGG - Intergenic
1090698287 11:129270930-129270952 GGTTGCCACTGGCATCTAGTGGG - Intronic
1090920957 11:131205461-131205483 GGGAACCACCGGCATCTGGTAGG - Intergenic
1091728558 12:2863147-2863169 GGGTGCTACTGGCGTCTAGTGGG + Intronic
1091875967 12:3933056-3933078 AGGTACGACTGGCATCTAGCAGG - Intergenic
1092131392 12:6115778-6115800 GGGTGCTGCTGGCATCTAGTGGG - Intronic
1092724451 12:11471639-11471661 GGGTGCTACTGGCATCTAGTTGG - Intronic
1092735160 12:11575686-11575708 GAGTGGTACTGGCATCTAGTGGG - Intergenic
1092874937 12:12839763-12839785 GGGCATCACTGGCATTTATTAGG - Intergenic
1093057582 12:14570036-14570058 GGGTGCCACTAGCATCCAGTAGG - Intergenic
1093870740 12:24288183-24288205 GGATGCTACTGGCATCTAGTGGG + Intergenic
1094070478 12:26407410-26407432 GGGTGCTACTAGCATCTAGTGGG - Intronic
1094261631 12:28507388-28507410 GGCTACTACTGGCATCTATTGGG - Intronic
1095426343 12:42078341-42078363 GAGTACTACTGGCATCTAGGGGG - Intergenic
1095560253 12:43555702-43555724 GGGTACTACTGGCATCGAGTGGG - Intergenic
1095657709 12:44689769-44689791 GTGTACTACTGGCATCTAGTGGG + Intronic
1096002934 12:48144499-48144521 AGGTGCTACTGGCATCTAGTGGG - Intronic
1096369703 12:51058770-51058792 GGGTGCTACTGGCATCTAGTGGG - Intronic
1096453555 12:51766481-51766503 GGATGCTACTGGCATCTAGTGGG - Intronic
1096599162 12:52717341-52717363 GGTACTAACTGGCATCTAGTGGG - Intergenic
1096970277 12:55659964-55659986 GGGTGCTACTGGCATCTAGTGGG - Intergenic
1097705466 12:62864096-62864118 GGGTGCTACAGGCATCTAGTGGG + Intronic
1098088103 12:66870033-66870055 AGGTGTTACTGGCATCTAATGGG - Intergenic
1098260157 12:68661619-68661641 TGGTGTGACTGGCATCTAGTGGG - Exonic
1098360483 12:69649714-69649736 GAGTATTTCTGGCATCTAGTGGG - Intronic
1098462526 12:70748021-70748043 GGGTGCTACTGGCATCTGGTAGG + Intronic
1098656157 12:73032404-73032426 GGGTGTTACTGGAATCTACTGGG + Intergenic
1098973722 12:76880104-76880126 GGTTGCAACTGGCATCTAGTGGG - Intergenic
1099803356 12:87484707-87484729 GGGTGATACTGGAATCTAGTGGG - Intergenic
1100085821 12:90909245-90909267 AGGTCTCACTGCCCTCTAGTGGG + Intronic
1100357276 12:93843152-93843174 GGGTATCACTAGCAATTAGAAGG + Intronic
1100564877 12:95785971-95785993 GAACACCACTGGCATCTAGTGGG - Intronic
1100584094 12:95963322-95963344 GGATGCTACTGGCATCTAGTGGG + Intronic
1100664919 12:96740857-96740879 GGGTGCTACTGGCATCTACTAGG + Intronic
1100691833 12:97046654-97046676 GTGTGTTACTAGCATCTAGTGGG + Intergenic
1100774503 12:97959493-97959515 GGATGCTACTGGCATCTAGTGGG - Intergenic
1101040052 12:100746626-100746648 AGGTATCACAGGCATCTAGTGGG + Intronic
1101059039 12:100951916-100951938 AGGTGCTACTGGCATCTAGTGGG - Intronic
1101268123 12:103113575-103113597 GGGTGCTACTGGCATCTAGTGGG + Intergenic
1101304605 12:103515003-103515025 GAGTAACACTGGCATCTAATGGG + Intergenic
1101356097 12:103978812-103978834 GGTTACTACTGGCATCTAGTGGG + Intronic
1101365507 12:104065977-104065999 GGCTGTTACTGGCATCTAGTAGG - Intronic
1101633404 12:106517219-106517241 GTACATTACTGGCATCTAGTGGG - Intronic
1101723740 12:107373027-107373049 GGGTGTTACTGGCAGCTACTGGG - Intronic
1102000916 12:109557718-109557740 GGGTGCCACTGGCACCTGGTGGG - Intronic
1102005682 12:109587908-109587930 GGGTGCTACTGGCATCTAGTGGG - Intronic
1102214304 12:111149483-111149505 GTGTGCTACTGGCATCTAGTGGG - Intronic
1102218224 12:111176977-111176999 GTGTACTACTGGCGTCTAGTGGG - Intronic
1102480213 12:113218005-113218027 GGCTACTACTGGCATCTTGTAGG + Intronic
1102745977 12:115249449-115249471 GAATACCACTGGCATCTAGTGGG + Intergenic
1102838284 12:116088499-116088521 GGGTGTGACTGGCATCAGGTAGG + Intronic
1102894849 12:116590704-116590726 GGGTGCTACTGGCATCTAGTGGG - Intergenic
1102910105 12:116707218-116707240 GGGTGCTACTGGCATCTGGTGGG - Intergenic
1103009028 12:117443584-117443606 GGTTATTACTGGCATCTAGTGGG - Intronic
1103025472 12:117570331-117570353 GGGTGCTACTGGCATCTAGTGGG + Intronic
1103298859 12:119911804-119911826 GGGTATTGCTGGCATCTAGTGGG - Intergenic
1103299384 12:119916460-119916482 GAGTGCTACTGGCATCTAGTGGG - Intergenic
1103380519 12:120490713-120490735 TGGTGTGATTGGCATCTAGTGGG + Intronic
1103757947 12:123224645-123224667 GGACATCACTGGCATTTAGTGGG + Intronic
1103838090 12:123840116-123840138 GGGTGCTACTGGCATCTAGTAGG - Intronic
1103844819 12:123893851-123893873 GTGTAGTACTGGCATCTAGTGGG + Intronic
1103855164 12:123963078-123963100 GGGTGCCACCAGCATCTAGTGGG + Intronic
1104402228 12:128485590-128485612 GGGTGCTACTGTCATCTAGTAGG + Intronic
1104408362 12:128537446-128537468 AGGTTTCACTGGCATCTCCTTGG + Intronic
1104420674 12:128632020-128632042 GGGGGTCACAGGCATCTATTGGG - Intronic
1104494468 12:129224002-129224024 GGATGCTACTGGCATCTAGTGGG - Intronic
1104617848 12:130285286-130285308 GGGTTCCACTGGCATCTAGTAGG + Intergenic
1105369210 13:19788060-19788082 GGGTGCTACTGGCATCCAGTGGG - Intergenic
1105460826 13:20584899-20584921 GGGTGCTACTGGCACCTAGTGGG + Intronic
1106014156 13:25852259-25852281 GGGTGCTACTGGCATCTAGCGGG + Intronic
1106138108 13:26989730-26989752 GGGTGCTACTGGCATCAAGTGGG + Intergenic
1106324843 13:28679005-28679027 GGCTGCTACTGGCATCTAGTGGG + Intergenic
1106510159 13:30406271-30406293 GTGTGTTACTGGCATCTAGTGGG - Intergenic
1106801757 13:33263226-33263248 GGGTGCTGCTGGCATCTAGTGGG - Intronic
1106821741 13:33472498-33472520 GGGTACTACTGGAACCTAGTCGG - Intergenic
1106916378 13:34519826-34519848 GAGAATGATTGGCATCTAGTGGG - Intergenic
1107033779 13:35879857-35879879 TAGTGGCACTGGCATCTAGTGGG - Intronic
1107131872 13:36905115-36905137 AGGTGCCACTGGCCTCTAGTGGG + Intronic
1107266516 13:38562028-38562050 TGGTGTTACTGGCATCTAGCAGG - Intergenic
1107282184 13:38749646-38749668 GGGTGTTACTGACATCTAATGGG - Intronic
1107359697 13:39604538-39604560 GAGTATTACTGGCATCTAGTTGG + Intergenic
1107413368 13:40177964-40177986 GGATACTACTGGCATCTAGTGGG + Intergenic
1107595173 13:41956206-41956228 GGGTGCTACTGGCATCTAGCGGG - Intronic
1107625491 13:42278031-42278053 GAGTGCTACTGGCATCTAGTGGG + Intronic
1107638926 13:42421325-42421347 GGGTGTTACCGGCATCTACTGGG + Intergenic
1107675183 13:42788827-42788849 ATGTATCCCTGGTATCTAGTGGG + Exonic
1107879946 13:44824201-44824223 GCGTGTTACAGGCATCTAGTGGG - Intergenic
1108746443 13:53399773-53399795 GGGTACTGCTGGCACCTAGTGGG + Intergenic
1110291664 13:73814772-73814794 GGGTGCTACTGGCATCTAGTGGG + Intronic
1110393931 13:75008241-75008263 GGGTGCTTCTGGCATCTAGTGGG + Intergenic
1110691793 13:78439129-78439151 AGGTGCCACTGGCATCTAGTGGG - Intergenic
1110711237 13:78653279-78653301 GGCTGCTACTGGCATCTAGTGGG - Intronic
1110831007 13:80030680-80030702 GGTTGTGACTGGCACCTAGTGGG - Intergenic
1110859146 13:80328530-80328552 GGAAACGACTGGCATCTAGTGGG - Intergenic
1111901545 13:94205958-94205980 GGGTGCTGCTGGCATCTAGTTGG + Intronic
1112415077 13:99197404-99197426 GGGTGCTACTGGCATCTAATGGG - Intergenic
1112514374 13:100039269-100039291 GGGTGCTACTGGTATCTAGTGGG + Intergenic
1112576387 13:100640231-100640253 AGGTCCCACTGGCATCTAGTAGG + Intronic
1112695466 13:101943443-101943465 AGGTGTTACTGACATCTAGTTGG + Intronic
1113315919 13:109178757-109178779 GGGTGCTGCTGGCATCTAGTGGG + Intronic
1113361116 13:109632465-109632487 GGGTGCCACTGACATCTAGTAGG + Intergenic
1113447288 13:110379180-110379202 GGGTGTTTCTGGCATCTGGTGGG + Intronic
1114376702 14:22154096-22154118 GAATCTTACTGGCATCTAGTAGG - Intergenic
1114579717 14:23746419-23746441 GGGTATCACTGGCATCTGTGGGG - Intergenic
1114821367 14:26023563-26023585 GGTGCTAACTGGCATCTAGTAGG - Intergenic
1116468131 14:45256206-45256228 GGGTACCAGTGGCATCTTGTGGG + Intergenic
1116898017 14:50336119-50336141 GCGTATCACAGGCAACCAGTTGG - Intronic
1117223479 14:53631313-53631335 GGGTATCATTGGGAACTTGTAGG + Intergenic
1117777738 14:59199833-59199855 GGATGTTACTGGCATCTAGTGGG - Intronic
1117869813 14:60188295-60188317 GGTTGTTACTGACATCTAGTGGG - Intergenic
1118375916 14:65176866-65176888 GGGTATCACTGTTGTCTTGTAGG + Intergenic
1118967700 14:70603081-70603103 AGGTTTCTCTGGCATCTAGCTGG - Intergenic
1119266728 14:73267144-73267166 GGGTGCCCCTGGCATCTAGTGGG - Intronic
1119346919 14:73933286-73933308 GGGTACTACTGGCATCTAGCAGG + Exonic
1119457350 14:74767564-74767586 GGCTGCCACTGGCATCTAATGGG - Intronic
1119591504 14:75892552-75892574 GAGTGCGACTGGCATCTAGTGGG + Intronic
1119677848 14:76569259-76569281 GGGTACTGCTGGCATCTAATGGG + Intergenic
1119895620 14:78217394-78217416 GGGTGCTACTGTCATCTAGTGGG + Intergenic
1120063694 14:80014925-80014947 GGGTGCTACTGGCATCTAGTAGG + Intergenic
1120167059 14:81212007-81212029 GAGTGCTACTGGCATCTAGTGGG + Intronic
1120854193 14:89198670-89198692 GGGTGCTACTGGCATCTAATGGG + Intronic
1120865387 14:89291885-89291907 GGGTGTCACTGGTGTCTAGTGGG - Intronic
1121010442 14:90517218-90517240 GGATACTGCTGGCATCTAGTGGG - Intergenic
1121238956 14:92414241-92414263 GGGTGCTACTGGCATTTAGTGGG - Intronic
1121338723 14:93092645-93092667 GAGTAGTACTGGCATCCAGTAGG + Intronic
1121411722 14:93752987-93753009 GGGTGCTACTGGCATGTAGTGGG - Intronic
1121788228 14:96679212-96679234 GGGTGCTACTGTCATCTAGTGGG + Intergenic
1121881120 14:97501052-97501074 TGGTACTACTGGAATCTAGTGGG - Intergenic
1121909363 14:97775234-97775256 GAGTATCACTTGAATCTAGGAGG + Intergenic
1122068678 14:99191222-99191244 GGGTGCTACTGGCATCTAGTGGG + Intronic
1122957054 14:105075754-105075776 GGGTGCCACTGGCTTCTAGTGGG + Intergenic
1125467085 15:39964468-39964490 GGGTGCTATTGGCATCTAGTGGG + Intronic
1125487774 15:40124307-40124329 GAGTGCCACTGGCATCTACTGGG - Intergenic
1125900933 15:43346468-43346490 GAGTGCTACTGGCATCTAGTGGG - Intronic
1126176777 15:45743227-45743249 GGGTGCTACTGGCATCTAGTGGG + Intergenic
1126576897 15:50206195-50206217 GGTTACTACTGGCATCTCGTGGG - Intronic
1126671053 15:51115246-51115268 AGGTACTACTGGTATCTAGTTGG - Intergenic
1126736333 15:51735405-51735427 GAGTGCTACTGGCATCTAGTGGG + Intronic
1127058028 15:55152414-55152436 AGGTGCTACTGGCATCTAGTGGG + Intergenic
1127135057 15:55911221-55911243 GGGTGTTACTAGCATTTAGTGGG + Intronic
1127395549 15:58541556-58541578 GGGTGTTGCTGGCATCTAGTTGG + Intronic
1127453786 15:59140141-59140163 GAGTGTCACTGGTATCCAGTGGG - Intronic
1127553666 15:60066173-60066195 GGCTATCAGTGGCAGCTGGTGGG - Intergenic
1127692560 15:61412474-61412496 TGGTGCTACTGGCATCTAGTGGG - Intergenic
1127903856 15:63361469-63361491 GGGTGCTACTAGCATCTAGTGGG + Intronic
1128220007 15:65962407-65962429 GGGTGCTACTGGCATCTAGTGGG + Intronic
1128224353 15:65991539-65991561 AGGTACTACTGGCATCTCGTGGG - Intronic
1128368189 15:67019640-67019662 AGGTGCCACTGGCATCTAGTGGG + Intergenic
1128673913 15:69595078-69595100 GGGTGCTACTGGCATCTAGAGGG - Intergenic
1128685236 15:69679522-69679544 GGGTACTCCTGGCATCCAGTGGG + Intergenic
1128855668 15:71012019-71012041 GGACATTACGGGCATCTAGTGGG - Intronic
1129945236 15:79533940-79533962 GTGTTCCACTGGCATCTAGTGGG + Intergenic
1130104359 15:80918432-80918454 GGGTTTTCCTGGCATCTAATAGG + Intronic
1130739375 15:86582081-86582103 GGGTGTTACCTGCATCTAGTGGG - Intronic
1130853155 15:87817772-87817794 AGGTGCTACTGGCATCTAGTGGG + Intergenic
1130919999 15:88335809-88335831 GGGTGCTACTGGCCTCTAGTAGG + Intergenic
1131212100 15:90506690-90506712 AGGTGCTACTGGCATCTAGTGGG + Intergenic
1131280673 15:91018660-91018682 GGGTTTTACTGGCATCTTGTGGG + Intronic
1131413346 15:92229794-92229816 GGGTCACACTGGAATATAGTTGG + Intergenic
1131496214 15:92913452-92913474 GGGTGTTACTGGCCTCTAGTGGG + Intronic
1131567173 15:93496783-93496805 GGTTGCAACTGGCATCTAGTAGG + Intergenic
1131659299 15:94497199-94497221 GGGTACTACTGGTGTCTAGTTGG - Intergenic
1131712464 15:95071009-95071031 GGTTGCTACTGGCATCTAGTGGG + Intergenic
1131958682 15:97765359-97765381 AGATATCACTGGCAGCCAGTGGG - Intergenic
1132162316 15:99554312-99554334 GGGTGCTACAGGCATCTAGTCGG - Intergenic
1132660758 16:1060547-1060569 GGGCACCACTGGCAGCCAGTGGG - Intergenic
1133379895 16:5321188-5321210 TGGTATTACTGGCATCTAGTGGG - Intergenic
1133421213 16:5648527-5648549 AGGTGGTACTGGCATCTAGTGGG + Intergenic
1133537182 16:6713516-6713538 GGGTTTTACTTGCATCTAGTGGG - Intronic
1133661684 16:7924332-7924354 GGGCAGTACTGGCATCTGGTGGG + Intergenic
1133703250 16:8329183-8329205 GGGTGCTACTGGCATCTAGTGGG - Intergenic
1133744763 16:8677640-8677662 GAGTGTCACTGGCATCTAGTGGG - Intronic
1133799716 16:9075160-9075182 GGGTATTACCAGCCTCTAGTGGG + Intergenic
1133815083 16:9190881-9190903 GAGTGCTACTGGCATCTAGTGGG + Intergenic
1133900536 16:9969741-9969763 GGGTATGACTGGCACCCAGTGGG + Intronic
1133984250 16:10656133-10656155 GGGTGCTACTGGCATCTAGTGGG - Intronic
1133987006 16:10676336-10676358 GGGAGCTACTGGCATCTAGTGGG - Intronic
1133997201 16:10757539-10757561 GGGTGCTACTGGCATCTTGTGGG - Intronic
1134028675 16:10974517-10974539 GGGTGCTACTGGCATCTAGCAGG - Intronic
1134029685 16:10981899-10981921 GGGTGCTACTGACATCTAGTGGG + Intronic
1134066498 16:11231903-11231925 GGGTACTACTGGTATCTAGTGGG + Intergenic
1134372801 16:13641160-13641182 AGGTGCTACTGGCATCTAGTGGG + Intergenic
1134416664 16:14049088-14049110 GGATACTACTGGCGTCTAGTGGG + Intergenic
1134423532 16:14116734-14116756 GAGGGTTACTGGCATCTAGTGGG - Intronic
1134467840 16:14494979-14495001 GGGAATCACTGGCATGAAGGTGG + Intronic
1134543703 16:15091083-15091105 GGGTGCTACTGGCATCTAGTGGG - Intronic
1134604870 16:15562623-15562645 GGTTGCTACTGGCATCTAGTGGG - Intronic
1134628825 16:15742054-15742076 GGGTGCCTCTGGCATCCAGTGGG + Intronic
1134689798 16:16183726-16183748 GGGTGCTGCTGGCATCTAGTGGG + Intronic
1134764494 16:16744792-16744814 CGGTGTTACTGGCATCCAGTAGG - Intergenic
1134779373 16:16881923-16881945 GAGTGCTACTGGCATCTAGTGGG - Intergenic
1134814564 16:17195158-17195180 GTGTGTTCCTGGCATCTAGTGGG + Intronic
1134829110 16:17309236-17309258 GGATGCTACTGGCATCTAGTGGG - Intronic
1134834765 16:17351806-17351828 GGATGCTACTGGCATCTAGTGGG - Intronic
1134835298 16:17356088-17356110 GTTTACAACTGGCATCTAGTAGG - Intronic
1134981563 16:18614422-18614444 CGGTGTTACTGGCATCCAGTAGG + Intergenic
1135057840 16:19245273-19245295 GGATGCTACTGGCATCTAGTGGG + Intronic
1135080224 16:19427718-19427740 GTGTGACATTGGCATCTAGTAGG - Intronic
1135164692 16:20128724-20128746 GGGTGATACTGGCATCTGGTGGG + Intergenic
1135337418 16:21615012-21615034 GGGTACTACTGCCATTTAGTGGG - Intronic
1135361286 16:21817230-21817252 GGGTGCTACTGGCATCTAGTGGG - Intergenic
1135422367 16:22313841-22313863 GGGTGCTTCTGGCATCTAGTAGG - Intronic
1135509996 16:23074226-23074248 AGGTGCTACTGGCATCTAGTGGG + Intronic
1135597833 16:23756745-23756767 GTGTGCTACTGGCATCTAGTGGG + Intronic
1136107339 16:28039372-28039394 GGGTGCCACTGGCATCTAGTTGG + Intronic
1136261242 16:29078167-29078189 GGGTGCTACTGGCATTTAGTGGG + Intergenic
1137551490 16:49440576-49440598 GGTTGCTACTGGCATCTAGTGGG - Intergenic
1137593746 16:49709966-49709988 GGTTGCTACTGGCATCTAGTGGG + Intronic
1137753731 16:50885512-50885534 GGGTGTTAATGGCATTTAGTGGG - Intergenic
1137789704 16:51164810-51164832 GGGTGCTACTGGCACCTAGTGGG + Intergenic
1137924563 16:52527916-52527938 GGGTGCTGCTGGCATCTAGTGGG + Intronic
1138000133 16:53269830-53269852 GCGTGTTACTGGCATCTAGTGGG + Intronic
1138052842 16:53799460-53799482 GCATATCCCTGGCATATAGTGGG + Intronic
1138628781 16:58276523-58276545 GGGTGCTGCTGGCATCTAGTAGG - Intronic
1138879377 16:60992058-60992080 GAGTGCTACTGGCATCTAGTGGG + Intergenic
1139097389 16:63721036-63721058 GGGTGCTAGTGGCATCTAGTGGG - Intergenic
1139270962 16:65682103-65682125 GGGTGCTACTGGCATCTAGTTGG + Intergenic
1139274709 16:65716741-65716763 GGGGTTCACTGGCATGTAGGTGG + Intergenic
1139283979 16:65794314-65794336 GGGTACTACTGGCATCTAGTGGG + Intergenic
1139557308 16:67720424-67720446 GGGTGCTACTGGCATCTACTGGG - Intergenic
1140041093 16:71408709-71408731 GGGTGCTACTGGTATCTAGTGGG + Intergenic
1140053167 16:71501133-71501155 GTGTGCTACTGGCATCTAGTGGG + Intronic
1140139206 16:72238867-72238889 GGGCGTTACTGACATCTAGTGGG + Intergenic
1140220382 16:73039537-73039559 AGGTGCTACTGGCATCTAGTGGG + Intronic
1140273926 16:73491781-73491803 GGGTGTCACTGACATCTAGTAGG + Intergenic
1140693827 16:77511927-77511949 GGGTGCTATTGGCATCTAGTGGG + Intergenic
1140732428 16:77868863-77868885 GGGTGCCACTGGCATCTAATGGG - Intronic
1140766467 16:78163980-78164002 GAGTCCTACTGGCATCTAGTGGG - Intronic
1140805388 16:78527828-78527850 AGGTGCTACTGGCATCTAGTGGG + Intronic
1140865404 16:79056613-79056635 GGATGCTACTGGCATCTAGTGGG - Intronic
1140971207 16:80014543-80014565 ATGTGTTACTGGCATCTAGTGGG - Intergenic
1140973458 16:80036187-80036209 GGGTACTACTGGCATCCAGCAGG - Intergenic
1141343257 16:83222970-83222992 TGGTGGTACTGGCATCTAGTGGG - Intronic
1141357119 16:83357620-83357642 GGGTACAACTGGCATCGAGCGGG + Intronic
1141360610 16:83392040-83392062 GGGTGTTACTGGCATTTAGTGGG - Intronic
1141439996 16:84024080-84024102 GGCTGTTACTGGCATGTAGTAGG - Intronic
1141484850 16:84331959-84331981 GGGTGCTTCTGGCATCTAGTGGG - Intergenic
1141656068 16:85417254-85417276 GAGTGCTACTGGCATCTAGTGGG - Intergenic
1141756123 16:85992158-85992180 GGGTACGACTGGCATCTAGTGGG - Intergenic
1141801903 16:86315449-86315471 GGGTATCACTGGGTTTTACTGGG + Intergenic
1142652455 17:1363955-1363977 GGGTGTTCCTAGCATCTAGTGGG - Intronic
1142903660 17:3028358-3028380 GGGTGCTACTGGCATCTAGTGGG + Intronic
1143221201 17:5263571-5263593 AGGTGTTACTGGCATCCAGTGGG + Intergenic
1143317846 17:6046119-6046141 AGGTGCTACTGGCATCTAGTGGG + Intronic
1143371302 17:6441818-6441840 GCATAGCACTGGCATCTGGTTGG + Intergenic
1143691013 17:8566079-8566101 GTGTGCCACTGGCATCTAGTTGG - Intronic
1143774883 17:9192529-9192551 GGGTGTCGCTGGCATCTAGTGGG + Intronic
1143872545 17:9967399-9967421 GGGTGCTACTGGCAACTAGTAGG - Intronic
1143965946 17:10756602-10756624 GGTTACTACTGGCATCTGGTGGG - Intergenic
1144392314 17:14805516-14805538 GGATGCTACTGGCATCTAGTGGG + Intergenic
1144738917 17:17570426-17570448 GGGTACTACTGACATCTAGTGGG + Intronic
1144827571 17:18114923-18114945 GGGAGTCATTGGCATCTAGATGG - Intronic
1145191252 17:20843197-20843219 GGGTTGCACTGGCATCTCATTGG + Intronic
1145758969 17:27414892-27414914 AGGTGCTACTGGCATCTAGTGGG - Intergenic
1146209544 17:30931335-30931357 GGGTGCTACTGGCATCTAATGGG + Intronic
1146479069 17:33189151-33189173 GGGTATTACCCACATCTAGTGGG + Intronic
1146573194 17:33970173-33970195 AGGTGCTACTGGCATCTAGTGGG - Intronic
1146677499 17:34783668-34783690 GGGTGTCCCTGGCTTTTAGTGGG - Intergenic
1146690938 17:34875595-34875617 GGGTGCTACTGGCACCTAGTGGG + Intergenic
1146720104 17:35118200-35118222 TGGTGCTACTGGCATCTAGTGGG + Intronic
1147046483 17:37755880-37755902 GGGTGCTACTGGCATCTAGTAGG + Intergenic
1148005003 17:44420495-44420517 TGATACTACTGGCATCTAGTAGG - Intronic
1148260520 17:46179096-46179118 GGGCACTACTAGCATCTAGTGGG - Intronic
1148533781 17:48420870-48420892 GGGTGCTCCTGGCATCTAGTGGG - Intronic
1148976678 17:51536015-51536037 AGGTACTACTGCCATCTAGTGGG + Intergenic
1149269852 17:54966546-54966568 GGGTGCTACTGGCATCTAATAGG - Intronic
1149683699 17:58522719-58522741 GGGTTTCCCTGGCTTCCAGTTGG - Intronic
1150434451 17:65143169-65143191 GGGTGCTCCTGGCATCTAGTGGG + Intronic
1150623043 17:66822768-66822790 AATTATCACTGGCATCTAGTGGG - Intergenic
1150623235 17:66823893-66823915 GGGTACTACTGGTATCTAGAGGG + Intergenic
1150926126 17:69534101-69534123 GGGTGTTACTGGCATCTAATAGG - Intronic
1150977170 17:70101191-70101213 GGGTCATACTGGCATCTAGTGGG + Intronic
1151033561 17:70771291-70771313 AGGTGCTACTGGCATCTAGTGGG + Intergenic
1151221472 17:72615978-72616000 GGGTGGTACTGGCATTTAGTTGG + Intergenic
1151433481 17:74080388-74080410 GGGTGTTTCTGGCATCAAGTGGG - Intergenic
1151474008 17:74335186-74335208 GGGTGCGACTGGCATCTAGTGGG + Intronic
1151614689 17:75201940-75201962 GGATGTTATTGGCATCTAGTGGG + Intergenic
1152351876 17:79788671-79788693 GGATGCCACTTGCATCTAGTGGG + Intergenic
1153568610 18:6445837-6445859 TGGTCTCACTGTCCTCTAGTGGG + Intergenic
1154264012 18:12863623-12863645 GGGTGCCACTGACATCTAATGGG - Intronic
1154286460 18:13061810-13061832 GGGTATTACTGACACCCAGTGGG - Intronic
1154943218 18:21135069-21135091 GCGTGTGACTGGCATCTAGTGGG + Intergenic
1156248714 18:35330060-35330082 GGGCACTACTGGCATTTAGTGGG - Intergenic
1156400398 18:36734355-36734377 AGGTGTTACTGGCATCTAATGGG - Intronic
1156917709 18:42481085-42481107 GTGTGTTACTGGCATCTAATGGG - Intergenic
1157364126 18:47048074-47048096 CTGTCACACTGGCATCTAGTGGG + Intronic
1157425717 18:47582667-47582689 GGGTGCCACTGGCATCTAGAGGG - Intergenic
1157738329 18:50070495-50070517 GGGTCCTACTGGCATCTAGTAGG + Intronic
1157775393 18:50391470-50391492 GGGTGCTCCTGGCATCTAGTAGG + Intronic
1157805952 18:50657708-50657730 GGGTGTGACTGGCATCTAGGAGG + Intronic
1157864418 18:51168523-51168545 GTGTACTACTGACATCTAGTGGG + Intergenic
1157874350 18:51258568-51258590 GGGTGTGACTGGCATCGAATGGG + Intergenic
1158068391 18:53441028-53441050 AGATATTACTGGCATCCAGTGGG - Intronic
1158137403 18:54223369-54223391 GTGTGATACTGGCATCTAGTGGG - Intronic
1158283552 18:55853461-55853483 TGGTAATACTGGCATCTAGTGGG - Intergenic
1158392113 18:57052377-57052399 GGGTGCTACTGGCATCTAGTGGG - Intergenic
1158395364 18:57075289-57075311 GGGTGCCACTGGCATCTAGTGGG - Intergenic
1158902215 18:61974490-61974512 GGGTGCTACTGGCATCTAGTGGG + Intergenic
1159019406 18:63131030-63131052 GGGTGCTACTGGTATCTAGTGGG + Intronic
1159058121 18:63486704-63486726 GGATGCCACTGGCATCTAGTAGG + Intronic
1159294785 18:66470809-66470831 GGTTGGCACTGGCATCTGGTAGG - Intergenic
1160384045 18:78483679-78483701 GGGTGCTACTGGCATCTGGTGGG + Intergenic
1160565778 18:79785976-79785998 GGGTCCCACTGGCATCAAGCGGG + Intergenic
1160600002 18:80005252-80005274 GGCCACCACTGGCATCTGGTGGG - Intronic
1160994947 19:1878227-1878249 GGGTTGCACTGGCATCTCATTGG - Intronic
1161145887 19:2677808-2677830 GGGTGTCCCTGGCATAGAGTGGG + Intronic
1161816934 19:6504949-6504971 GTGCACTACTGGCATCTAGTGGG + Intergenic
1161939135 19:7391751-7391773 GGGAGCCACTGGCATCTAGGAGG + Intronic
1162046560 19:8004496-8004518 GGATACTGCTGGCATCTAGTGGG + Intronic
1162180305 19:8864346-8864368 GGGTGCAACTGGCACCTAGTGGG - Intronic
1162339699 19:10085267-10085289 GGGAACCACTGGCATCTAGTGGG + Intergenic
1162404454 19:10465192-10465214 GGATACTTCTGGCATCTAGTGGG - Intronic
1162563691 19:11433250-11433272 GTCTGCCACTGGCATCTAGTGGG - Intronic
1162793021 19:13072720-13072742 GGGTGCTACTGTCATCTAGTGGG + Intronic
1162834211 19:13305623-13305645 GGGTGCTACTGGCATCTGGTGGG - Intronic
1162997604 19:14346170-14346192 GGGTACTCCTGGCATTTAGTGGG + Intergenic
1163044202 19:14627162-14627184 GGTTTCTACTGGCATCTAGTTGG - Intronic
1163275191 19:16279183-16279205 GGATGTTACTGGCATCTGGTGGG + Intergenic
1163336107 19:16672913-16672935 TGGTGCCACTGTCATCTAGTGGG + Intronic
1163381103 19:16969345-16969367 GAGTGTGACTGACATCTAGTGGG + Intronic
1163382820 19:16979950-16979972 TGGTACTACTGGCATCTGGTGGG + Intronic
1163435640 19:17293553-17293575 GGGTACTACTGGCATCTAGTGGG - Intronic
1163683192 19:18695523-18695545 GGGTGCTACTGGCATCCAGTGGG + Intronic
1164694413 19:30232845-30232867 GGGTGCTACTGGCATCTAGTGGG - Intronic
1164793675 19:31009017-31009039 GGGGGCTACTGGCATCTAGTGGG + Intergenic
1165652091 19:37500463-37500485 GGATACTACTGGCATCTAGTGGG - Intergenic
1165707580 19:37987528-37987550 TGCTGTTACTGGCATCTAGTGGG - Intronic
1166476581 19:43131052-43131074 GGGTGCAACTGGCATCTAGTGGG + Intronic
1167677700 19:50897762-50897784 GGGTGCTACTGGCATCTAGTGGG - Intergenic
1168214824 19:54917728-54917750 GGGTTCTACTGGCATCTGGTAGG + Intergenic
1168300689 19:55403098-55403120 GGGTGCCACTAGCATCTAGTGGG - Intronic
1168665338 19:58200868-58200890 GGGTGGCACTGGCATCTGGTTGG + Intronic
925543555 2:4992402-4992424 GGGTGCTACTGGCATCTAGTGGG - Intergenic
925575202 2:5352929-5352951 GGATGCTACTGGCATCTAGTGGG - Intergenic
925634480 2:5929675-5929697 GGATGTTACTGGCATCTAGTGGG + Intergenic
925847718 2:8048877-8048899 GGGTGTCAGTGGCATCTGCTTGG - Intergenic
925953973 2:8942897-8942919 GGGTGCTACTGGCATCTAGGTGG + Intronic
926271427 2:11369589-11369611 CGCTAACACTGGCACCTAGTAGG - Intergenic
926622335 2:15058279-15058301 GAGTGTTACTGGCAGCTAGTGGG + Intergenic
926666050 2:15524434-15524456 GGGTCTGACTGGCATGTTGTAGG + Intronic
926753127 2:16215168-16215190 TGGTACCACTGTCATATAGTCGG - Intergenic
926963033 2:18379779-18379801 GAGTGTTGCTGGCATCTAGTGGG + Intergenic
926974287 2:18497685-18497707 AGGTACTACTGGAATCTAGTGGG - Intergenic
927346877 2:22054671-22054693 TTGTATCCCTGGCATCTAGCAGG - Intergenic
927646703 2:24881851-24881873 GGGTGCTACTGGCCTCTAGTGGG + Intronic
928175810 2:29033668-29033690 GGGTATCGCTGAGACCTAGTTGG + Intronic
928513467 2:32023008-32023030 GGGTTCTACTGGCATCTAGTGGG - Intronic
928621186 2:33089458-33089480 GGGTCCTACTGGCATCTAGTGGG + Intronic
929642131 2:43592546-43592568 GGGTGCCACTGGCATCTAGTGGG - Intronic
930002163 2:46868855-46868877 GGGTGCTACTGGCATCTAATGGG + Intergenic
930247845 2:49003364-49003386 GGATGTCAGTGGAATCTAGTGGG + Intronic
931225970 2:60332607-60332629 GGATGCTACTGGCATCTAGTGGG + Intergenic
931286527 2:60836483-60836505 GGCTGCTACTGGCATCTAGTGGG - Intergenic
931656880 2:64517592-64517614 GGCTACAACTGGCATCTAGTAGG - Intergenic
931703186 2:64925217-64925239 GGGTGCTACTGGCATCCAGTGGG + Intergenic
931775147 2:65533921-65533943 AGGTACTAATGGCATCTAGTGGG + Intergenic
931796917 2:65720099-65720121 GTGTGCTACTGGCATCTAGTGGG + Intergenic
931939578 2:67237478-67237500 GGGCACTACTGGCATCTAGTGGG - Intergenic
931939747 2:67239021-67239043 GGGTACTACAGGCATCTAGTGGG + Intergenic
931980113 2:67685534-67685556 GGGTGCTACTGGCATCTAGCAGG + Intergenic
932112620 2:69014295-69014317 GGATGTTACTGGCATCCAGTGGG - Intronic
932638345 2:73413535-73413557 GACTATTACTGGTATCTAGTGGG - Intronic
933038876 2:77435078-77435100 GAGTTCTACTGGCATCTAGTGGG - Intronic
933209126 2:79545683-79545705 GGAAATCACTGACACCTAGTGGG - Intronic
933222320 2:79705058-79705080 GGGTGCTACAGGCATCTAGTGGG + Intronic
933262344 2:80144936-80144958 AGGTGTTACTTGCATCTAGTGGG - Intronic
933339713 2:81007287-81007309 GGTTACTACTGGCATCTAGTGGG - Intergenic
933351618 2:81159666-81159688 GGGCATCATTGTTATCTAGTAGG - Intergenic
933503482 2:83146818-83146840 GGGCGCTACTGGCATCTAGTGGG - Intergenic
934064435 2:88327563-88327585 GGGTACAACTGGCATCTAGTAGG - Intergenic
935080685 2:99790626-99790648 GGGTGCTACTGGCATCAAGTGGG + Intronic
935787507 2:106562106-106562128 GCGTACTACTGGCATCCAGTGGG + Intergenic
935795784 2:106640491-106640513 GGCTACCACTGACATCCAGTGGG + Intergenic
936959850 2:118061582-118061604 GGGTGCTACTGACATCTAGTGGG + Intergenic
937236842 2:120436359-120436381 GGACATCCCTGGCAGCTAGTAGG + Intergenic
937256198 2:120557565-120557587 GGGTTATACTGGTATCTAGTGGG + Intergenic
937347971 2:121139073-121139095 GGATGCCACTGGCCTCTAGTGGG + Intergenic
937651062 2:124319733-124319755 AGGTGCTACTGGCATCTAGTGGG - Intronic
937850021 2:126623641-126623663 AGGTGCCACTGGCATCTTGTGGG + Intergenic
938743661 2:134257060-134257082 AGCTGTTACTGGCATCTAGTGGG - Intronic
939635413 2:144576088-144576110 GGGTCCTATTGGCATCTAGTAGG + Intergenic
939658328 2:144855114-144855136 GGACATTACTGGCATCTAGTGGG + Intergenic
939732739 2:145805025-145805047 GGGTGCTACTGGCATCCAGTAGG + Intergenic
939900936 2:147848427-147848449 GTGTGCTACTGGCATCTAGTTGG + Intronic
939967582 2:148625568-148625590 GGATGCTACTGGCATCTAGTGGG + Intergenic
941174321 2:162178451-162178473 GAGTGCTACTGGCATCTAGTGGG - Intronic
942114820 2:172717845-172717867 GGAGCTCACTGGCCTCTAGTAGG + Intergenic
943282529 2:185955062-185955084 TGGTACAACTGGCATCTAGATGG + Intergenic
943474844 2:188341173-188341195 TCCTATCACTGGCATCTACTTGG + Intronic
943592623 2:189817089-189817111 GGATGCTACTGGCATCTAGTGGG + Intronic
943818432 2:192286285-192286307 TGGTGCTACTGGCATCTAGTGGG + Intergenic
944127934 2:196315411-196315433 GGGTGCTACTGGCATTTAGTGGG - Intronic
944370785 2:198981036-198981058 GGATGCTACTGGCATCTAGTAGG + Intergenic
944651850 2:201838267-201838289 GGGTATCACTGGCATCTAGTGGG + Intronic
944826078 2:203484432-203484454 TGCTACTACTGGCATCTAGTGGG - Intronic
944926692 2:204472608-204472630 GGATGTTACTGGCATCTAGTGGG + Intergenic
945067117 2:205956583-205956605 GGGTGCCACTGGCATCTAGTAGG + Intergenic
945608189 2:211963214-211963236 GGGTGATACTGGCATCTAGTGGG + Intronic
946540356 2:220677420-220677442 GATTGTTACTGGCATCTAGTGGG + Intergenic
946665114 2:222041454-222041476 TGGTGCTACTGGCATCTAGTGGG - Intergenic
946736038 2:222755512-222755534 AGATGTTACTGGCATCTAGTAGG + Intergenic
947012872 2:225584968-225584990 GGGTGTTACTGACATCTATTGGG + Intronic
947140559 2:227016139-227016161 GGTCATTACTGGCATCTAGCAGG + Intronic
947339948 2:229127670-229127692 AAGTATTAATGGCATCTAGTGGG - Intronic
947374798 2:229484666-229484688 AGGTGTGACTGGCATCTAGTAGG + Intronic
947495951 2:230637219-230637241 GGGTGCTACTGGCATCTAGTAGG - Intergenic
947522031 2:230853726-230853748 GTGTGTCACTGGGCTCTAGTGGG - Intergenic
947551129 2:231047589-231047611 GGGCACCCCTGGCATCTAGTGGG + Exonic
947940030 2:234045635-234045657 GGGTTCTACTGACATCTAGTAGG - Intergenic
948136297 2:235638912-235638934 AGATGTTACTGGCATCTAGTAGG - Intronic
948974969 2:241458388-241458410 GGGTAGCCCTGGCATCTGGAAGG - Intronic
1169524792 20:6412709-6412731 GGGTGCTACTGGCATGTAGTGGG - Intergenic
1169666190 20:8038972-8038994 AGGTGGAACTGGCATCTAGTGGG - Intergenic
1172124448 20:32616998-32617020 GGGTGCTACTGGCATCTAGTGGG - Intergenic
1173015637 20:39223045-39223067 GGCTGTTACTGGAATCTAGTGGG - Intergenic
1173347906 20:42217715-42217737 GGGAACTACTGGCATCTAGAGGG - Intronic
1173426360 20:42946892-42946914 GGGTGATCCTGGCATCTAGTGGG - Intronic
1173477712 20:43373631-43373653 GGGTGTTCCTGGCATTTAGTGGG + Intergenic
1173507940 20:43603431-43603453 AGGTACAACTGGCATCTAGTAGG + Intronic
1173758667 20:45540441-45540463 TAGTATCCCTGGCATCCAGTGGG + Intronic
1173824986 20:46042538-46042560 GGGTGTACCTGGCATCTAGTAGG + Intronic
1173861309 20:46285461-46285483 GGCTGCTACTGGCATCTAGTGGG + Intronic
1173862040 20:46290353-46290375 GGGTGCTGCTGGCATCTAGTGGG + Intronic
1173928131 20:46796121-46796143 GGGTGCTACTGGCATCTAGTGGG + Intergenic
1173965544 20:47109810-47109832 GGATACTACTGGCATCTAGTGGG + Intronic
1174012827 20:47464281-47464303 GGGTGCTACTGGCATTTAGTGGG + Intergenic
1174103243 20:48143301-48143323 GGGTGCTACTGGCATCTAGTGGG - Intergenic
1174120760 20:48263565-48263587 GAGTGTTACTGGCATCCAGTGGG + Intergenic
1174203100 20:48820719-48820741 GGGTCCTACTGGCATCTGGTAGG + Intronic
1174204740 20:48830027-48830049 GAGTGCTACTGGCATCTAGTGGG - Intergenic
1174301415 20:49585231-49585253 GAGTGTTAATGGCATCTAGTGGG - Intergenic
1174525258 20:51165373-51165395 GGGCGCCACTGGCATCTGGTGGG - Intergenic
1174548150 20:51341933-51341955 GAGTGTTACTGGTATCTAGTGGG + Intergenic
1174605299 20:51757074-51757096 GGATGGCACTGGCATCTAGTGGG + Intronic
1174646684 20:52092300-52092322 GGGTTCTACTGGCATCTGGTGGG - Intronic
1174671813 20:52315225-52315247 GAGTGCTACTGGCATCTAGTGGG + Intergenic
1174688788 20:52481977-52481999 GGGTGTTACTGGCATCTAGTGGG + Intergenic
1174703768 20:52635330-52635352 GAGGGTGACTGGCATCTAGTGGG - Intergenic
1174706209 20:52658778-52658800 GGGTACTGCTGGCATCTAGTGGG + Intergenic
1174723100 20:52834655-52834677 GGGTGCTACTGGCATCTAGTGGG - Intergenic
1174735303 20:52960375-52960397 GGTTGCTACTGGCATCTAGTGGG - Intergenic
1174763163 20:53226764-53226786 GGGTGCTACTGGCATCTAGTGGG - Intronic
1174764434 20:53239143-53239165 AGGTGCTACTGGCATCTAGTGGG - Intronic
1174828069 20:53787072-53787094 AGGTGCTACTGGCATCTAGTGGG - Intergenic
1174917473 20:54668731-54668753 GGGTGCTACTGCCATCTAGTGGG - Intergenic
1175052430 20:56167704-56167726 GGGTGCTCCTGGCATCTAGTGGG + Intergenic
1175057142 20:56208785-56208807 GGGTGATCCTGGCATCTAGTGGG + Intergenic
1175105695 20:56613251-56613273 GGGTGCCCCTGGCATCTAGTGGG - Intergenic
1175135366 20:56819400-56819422 GGGTGTTACTGGCATAGAGTGGG - Intergenic
1175158413 20:56990034-56990056 GGGTGCCACTGGCATCTTGTGGG - Intergenic
1175201992 20:57284334-57284356 GGGTGCTACTGGCATTTAGTGGG + Intergenic
1175229939 20:57467353-57467375 GGGTGTTGTTGGCATCTAGTGGG + Intergenic
1175261981 20:57680412-57680434 GGGTGTTACTAGCATCCAGTGGG + Intronic
1175306158 20:57977062-57977084 GGGTGCTCCTGGCATCTAGTGGG - Intergenic
1175423251 20:58849138-58849160 GGATGCTACTGGCATCTAGTGGG + Intronic
1175446857 20:59027254-59027276 GGGTATTACTGGTATATAGATGG - Exonic
1175446868 20:59027335-59027357 GGGTATTACTGGTATATAGATGG - Exonic
1175657155 20:60780927-60780949 GGGAGCTACTGGCATCTAGTGGG - Intergenic
1175663565 20:60838655-60838677 GGGCACCACTGGCATCTAGTGGG - Intergenic
1175694757 20:61093462-61093484 GGGTGCTACTGGCATCTAGTGGG - Intergenic
1175770762 20:61622757-61622779 GGGTGCTACTGGCATCTACTGGG - Intronic
1176657543 21:9601479-9601501 GGATACTACTGGCATCTAGCAGG - Intergenic
1176958166 21:15129863-15129885 GGGTTCTACTAGCATCTAGTGGG + Intergenic
1177424339 21:20903154-20903176 AGGTGTAACTGTCATCTAGTGGG + Intergenic
1177749407 21:25261935-25261957 GGATGTTACTGGCATCTAGTGGG - Intergenic
1178024579 21:28451851-28451873 GGGTGCTACTGGCATCTAGTGGG - Intergenic
1178221151 21:30661566-30661588 GGGTGTTACTGGTATCTAATGGG + Intergenic
1178371970 21:32033899-32033921 GGGTGCTACTGGCATCTAGTAGG - Intronic
1178390480 21:32193960-32193982 GGGTACCACTGGCCTCTCGTGGG - Intergenic
1178473548 21:32916960-32916982 GGGTGTGAATGGCACCTAGTAGG + Intergenic
1178530517 21:33372082-33372104 AGGTGCTACTGGCATCTAGTGGG + Intergenic
1178772820 21:35521465-35521487 GGGTGCTACTGGCCTCTAGTGGG + Intronic
1178906451 21:36641053-36641075 GGGTGCTACTGGCATCTAGTGGG - Intergenic
1178944407 21:36934276-36934298 GGGTGATACTGGCATCCAGTGGG + Intronic
1179117967 21:38511846-38511868 AGGTGTTACTGGCATCTAGTGGG - Intronic
1179287221 21:39987999-39988021 GGGCATCCCTGACATCTGGTCGG - Intergenic
1179342039 21:40521186-40521208 GGGTGGTACTGACATCTAGTGGG + Intronic
1179440934 21:41393702-41393724 GGGAGTCACTGGCATGTAGATGG - Intronic
1180692366 22:17727865-17727887 GGGTGCCACTGGCATCTAGTGGG - Exonic
1181121003 22:20668761-20668783 GGGTTGCACTGGCATCTCATTGG - Intergenic
1181333970 22:22115787-22115809 GGGTTGCACTGGCATCTCATTGG - Intergenic
1181493136 22:23273239-23273261 GGGTGCTACTGGCATCTAATGGG + Intronic
1182227326 22:28809119-28809141 GGGTGCCACTGGCATCTGGTGGG - Intergenic
1182262103 22:29080785-29080807 AGGTACTACTGGCATCTAGCCGG + Intronic
1182653124 22:31868282-31868304 TAGTATTACTGGCATCAAGTGGG + Intronic
1183080809 22:35454873-35454895 GGATGCTACTGGCATCTAGTGGG - Intergenic
1183196521 22:36357486-36357508 GGGTGCGACTGGCATCTAGTGGG - Intronic
1183223630 22:36533706-36533728 GCGTATCACTGGCATAGAGTAGG + Intergenic
1183296213 22:37031027-37031049 CAGTGTTACTGGCATCTAGTGGG - Intergenic
1183396735 22:37575958-37575980 GGGTGTCACTGACATCCAGTGGG - Intronic
1183523295 22:38309087-38309109 GGGGTGCCCTGGCATCTAGTGGG - Intronic
1184394594 22:44225650-44225672 GGGAGTCACTGGCATCTGGAGGG - Intergenic
1184639746 22:45864141-45864163 GGATGTCACTGACATTTAGTGGG + Intergenic
949355562 3:3177032-3177054 GAGTCCTACTGGCATCTAGTGGG + Intronic
949738240 3:7199630-7199652 GGCTTCCACTGGCATCTAGTTGG + Intronic
949851123 3:8421462-8421484 GGTTGCTACTGGCATCTAGTGGG + Intergenic
949952125 3:9238031-9238053 GGATGCTACTGGCATCTAGTGGG + Intronic
949974123 3:9438823-9438845 GAGTGTTACCGGCATCTAGTGGG - Intronic
950499438 3:13354399-13354421 GGTTGCCACTGGCATCTACTCGG + Intronic
950689256 3:14642658-14642680 AGCTAGTACTGGCATCTAGTGGG + Intergenic
950697671 3:14716107-14716129 GGATACTACTGGAATCTAGTGGG - Intronic
950945078 3:16937042-16937064 GGGTGTTACTGGCATTTAGTGGG - Intronic
951011485 3:17686810-17686832 GAGAATTACTGACATCTAGTGGG + Intronic
951061062 3:18207948-18207970 GGGTGCTGCTGGCATCTAGTGGG + Intronic
951110051 3:18792591-18792613 GTCTATTACTGGCATCTACTGGG + Intergenic
951153122 3:19316276-19316298 GGGTATTACTGGCATTTAGTGGG - Intronic
951156413 3:19359629-19359651 GGGTGCTACTGGCATTTAGTGGG - Intronic
951403431 3:22263801-22263823 GGGTGCTCCTGGCATCTAGTGGG + Intronic
951585440 3:24210486-24210508 GTGTGTTACTGGCATCTAGTGGG + Intronic
951592082 3:24277255-24277277 GGGTGCCACGGGCATCTAGTGGG + Intronic
951622067 3:24613320-24613342 ATGTACTACTGGCATCTAGTGGG - Intergenic
951781625 3:26369711-26369733 GGGTGGTACTGGCATATAGTGGG + Intergenic
952161170 3:30694873-30694895 GGGTGCTACTGGCATCTAGTGGG - Intergenic
952322658 3:32292745-32292767 TGCTACTACTGGCATCTAGTAGG - Intronic
952755017 3:36858275-36858297 GAGTGTCACTGGCAGCTAGCAGG + Intronic
953016311 3:39080179-39080201 GGGTATTACTGGCAACTACTGGG - Intronic
953144340 3:40260633-40260655 TGCTGCCACTGGCATCTAGTGGG + Intergenic
953156869 3:40383574-40383596 GGATGTTACTGGCAACTAGTAGG + Intergenic
953682171 3:45047767-45047789 GGGTATTGCTGGCGTCTAGCGGG - Intergenic
953954506 3:47220868-47220890 GGATGCTACTGGCATCTAGTGGG + Intergenic
954422945 3:50428183-50428205 GTGTACTGCTGGCATCTAGTGGG + Intronic
954998634 3:54905687-54905709 GGATGCTACTGGCATCTAGTGGG + Intronic
955057171 3:55465160-55465182 GGATGTTATTGGCATCTAGTGGG + Intergenic
955149656 3:56354446-56354468 GGGTGCTAATGGCATCTAGTAGG + Intronic
955196450 3:56808823-56808845 GGGTGCCATTGGCATCTAATAGG + Intronic
955219423 3:57011488-57011510 GGGTGCTACTGGAATCTAGTGGG + Intronic
955254068 3:57311622-57311644 GGGTGTTACTGGCATCTATTGGG + Intronic
955354097 3:58216171-58216193 GGATGTGATTGGCATCTAGTGGG - Intergenic
955533136 3:59895088-59895110 AGGTGTTTCTGGCATCTAGTGGG + Intronic
955577627 3:60383460-60383482 GAGTGCTACTGGCATCTAGTGGG + Intronic
955620733 3:60861450-60861472 GGTTACTACTGGCATCTAGCAGG - Intronic
955675876 3:61448588-61448610 AGAGATGACTGGCATCTAGTGGG + Intergenic
955685557 3:61545180-61545202 GGCTGCTACTGGCATCTAGTGGG + Intergenic
955936633 3:64108918-64108940 ATGTGTGACTGGCATCTAGTGGG - Intronic
956100047 3:65758641-65758663 GGATGCTACTGGCATCTAGTGGG + Intronic
956229104 3:66993263-66993285 GGGTGCTACTGGCACCTAGTGGG + Intergenic
956349511 3:68319425-68319447 GAGGCTTACTGGCATCTAGTGGG + Intronic
956375873 3:68613201-68613223 GGGTGCTCCTGGCATCTAGTGGG - Intergenic
956381980 3:68674077-68674099 GGGTACCATTGGCATCTGGTGGG + Intergenic
956493739 3:69802203-69802225 GGGTGTTACTGGCATCTCCTGGG + Intronic
956547753 3:70424826-70424848 GGGTGCTACTGGCATGTAGTGGG - Intergenic
956663824 3:71623854-71623876 AGGTATGACTGGCAACTAGTAGG - Intergenic
956776407 3:72568992-72569014 GAGTGCCACTGGCATCTAGTGGG - Intergenic
956822393 3:72965709-72965731 GGCTGCTACTGGCATCTAGTGGG - Intronic
956934288 3:74082229-74082251 GGGTGCTACTGGAATCTAGTAGG + Intergenic
957025772 3:75180045-75180067 TGGTATCACTGGCATCTACCAGG - Intergenic
957230441 3:77506587-77506609 GGGTGCTACTGGCATCTAGTGGG + Intronic
957953986 3:87160428-87160450 GGTTGCCACTGGCATCTAGTGGG + Intergenic
958602835 3:96320634-96320656 GGGCATCACTAGCATATATTTGG + Intergenic
958795897 3:98705881-98705903 AGGCACTACTGGCATCTAGTGGG + Intergenic
958813130 3:98885886-98885908 GGGTGTTATTGGCATCTAGTAGG + Intronic
959968882 3:112385831-112385853 GGGTGTTACTGGCATCTAACAGG + Intergenic
960371826 3:116850227-116850249 GGGTGTTTCTGGCATCTAGTGGG + Intronic
960700027 3:120430237-120430259 GGGAATCACAGCCATCTGGTAGG + Intronic
960704829 3:120471998-120472020 GGTTACTACTGGCATCTAGGTGG - Intergenic
960984631 3:123268035-123268057 GGGATTCATTGCCATCTAGTGGG + Intronic
961234619 3:125355391-125355413 GGGTTCCACTGGCATCTAGTGGG - Intronic
961238863 3:125392534-125392556 GGGCATTACTGGCATCTAGTGGG + Intergenic
961608577 3:128117411-128117433 GGGTGCTACTGGCATCTAGTGGG - Intronic
961628398 3:128279368-128279390 GGGTGCTATTGGCATCTAGTGGG - Intronic
961733593 3:128985913-128985935 GGCTACTACTGGCAGCTAGTGGG + Intronic
961930857 3:130531325-130531347 GGGTGCCACTGACATCTAGTGGG - Intergenic
961937696 3:130603279-130603301 GGGTGTTACTGGCAGCTAATGGG - Intronic
961973315 3:130993579-130993601 GGATGTTACTGGCACCTAGTGGG - Intronic
962081617 3:132145359-132145381 GGGTACTACTGGCATGTAGCAGG - Intronic
962216238 3:133524453-133524475 GGGTGATACTGGCATCTAGTGGG - Intergenic
962279040 3:134036393-134036415 GGGTATGACCTGAATCTAGTTGG - Intronic
962515031 3:136142287-136142309 GGGTCCTACTGGCATCTAGTGGG - Intronic
962827283 3:139109014-139109036 TGGTATCAGTGGCATCAAGTTGG + Intronic
962865347 3:139443965-139443987 GGGTGCTACTGGCATCTAGTAGG - Intergenic
962876761 3:139541220-139541242 GGGTGCCACTGGGATCTAATGGG - Intergenic
963166656 3:142211203-142211225 GGGTGCTACTGACATCTAGTGGG + Intronic
963222098 3:142824304-142824326 GGGTATTGCTAGCATCTAGTGGG + Intronic
963574477 3:147042750-147042772 AGGTGCTACTGGCATCTAGTGGG - Intergenic
963579073 3:147101120-147101142 GGGTGCTACTGTCATCTAGTGGG - Intergenic
963650615 3:147975301-147975323 GAGTACTACTGGTATCTAGTGGG - Intergenic
963709288 3:148727986-148728008 GGGTATTACTAGCATCTAGCAGG - Intronic
963952645 3:151220117-151220139 GTGGGTTACTGGCATCTAGTAGG - Intronic
964609493 3:158596111-158596133 GCATATAACTAGCATCTAGTGGG - Intronic
964742591 3:159983241-159983263 GGTTGCCACTGGCATCTAGTGGG - Intergenic
965011628 3:163100575-163100597 GAGTATTATTGGTATCTAGTGGG - Intergenic
966081328 3:176005495-176005517 AGTTGTTACTGGCATCTAGTGGG + Intergenic
966446885 3:180010389-180010411 GGGTGCTAGTGGCATCTAGTGGG + Intronic
966510675 3:180759136-180759158 GGATATTACTGGCATCTAGTGGG - Intronic
966554053 3:181238849-181238871 TGGTGCCACTGGCATCTAGTGGG + Intergenic
967232778 3:187356387-187356409 TGGTGTTACTGACATCTAGTGGG + Intergenic
967245634 3:187483787-187483809 GGGTTGTACTGGCATCTAGTTGG + Intergenic
967706449 3:192656550-192656572 GGGTGCTACTGGCATCCAGTGGG + Intronic
967892254 3:194371770-194371792 GGGTACTGCTGGCATCTAGAGGG - Intergenic
968311970 3:197691435-197691457 GGTTACCACTGGCATCTAGTAGG + Intronic
968835403 4:2960314-2960336 GAGTGTCACTGGCTTCTAGCAGG + Intronic
969185728 4:5472945-5472967 AGGTGTTACTGGTATCTAGTAGG - Intronic
969501845 4:7558328-7558350 GGGTACTATTGGCATCTAGTGGG - Intronic
969864510 4:10065509-10065531 GGGTACTACTGGCATCTAATGGG + Intergenic
969986895 4:11221710-11221732 AGGTGTTACTGGCATCTAGTGGG - Intergenic
970510461 4:16776956-16776978 GGGTGTTATTGGCCTCTAGTGGG - Intronic
970569155 4:17362677-17362699 GAGTATTACTGGCATCTAGTGGG - Intergenic
970606363 4:17685723-17685745 AGGTACTACTGGCATCTCGTGGG + Intronic
971176476 4:24287164-24287186 TGGTAATACTGGCATCTAGTAGG - Intergenic
971373958 4:26041253-26041275 AGGTGTTACTGGAATCTAGTGGG + Intergenic
971582355 4:28358184-28358206 GGCTGCTACTGGCATCTAGTGGG - Intergenic
972259324 4:37392480-37392502 GGTTAGTATTGGCATCTAGTGGG - Intronic
972696350 4:41450398-41450420 TGGGGTCACTGGCATATAGTTGG + Intronic
972749880 4:41978161-41978183 GGATACTACTGGCATCGAGTGGG - Intergenic
972871900 4:43310721-43310743 GAGTACTACTGGCATCTATTTGG + Intergenic
972994439 4:44863187-44863209 GGAAGTCACTGGCATTTAGTGGG - Intergenic
973217617 4:47688007-47688029 AGGTGCTACTGGCATCTAGTGGG - Intronic
973576721 4:52297139-52297161 GGATACTACTGGCATCTAGAGGG - Intergenic
973895586 4:55409611-55409633 GGGAACTACTGGCATCTAGTGGG - Intronic
973988631 4:56380823-56380845 GGGTGCTACTGGCATCTGGTGGG - Intronic
974552234 4:63392369-63392391 GGATACCACTTGCATCCAGTAGG - Intergenic
975235384 4:71989547-71989569 ACTTGTCACTGGCATCTAGTGGG + Intergenic
975776476 4:77792949-77792971 GGGTGCTACTGGAATCTAGTAGG + Intronic
975885485 4:78959584-78959606 GGGTTTTATTGACATCTAGTGGG + Intergenic
976013739 4:80524438-80524460 AGTTACTACTGGCATCTAGTAGG - Intronic
976215446 4:82711345-82711367 GGGTGTTACTGGCATCTAGTGGG + Intronic
976912768 4:90327739-90327761 GGGTCCCACTGGCATTTATTAGG - Intronic
977564081 4:98563850-98563872 AGGGTGCACTGGCATCTAGTGGG + Intronic
978150990 4:105434472-105434494 AGGTATTACTAGCATCTAGTAGG + Intronic
978156658 4:105497093-105497115 GGGTACTACTGACATCTAGTGGG - Intergenic
978758432 4:112329087-112329109 GTGAAGCACTGGCATATAGTAGG + Intronic
979438114 4:120719149-120719171 GTGTACTACTGACATCTAGTGGG - Intronic
979604139 4:122618970-122618992 GGGTGCTACTGGCATCTAGTAGG - Intronic
980057141 4:128089130-128089152 GGGTGCTACTGGCATCTAGTGGG + Intronic
981319572 4:143375845-143375867 GTGCACTACTGGCATCTAGTGGG - Intronic
981472695 4:145154762-145154784 GGGTGCTACTGACATCTAGTGGG - Intronic
981519263 4:145644874-145644896 GGGTGCTACTGGCATCTACTGGG - Intronic
982011890 4:151113567-151113589 AGGTGCTACTGGCATCTAGTGGG - Intronic
982028028 4:151271518-151271540 AGGTATTACTGGCATTTAATAGG + Intronic
982174161 4:152689727-152689749 TGGTGCTACTGGCATCTAGTGGG + Intronic
982258067 4:153468704-153468726 GAGTGCCACTGGCATCTAGTGGG - Intronic
982435459 4:155379577-155379599 GGGTGCTACTGGCATCTAGTGGG - Intergenic
982691657 4:158554051-158554073 GGTTGCTACTGGCATCTAGTAGG - Intronic
982747823 4:159123425-159123447 GTGTTTCACTGGCTTCTGGTTGG + Intronic
982963364 4:161869609-161869631 GAGTGTTACTGGCATCTAATAGG + Intronic
983573388 4:169234240-169234262 ATGTACCACTGGCATCTAGTGGG + Intronic
984191948 4:176616408-176616430 GGGTGCCACTGACATCTAGTTGG - Intergenic
984538611 4:181008471-181008493 AGGAATCACAAGCATCTAGTTGG + Intergenic
984630102 4:182052022-182052044 GGGTATTACTGGCCTCCAGCAGG + Intergenic
984988508 4:185354449-185354471 GGGTGCTACTGGCATCTAGCAGG + Intronic
985417870 4:189754609-189754631 GGATACTACTGGCATCTAGCAGG + Intergenic
985677823 5:1241396-1241418 GGGTGTGCCTGGCATCCAGTGGG + Intronic
986130803 5:4928218-4928240 GGGTGTTATTGACATCTAGTAGG - Intergenic
986302233 5:6486840-6486862 GGGTGCCACTAGCATCTAGTGGG + Intronic
986779234 5:11048962-11048984 GGGTGCTACTGGCACCTAGTGGG - Intronic
986907649 5:12514918-12514940 TGTTACTACTGGCATCTAGTAGG - Intergenic
987011489 5:13770593-13770615 GGGTACTGCTGGCATGTAGTGGG - Intronic
987149219 5:15021862-15021884 CGGTATTGCTGGCATTTAGTGGG + Intergenic
987204950 5:15615349-15615371 AGGTGCAACTGGCATCTAGTGGG - Intronic
987217049 5:15748153-15748175 AGGTACTACTGGCATCTTGTGGG + Intronic
987285635 5:16453791-16453813 GGGTACTACTGGCACCTAGTGGG + Intronic
988468590 5:31514827-31514849 GGGTACTACTGGCATCTAACAGG + Intronic
988673968 5:33412221-33412243 AAGTATCACTGGCATCTAGAAGG - Intergenic
989109346 5:37892058-37892080 AGGTGCCATTGGCATCTAGTTGG - Intergenic
989224902 5:39015540-39015562 GGGTGCTACTGGCATCTAGTAGG + Intronic
989530434 5:42501626-42501648 GGAAGTCACTAGCATCTAGTGGG - Intronic
989537229 5:42578145-42578167 GGGGACTACTGGTATCTAGTGGG - Intronic
989544604 5:42658711-42658733 GGGTGCTACTGGCATCTAGTAGG + Intronic
989545560 5:42668423-42668445 GGGTGATACTGGCATCTAGTGGG - Intronic
989761433 5:45021103-45021125 GGGTCCTACTGGCATCCAGTGGG - Intergenic
989961792 5:50424741-50424763 AGGTGTCACTCACATCTAGTGGG + Intronic
990097915 5:52141112-52141134 GAGTGTCACTGGCATGTAGTAGG + Intergenic
990332418 5:54740817-54740839 GAGTGTAACTGGCATCTGGTGGG - Intergenic
990339083 5:54804738-54804760 GGATATTTCTTGCATCTAGTGGG - Intergenic
990449455 5:55920949-55920971 AGGTGCTACTGGCATCTAGTGGG + Intronic
990596445 5:57316845-57316867 GGGTGCTACTGGCATTTAGTGGG + Intergenic
990615107 5:57499947-57499969 AAGTACCACTGGAATCTAGTGGG - Intergenic
990680240 5:58234705-58234727 GGGTGTTACTGGCATCTAGTTGG + Intergenic
990858173 5:60295588-60295610 GGGTGCTACTGCCATCTAGTTGG - Intronic
991197129 5:63948296-63948318 GGGTGCTACTGGCATCTAGTGGG - Intergenic
991474219 5:67002939-67002961 TGTCAGCACTGGCATCTAGTAGG + Intronic
991511986 5:67388165-67388187 GGGTGCTATTGGCATCTAGTGGG + Intergenic
992170950 5:74101553-74101575 GGGAGATACTGGCATCTAGTGGG + Intergenic
993003224 5:82403704-82403726 TGGTTCCACTGGCATCTAGTGGG - Intergenic
993543377 5:89180468-89180490 GTGTGCTACTGGCATCTAGTGGG + Intergenic
994058257 5:95444934-95444956 AGGTGTTACTGGCATCTAGTGGG - Intronic
994279043 5:97877762-97877784 GCATACTACTGGCATCTAGTGGG - Intergenic
995004084 5:107170117-107170139 GGATACTACTAGCATCTAGTGGG + Intergenic
995290002 5:110441228-110441250 GGATGTTACTGACATCTAGTGGG - Intronic
995732069 5:115256178-115256200 GGGAGTTACTGGCATCAAGTGGG + Intronic
995837989 5:116416946-116416968 GGGTGCTACTGGCATCTTGTTGG + Intergenic
995844830 5:116482174-116482196 AGGTGTCACTGGCTTATAGTTGG - Intronic
997113431 5:131100362-131100384 AGGTTTTATTGGCATCTAGTGGG - Intergenic
997259241 5:132453472-132453494 GGTTACTACTGGCATTTAGTAGG - Intronic
997421739 5:133774386-133774408 GGGTACTACTGGTATCTAGTGGG + Intergenic
997616189 5:135247704-135247726 GGGGATCCCTGACATCTAGCAGG + Intronic
998237276 5:140409008-140409030 GGGTTCTACTGGCATCTAGTGGG - Intronic
998271091 5:140707329-140707351 GGGTGCTACTGGCATCTAGCAGG - Intergenic
998497269 5:142601625-142601647 GGGTGCTACTGGCATCTAGTGGG + Intronic
998588030 5:143448702-143448724 GGGTGCTACTGGCATCTAGTGGG + Intergenic
999427066 5:151497766-151497788 GGGTGCAACTGACATCTAGTGGG - Intergenic
999988331 5:157025537-157025559 GGATGTGACTGGCATCTAGTGGG + Intergenic
1000072269 5:157751809-157751831 GGGTACTACTGGCATCTAATTGG + Intronic
1000090735 5:157927774-157927796 GAGTGCTACTGGCATCTAGTAGG - Intergenic
1000121813 5:158204740-158204762 GGGTGCTCCTGGCATCTAGTGGG + Intergenic
1000132820 5:158316304-158316326 GGGTTTCACTGTCATCTCCTTGG - Intergenic
1000218476 5:159187726-159187748 GGGTATCACTGGGGTCTAGTGGG + Intronic
1000324011 5:160158298-160158320 AGGTGATACTGGCATCTAGTGGG + Intergenic
1000387181 5:160685856-160685878 GGGTACTACTGACATCTAGTGGG - Intronic
1000614776 5:163414644-163414666 GGCCATCACTGACATGTAGTGGG - Intergenic
1000663823 5:163970113-163970135 TGGTTCTACTGGCATCTAGTGGG - Intergenic
1000846670 5:166290459-166290481 GCATGGCACTGGCATCTAGTGGG + Intergenic
1001047949 5:168389850-168389872 GGGTGATACTGGCAGCTAGTGGG - Intronic
1001049835 5:168405335-168405357 GGGTACCACCAGCATCTTGTGGG + Intronic
1001089104 5:168724003-168724025 AAGTATTACTGGCATCTAGTGGG + Intronic
1001221926 5:169907832-169907854 GGGTGCTACTGGCATCTAGTGGG + Intronic
1001422117 5:171596116-171596138 GGGTAAACCTGGCATGTAGTGGG - Intergenic
1001549099 5:172589113-172589135 GGGTGCTACTGGCATCTAGTGGG + Intergenic
1001604399 5:172949662-172949684 GGGTATGATTGGCATCTCCTGGG + Intronic
1001606125 5:172960973-172960995 GAGTGCCACTGGCATCTAGTGGG - Intronic
1002049144 5:176559859-176559881 GGTTGCTACTGGCATCTAGTGGG + Intronic
1003055146 6:2811405-2811427 GAGTGTCACTAGCATCCAGTGGG - Intergenic
1003079179 6:3007211-3007233 GGGTGCTACTGGCATCTGGTGGG - Intronic
1003318390 6:5031523-5031545 GGGTGCTAGTGGCATCTAGTGGG + Intergenic
1003657108 6:8022229-8022251 AGGTGCTACTGGCATCTAGTAGG + Intronic
1003688238 6:8326219-8326241 GTGTATCCCTGGCATCTGGACGG + Intergenic
1003773989 6:9339090-9339112 GGATACTTCTGGCATCTAGTGGG + Intergenic
1003962625 6:11223044-11223066 GTGTGTTACTGGCATCTAGTGGG + Intronic
1004142199 6:13028687-13028709 GGGTGCTACTGGCATCTAGTGGG - Intronic
1004608327 6:17214764-17214786 GGGTGCTACTGGCATCTAGTGGG + Intergenic
1004853391 6:19724370-19724392 GGGTGATACTGGCATCTGGTGGG + Intergenic
1004854522 6:19735684-19735706 GGGTGCTACTGGTATCTAGTGGG - Intergenic
1005079965 6:21946926-21946948 AGGTAAAACTAGCATCTAGTGGG + Intergenic
1005258695 6:24033437-24033459 GGGTGTCACTGTGCTCTAGTGGG + Intergenic
1005343531 6:24866399-24866421 GGGGTCTACTGGCATCTAGTGGG + Intronic
1005354389 6:24968599-24968621 GGTTGCCACTGGCATCTAATAGG + Intronic
1005357389 6:24997592-24997614 GCTTGTTACTGGCATCTAGTGGG - Intronic
1005646911 6:27848185-27848207 GTGTATCCCTGACATATAGTAGG + Intronic
1005916481 6:30356521-30356543 TGGTGTTACAGGCATCTAGTGGG + Intergenic
1006331468 6:33394076-33394098 GGTTGCTACTGGCATCTAGTGGG + Intronic
1007089364 6:39172610-39172632 GGGTGCCACTGGCATCTCATGGG - Intergenic
1007172095 6:39871151-39871173 GGGTGCTGCTGGCATCTAGTGGG + Intronic
1007404941 6:41629708-41629730 GGGTGTTACTGGCATCTGGTGGG + Intergenic
1007537404 6:42605299-42605321 GGGTGCTGCTGGCATCTAGTGGG - Intronic
1007662882 6:43497173-43497195 GAGTGCCACTGGCACCTAGTGGG - Intronic
1008032476 6:46712551-46712573 GGGTATTTCTGGTGTCTAGTGGG + Intronic
1008456718 6:51719475-51719497 GGGTGCTACTGGCATGTAGTGGG - Intronic
1008814658 6:55550822-55550844 GGGCACTACTGGCATCTAGTAGG + Intronic
1009860921 6:69331092-69331114 GGGTACTACTGGTATGTAGTAGG - Intronic
1010044839 6:71429351-71429373 GGGTGCTACTGGCATCTGGTGGG + Intergenic
1010694960 6:78960752-78960774 GGCTGCTACTGGCATCTAGTGGG + Intronic
1011274530 6:85616873-85616895 GGGTGCTACTGGCATCTAGCAGG + Intronic
1011726701 6:90216825-90216847 GGGTGCTACTGGCATCTAGTGGG + Intronic
1011759260 6:90542895-90542917 AGGTACTACTGGCATCTAGTGGG - Intronic
1012468867 6:99547656-99547678 GGGTGCTACTAGCATCTAGTGGG - Intronic
1012473607 6:99597553-99597575 GGATATTACTGGCATCCAGTGGG + Intergenic
1012833264 6:104232210-104232232 ATGTATTACTGGCACCTAGTGGG - Intergenic
1012919833 6:105209929-105209951 GGGTACTATTGGCATCTAGTGGG + Intergenic
1013066428 6:106688365-106688387 GGGTGCTACTGGCATCTAGTGGG + Intergenic
1013143000 6:107358804-107358826 GGGTGCTATTGGCATCTAGTGGG - Intronic
1013158545 6:107519253-107519275 GGGTACTAATGGCATCTAGTGGG + Intronic
1013158737 6:107521037-107521059 GGGTACTAATGGCATCTAGTGGG - Intronic
1013254438 6:108370485-108370507 GGCTGCTACTGGCATCTAGTAGG + Intronic
1013292166 6:108728984-108729006 GAGTACTACTGGCATCTGGTGGG + Intergenic
1013701896 6:112781455-112781477 GAGTGCTACTGGCATCTAGTGGG - Intergenic
1015444432 6:133286959-133286981 GGGTGCTACTGACATCTAGTGGG - Intronic
1015826344 6:137316716-137316738 GAGTGTTACTGGCATCTGGTGGG - Intergenic
1016592459 6:145761766-145761788 GAGGACTACTGGCATCTAGTGGG - Intergenic
1016868299 6:148791159-148791181 GATTATTACTGGCATCTAGTGGG + Intronic
1018166415 6:161101715-161101737 GGGTGCTACTGGCATCTAGTGGG - Intronic
1018192805 6:161325395-161325417 GGGTGCTACTGGCATCCAGTGGG + Intergenic
1018324616 6:162652092-162652114 GGGTGCTACTGGCATCCAGTGGG - Intronic
1018404146 6:163459361-163459383 GGGTACTATTGGCATCTAGTGGG + Intronic
1020579445 7:9976749-9976771 GGTTGCGACTGGCATCTAGTGGG - Intergenic
1021233995 7:18120188-18120210 GAGTGCTACTGGCATCTAGTGGG + Intronic
1021280087 7:18706683-18706705 GGTTGCTACTGGCATCTAGTGGG + Intronic
1021829344 7:24588029-24588051 GGGTGCTACTGACATCTAGTGGG + Intronic
1021918332 7:25457469-25457491 GGATGTCACTGGCCTCTAGTGGG + Intergenic
1022001900 7:26233936-26233958 GGGCGCTACTGGCATCTAGTGGG - Intergenic
1022218646 7:28290403-28290425 GGGTGTTACTGGCATCTAGTGGG + Intergenic
1022237876 7:28479312-28479334 GGGTCACCCTGGCATTTAGTGGG - Intronic
1022331698 7:29385449-29385471 GGGTATTCCTGGCCTCTAGTGGG - Intronic
1022378262 7:29835510-29835532 GGGTGCTACTGGCATCTAGTGGG - Intronic
1022626587 7:32043091-32043113 AGATGTTACTGGCATCTAGTGGG + Intronic
1022751538 7:33231915-33231937 GGGTACTACTGGCATCTAGTGGG - Intronic
1022822530 7:33975036-33975058 GGGGTTTACTGGCATCCAGTTGG - Intronic
1022828332 7:34039451-34039473 GGGTGCCACTGCCATCTAGCAGG + Intronic
1022922846 7:35033894-35033916 AGATACCAGTGGCATCTAGTAGG + Intronic
1022977078 7:35568663-35568685 GGGTGCTACTGGCATCTAGTGGG + Intergenic
1023244232 7:38183379-38183401 AGGTACCACTAGCTTCTAGTGGG - Intronic
1023757493 7:43433106-43433128 GAGTGTCACTGGCATCTAATGGG + Intronic
1023792342 7:43762973-43762995 ATGTGCCACTGGCATCTAGTGGG + Intronic
1023815086 7:43943445-43943467 GAGTACTACTGGTATCTAGTCGG + Intronic
1024281206 7:47721312-47721334 TGGTGCCACTGGCATCTGGTGGG - Intronic
1024501431 7:50112435-50112457 GGGTGCTACTGGCATCTAGTGGG - Intronic
1024668329 7:51567138-51567160 GGGTACTACTGGCATCTAGTGGG - Intergenic
1024678944 7:51663164-51663186 TGGTGCTACTGGCATCTAGTGGG + Intergenic
1025254896 7:57377781-57377803 GGGTGCTCCTGGCATCTAGTGGG - Intergenic
1027832711 7:83200451-83200473 GGAAATCACTAGCATCCAGTTGG - Intergenic
1028432302 7:90761654-90761676 TGGTGTCACTGGCATGTAGTGGG + Intronic
1028804334 7:95007347-95007369 AGGTACCACTGGCATCTATTGGG - Intronic
1028960877 7:96748935-96748957 GGGTAATGCTGGCGTCTAGTGGG - Intergenic
1029024769 7:97404588-97404610 GGGTACTACTGGCATCTAGTGGG - Intergenic
1029738384 7:102477579-102477601 GGTTATGACTGGAATCTACTGGG - Intronic
1029755514 7:102571235-102571257 GGTTATGACTGGAATCTACTGGG - Intronic
1029773463 7:102670315-102670337 GGTTATGACTGGAATCTACTGGG - Intronic
1029846312 7:103415502-103415524 GAGTATTACTGGCATCTAGTGGG + Intronic
1030235036 7:107249283-107249305 GTGTGTTACTAGCATCTAGTAGG + Intronic
1031159850 7:118153213-118153235 GGGTGCCACTGGCATCTAGTAGG - Intergenic
1032572114 7:133011535-133011557 GGGTACCACTGGCATCTGATAGG - Intronic
1032807158 7:135367089-135367111 TGGTACCCCTAGCATCTAGTGGG - Intronic
1033405820 7:141071423-141071445 GCGTTTCAGTGCCATCTAGTGGG - Intergenic
1034059450 7:148073052-148073074 GGGTGTTAATGGCATTTAGTAGG - Intronic
1034409796 7:150934384-150934406 GGTTGTTACTGGCATCTAGTGGG - Intergenic
1034678435 7:152909783-152909805 TGGTGTGACTGGCATTTAGTGGG + Intergenic
1036188439 8:6646715-6646737 GGATGCCACTGGCATCTAATAGG - Intergenic
1036721571 8:11180431-11180453 GGGTGCTACTGGCATCTAGTTGG - Intronic
1036988831 8:13568528-13568550 GGGGATCAATGGCATATAGCTGG + Intergenic
1037212056 8:16401137-16401159 GGGTATTACTGGCAATTATTGGG + Intronic
1037354715 8:18005762-18005784 AGGTGTTACTGGCATCTAGTGGG + Intronic
1037685193 8:21132767-21132789 AGGTGCTACTGGCATCTAGTGGG - Intergenic
1039413100 8:37372126-37372148 GGCTATCCCTGGCACTTAGTAGG + Intergenic
1040929763 8:52721412-52721434 GGGTGCTACTGGCATCTAGTGGG - Intronic
1041354954 8:56990683-56990705 GGATGCTACTGGCATCTAGTAGG - Intronic
1041899204 8:62962609-62962631 TGGTGTTACTGGCATCTAGGCGG - Intronic
1042206689 8:66336637-66336659 GGGTGCTACTGGCATCTAGCGGG + Intergenic
1042299847 8:67265817-67265839 GGGCATTACAGGAATCTAGTTGG + Intronic
1042404364 8:68386854-68386876 GGCTATTTCTGGCATCTAGTTGG - Intronic
1042477407 8:69264486-69264508 GAGTGACACTGGCATCCAGTGGG - Intergenic
1043300775 8:78728741-78728763 GGAGATCACTGGCATCTAATGGG + Intronic
1043368198 8:79560043-79560065 AGCTCTCACTGGCATCTGGTGGG - Intergenic
1043990151 8:86742998-86743020 GGATGTTACTGGCATCCAGTGGG - Intronic
1044484288 8:92732267-92732289 AGGTACTGCTGGCATCTAGTGGG + Intergenic
1044902790 8:96966578-96966600 GGGTGCTACTGGCTTCTAGTGGG - Intronic
1045144804 8:99329942-99329964 GGGTGCCACTGGTATCTAGTGGG - Intronic
1045238794 8:100379783-100379805 GGGCATTACTGTCATCTAGATGG + Intronic
1045447868 8:102286090-102286112 GGGTTTCACTGGCATCTAGTGGG + Intronic
1045492923 8:102684019-102684041 GTGTACCACTGGCATCTAGTGGG + Intergenic
1045494401 8:102696312-102696334 GGGTGTTGCTGGCATCTAGCGGG + Intergenic
1045614354 8:103890976-103890998 GGGTGCTACTGGCATCTAGTAGG - Intronic
1045759527 8:105587839-105587861 GGATGCTACTGGCATCTAGTAGG - Intronic
1046052029 8:109035068-109035090 GAGTGTTACTGGCATCTAGTGGG + Intergenic
1046238603 8:111461319-111461341 GGCTGTTACTGGCATCTAGTGGG - Intergenic
1046731369 8:117729915-117729937 AGGTGCTACTGGCATCTAGTGGG + Intergenic
1046779855 8:118203420-118203442 AGGTACTACTGGCATCTAATGGG + Intronic
1046797928 8:118392817-118392839 GAGTATTATTGTCATCTAGTAGG - Intronic
1046824598 8:118673783-118673805 GGGTGCTACTGGCATCTAGTGGG - Intergenic
1047183992 8:122615462-122615484 GGGTGTCACTGACATCTAGGGGG - Intergenic
1047401794 8:124554387-124554409 GGGTACTATTGGCATCTAGTGGG - Intronic
1047407600 8:124598375-124598397 GGATGTTACTGGCATCTAGTGGG - Intronic
1047447304 8:124930819-124930841 GAGTATTACTGGCATCTATTAGG - Intergenic
1047709088 8:127532447-127532469 GGGTGCTACTGGCATTTAGTGGG - Intergenic
1047802305 8:128322833-128322855 GTGCATCACTGCCAGCTAGTGGG + Intergenic
1048786054 8:138051494-138051516 GGGTGCTACTGGTATCTAGTAGG + Intergenic
1049432908 8:142573578-142573600 GGGTCACCCTGGCATCTCGTAGG + Intergenic
1050026272 9:1337470-1337492 GTGTGCTACTGGCATCTAGTGGG + Intergenic
1050290848 9:4153062-4153084 GGGTGCTACTGGCATCTAGTGGG - Intronic
1050371375 9:4924697-4924719 TGGTGCCACTGGCATCTGGTGGG + Intergenic
1050630758 9:7555885-7555907 GGGTACTTCTGGCATGTAGTGGG + Intergenic
1050951141 9:11596061-11596083 GGGTATCATTGGAAGCCAGTTGG - Intergenic
1051202910 9:14649077-14649099 GAGTGCTACTGGCATCTAGTGGG - Intronic
1051235673 9:14996188-14996210 GGGTGCTAGTGGCATCTAGTGGG - Intergenic
1051617082 9:19016584-19016606 AGGTGCCACTGGCATCCAGTGGG + Intronic
1051689501 9:19695136-19695158 TGGTGCTACTGGCATCTAGTGGG + Intronic
1052739002 9:32375600-32375622 GTGTTCTACTGGCATCTAGTTGG - Intergenic
1052832092 9:33223945-33223967 AGGTGCTACTGGCATCTAGTGGG + Intronic
1055251308 9:74309849-74309871 AGGTGCTACTGGCATCTAGTGGG - Intergenic
1055317855 9:75052175-75052197 GGGTGCTACTAGCATCTAGTGGG + Intergenic
1055587172 9:77767303-77767325 GGGTGCTACTGGCATCTAGTAGG - Intronic
1056379465 9:86044132-86044154 GGCTGCTACTGGCATCTAGTGGG - Intronic
1056534224 9:87513980-87514002 GGCTGTTACTGGCATCCAGTGGG - Intronic
1056642898 9:88386550-88386572 GTGTGCTACTGGCATCTAGTGGG + Intergenic
1056926000 9:90835005-90835027 GGGTGCTACTGGCATCTAGTGGG + Intronic
1057116802 9:92531600-92531622 AGGTACTAATGGCATCTAGTGGG - Intronic
1057461954 9:95271126-95271148 GGATGTCACTGGCACCCAGTGGG + Intronic
1057488028 9:95501256-95501278 GGGTGCTACTGGCATCTAGTAGG + Intronic
1057609350 9:96526818-96526840 GGGTACCACGGGCATCTGGTGGG - Intronic
1058060747 9:100493141-100493163 TGGTCCTACTGGCATCTAGTGGG + Intronic
1059094175 9:111394785-111394807 GGGTGCCACTGGTCTCTAGTGGG - Intronic
1059403607 9:114086192-114086214 GGCTGTCACTGGCATCTACACGG - Intronic
1059482581 9:114603049-114603071 GGGTTCTGCTGGCATCTAGTGGG - Intergenic
1059550558 9:115224917-115224939 TGGTGTGGCTGGCATCTAGTGGG + Intronic
1059719943 9:116950211-116950233 GGGTACTACTGGCATCCAGTTGG - Intronic
1059882279 9:118704902-118704924 GAATATTACTGGCATCTAGTTGG - Intergenic
1059918543 9:119131766-119131788 GAGTGCTACTGGCATCTAGTGGG - Intergenic
1059919083 9:119137650-119137672 GAGTACTACTGGCATCTAGTGGG - Intergenic
1060806590 9:126581471-126581493 GGGTGCCACTGGCATGTAATGGG + Intergenic
1060948849 9:127587801-127587823 TTGTATTACTGGCATCTAGTGGG + Intergenic
1061736214 9:132661481-132661503 GGGCACTGCTGGCATCTAGTGGG + Intronic
1061903356 9:133684213-133684235 GGGTGCCACTGGCACCTAGTGGG + Intronic
1062121861 9:134838227-134838249 GGCTCCTACTGGCATCTAGTGGG - Intronic
1062493401 9:136820107-136820129 GAGAATCACTGGAATCCAGTAGG + Intronic
1203635268 Un_KI270750v1:105053-105075 GGATACTACTGGCATCTAGCAGG - Intergenic
1185847511 X:3452219-3452241 TGGTCCTACTGGCATCTAGTGGG + Intergenic
1185847576 X:3453231-3453253 GGGTGCTCCTGGCATCTAGTGGG + Intergenic
1186186628 X:7026688-7026710 GGGTGCAACTGGCATCTAGTGGG + Intergenic
1186282191 X:8004720-8004742 GGGTGAGACTGGCATTTAGTGGG - Intergenic
1186346303 X:8696767-8696789 AGGAGTTACTGGCATCTAGTGGG - Intronic
1186380486 X:9053695-9053717 GTGTGCCACTGGCCTCTAGTAGG - Intronic
1186412990 X:9360246-9360268 GGGTTCTCCTGGCATCTAGTGGG - Intergenic
1186442257 X:9596481-9596503 GGGTAGTACTGGCATCTGGTGGG + Intronic
1186447400 X:9643222-9643244 GGGTGCTACTGGCATCTAGTGGG + Intronic
1186451667 X:9679278-9679300 GTGTGCTACTGGCATCTAGTGGG + Intronic
1186476291 X:9860133-9860155 GGGTGCTACTGGCTTCTAGTGGG + Intronic
1186512109 X:10137674-10137696 GGGTGTTACTGGCATCTGGTGGG - Intronic
1186533804 X:10326807-10326829 GGGTGCTACTGACATCTAGTGGG + Intergenic
1186547566 X:10466576-10466598 GGGTGCTATTGGCATCTAGTGGG - Intronic
1186595076 X:10972456-10972478 GGGTGCTACTGGCATCTAGTAGG - Intergenic
1186614425 X:11171819-11171841 GGGTGCTCCTGGCATCTAGTGGG - Intronic
1186625104 X:11284843-11284865 GGATGTTCCTGGCATCTAGTGGG - Intronic
1186638893 X:11434096-11434118 GGGTGTCACTTGCATCCAGTGGG + Intronic
1186640040 X:11445735-11445757 GGGCACTACTGGCATCTAGTGGG + Intronic
1186642591 X:11472206-11472228 GGGTGCTACCGGCATCTAGTGGG - Intronic
1186692558 X:11994132-11994154 GGGTGCAATTGGCATCTAGTGGG + Intergenic
1186695888 X:12031606-12031628 TGGTGCTACTGGCATCTAGTGGG + Intergenic
1186717663 X:12269666-12269688 GAGCACTACTGGCATCTAGTGGG + Intronic
1186756488 X:12677159-12677181 GGATGCTACTGGCATCTAGTAGG - Intronic
1186759148 X:12705012-12705034 GGGTGCTACTGGCATCTTGTGGG - Intronic
1186767740 X:12789029-12789051 AGGTGCTACTGGCATCTAGTGGG + Intergenic
1186797042 X:13057159-13057181 GGGTGCTATTGGCATCTAGTGGG - Intergenic
1186801040 X:13092598-13092620 GGGTGCTACTGGCATCTAGTGGG + Intergenic
1186817958 X:13256497-13256519 AGGTGATACTGGCATCTAGTGGG + Intergenic
1186818137 X:13258305-13258327 GGGTGCTACTGGCATCTAGTGGG - Intergenic
1186873200 X:13792481-13792503 GGACACTACTGGCATCTAGTGGG + Intronic
1186888938 X:13941114-13941136 GGGGCTTACTGGCATCCAGTGGG + Intergenic
1186899519 X:14038588-14038610 GTGTGCTACTGGCATCTAGTGGG - Intergenic
1186945131 X:14557736-14557758 TGGTGCTACTGGCATCTAGTGGG + Intronic
1186958986 X:14714305-14714327 GGGTGCTACTGGCATCTAGTGGG + Intronic
1186989582 X:15052951-15052973 GGGTGTCATTGGCATCTTGTGGG - Intergenic
1187003206 X:15203719-15203741 GGGTGTTATTGGCATGTAGTCGG + Intergenic
1187007286 X:15245326-15245348 GGGTGCTACTGGCATCTAATGGG + Intronic
1187048250 X:15670727-15670749 GGATTCTACTGGCATCTAGTGGG + Intergenic
1187054085 X:15725097-15725119 GGGTGCTACTGACATCTAGTGGG + Intronic
1187079679 X:15973544-15973566 CGTTACTACTGGCATCTAGTGGG + Intergenic
1187203371 X:17157567-17157589 GGATGCTACTGGCATCTAGTGGG + Intergenic
1187273462 X:17799330-17799352 GATTACTACTGGCATCTAGTGGG - Intergenic
1187339986 X:18412363-18412385 GGGTGTTACTGGCACCTAATGGG + Intergenic
1187442275 X:19331216-19331238 GGGTGCTACTGGCATCTGGTGGG - Intergenic
1187479141 X:19638999-19639021 GAGTGCTACTGGCATCTAGTGGG + Intronic
1187529515 X:20083831-20083853 AGGTGCTACTGGCATCTAGTGGG + Intronic
1187690293 X:21859700-21859722 GGGTGCTACTGGCATCTGGTGGG + Intronic
1187721382 X:22154527-22154549 GGGTGTTACTGGCATTTAGTGGG + Intronic
1187737748 X:22322020-22322042 GGATGCTACTGGCATCTAGTGGG + Intergenic
1187885603 X:23886077-23886099 AGGTGCTACTGGCATCTAGTGGG - Intronic
1187978703 X:24731631-24731653 TGGTAATACTGGCAACTAGTAGG + Intronic
1188025097 X:25200021-25200043 TGGTGCCACTGGCGTCTAGTGGG + Intergenic
1188065186 X:25650218-25650240 GGACATTACTGGCATCTAGTGGG + Intergenic
1188168060 X:26886952-26886974 GGGTACCACTAGCATCTAGTGGG + Intergenic
1188550920 X:31363807-31363829 AGGTGCTACTGGCATCTAGTGGG - Intronic
1189139522 X:38587091-38587113 AGGTGCAACTGGCATCTAGTGGG + Intronic
1189256422 X:39643155-39643177 GGGTGCTACTGGCATCTAGTAGG + Intergenic
1189625897 X:42896150-42896172 TGGTGCTACTGGCATCTAGTGGG - Intergenic
1190039143 X:47055104-47055126 GGGTGCTACTGGCATCTAGTGGG - Intronic
1190303477 X:49069290-49069312 GGATTTCACTGGCATCTACCGGG - Intronic
1190392838 X:49949221-49949243 AGGTGTTACTGGCATCTAGTGGG + Intronic
1190754761 X:53391912-53391934 GGTTACTACTGGCATCTAGTGGG - Intronic
1191100923 X:56727653-56727675 GAGTAGTACTGGCATATAGTTGG + Intergenic
1192625393 X:72722005-72722027 GGGTGCTACTGACATCTAGTTGG - Intergenic
1193115523 X:77771852-77771874 GGGTGTTACTGGTATCTAGTGGG + Intronic
1193335327 X:80281186-80281208 GGGTGCCATTGGTATCTAGTGGG + Intergenic
1194248310 X:91541457-91541479 GAGAATCACTGGAATCTAGGAGG + Intergenic
1194469619 X:94276760-94276782 GCGTGCTACTGGCATCTAGTAGG + Intergenic
1194585781 X:95732491-95732513 CGGTACTAATGGCATCTAGTGGG - Intergenic
1194768881 X:97876366-97876388 GGGTGCTACTGGCATCTAATGGG + Intergenic
1194973607 X:100371203-100371225 TGGTATCCCTGGATTCTAGTAGG - Intronic
1195532792 X:105976180-105976202 TGGTGCTACTGGCATCTAGTGGG + Intergenic
1195630101 X:107046700-107046722 AGGTGCTACTGGCATCTAGTGGG + Intergenic
1195765964 X:108297474-108297496 GGGTCATACTGGCATCTAGTGGG - Intronic
1195997517 X:110746022-110746044 GGATGTCATTGGCATTTAGTGGG - Intronic
1196203305 X:112910614-112910636 GAGTGCTACTGGCATCTAGTGGG - Intergenic
1196389638 X:115193775-115193797 GGTTGTTGCTGGCATCTAGTGGG - Intronic
1196504012 X:116419134-116419156 GGGTGCTACTGGCATCTACTAGG + Intergenic
1197295927 X:124718939-124718961 GGGTACTACTGGCATCTAGTGGG + Intronic
1197735702 X:129849539-129849561 GGGAATCACTTGAATCTAGGAGG + Intergenic
1198033352 X:132777081-132777103 GGGTACAACTGGCATCTAGTAGG + Intronic
1198413678 X:136397159-136397181 GAGTGCTACTGGCATCTAGTGGG - Intronic
1198556622 X:137799998-137800020 GGGTATTGCTGGCACCTAGTGGG - Intergenic
1198649225 X:138842714-138842736 GGGTGCTACTGGCATCTAGTGGG + Intronic
1199057022 X:143308429-143308451 TGGTGCTACTGGCATCTAGTAGG + Intergenic
1199656322 X:149998616-149998638 GGGTGCTACTGGAATCTAGTTGG - Intergenic
1199938830 X:152604288-152604310 GGGTGCTACTAGCATCTAGTGGG + Intergenic
1200567322 Y:4782977-4782999 GAGAATCACTGGAATCTAGGAGG + Intergenic
1200816330 Y:7537139-7537161 TGGTCCTACTGGCATCTAGTGGG - Intergenic
1201228492 Y:11840837-11840859 CTGGATCACTGGCATCTAGTGGG + Intergenic
1201440426 Y:14001800-14001822 GGGTGCAACTGGCATTTAGTTGG - Intergenic
1201444145 Y:14040908-14040930 GGGTGCAACTGGCATTTAGTTGG + Intergenic
1201575082 Y:15454847-15454869 TGGGGTCACTGGCATTTAGTGGG - Intergenic