ID: 944653944

View in Genome Browser
Species Human (GRCh38)
Location 2:201859080-201859102
Sequence CTGCGCGGGCCTCCTGCAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 113
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 103}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944653932_944653944 29 Left 944653932 2:201859028-201859050 CCGTCTTTCACACAATTAGCCAA 0: 1
1: 0
2: 1
3: 10
4: 250
Right 944653944 2:201859080-201859102 CTGCGCGGGCCTCCTGCAGTGGG 0: 1
1: 0
2: 1
3: 8
4: 103
944653933_944653944 10 Left 944653933 2:201859047-201859069 CCAAGACACATTAATCAAGCTGG 0: 1
1: 0
2: 0
3: 9
4: 95
Right 944653944 2:201859080-201859102 CTGCGCGGGCCTCCTGCAGTGGG 0: 1
1: 0
2: 1
3: 8
4: 103

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944653944 Original CRISPR CTGCGCGGGCCTCCTGCAGT GGG Intronic
900412672 1:2520026-2520048 CCGCGCGTGCCTCCTGCCATGGG - Intronic
900753488 1:4416367-4416389 CTGCCTGGGCCTCCTGCATGAGG + Intergenic
901462428 1:9399726-9399748 CTGCTCGGGCCTCCAGCTGCAGG - Intergenic
901651648 1:10746592-10746614 CTGCACCTGCCTCCAGCAGTAGG - Intronic
907906010 1:58784236-58784258 CTCCGCTGCCCTCCTACAGTCGG + Exonic
924854096 1:247858188-247858210 GTGCACGTGCCTCCTGAAGTAGG + Intronic
1065873869 10:29980268-29980290 CTGTGGGTGACTCCTGCAGTGGG + Intergenic
1069569678 10:69486764-69486786 CTGCTGGGGCCTCCTGCAGTGGG + Intronic
1069752106 10:70751487-70751509 CTGCGGGGGCCACCCTCAGTTGG - Exonic
1071527933 10:86368699-86368721 CTCCCCGGGCCTCCTGTTGTTGG + Intergenic
1074998584 10:118778703-118778725 CTGGGTGGGCCACCTCCAGTGGG + Intergenic
1077338532 11:2016011-2016033 CTGCCCCCGCATCCTGCAGTGGG - Intergenic
1077460982 11:2709353-2709375 CTGCGGGGGCTTCCTGGAATTGG + Intronic
1081743888 11:45459654-45459676 CTGCCTGGGCTTCCTGCAGGCGG + Intergenic
1084030402 11:66477595-66477617 CTGCGCAGGGCCCCTGCAGTGGG + Intergenic
1090669725 11:128937765-128937787 CTGCTCAAGCTTCCTGCAGTGGG - Exonic
1091219096 11:133920031-133920053 TCGCCCGGGCCTCCTGCAGCAGG - Exonic
1202821516 11_KI270721v1_random:71193-71215 CTGCCCCCGCATCCTGCAGTGGG - Intergenic
1091555058 12:1566798-1566820 CCCCTCGTGCCTCCTGCAGTGGG + Exonic
1091784837 12:3237063-3237085 CAGGGAGGGCCTCCTGGAGTAGG + Intronic
1092992452 12:13916021-13916043 CTGAAGGGTCCTCCTGCAGTGGG + Intronic
1095234559 12:39781360-39781382 CTGTGCGGGGCTCCCTCAGTGGG - Intronic
1097840963 12:64320750-64320772 CTGCTGGGGCCTCATGCAGGAGG - Intronic
1098073342 12:66699846-66699868 CAGGGCGGGCCTCATGCAGGTGG - Intronic
1098426157 12:70366955-70366977 CTGCGAGGTGCCCCTGCAGTCGG - Exonic
1098750983 12:74292962-74292984 CTGCATGGGCTTCCTGCTGTGGG + Intergenic
1102561666 12:113766625-113766647 CTGCCCGGGCCTCTCGCATTTGG + Intergenic
1105015831 12:132786416-132786438 CCGCGAGGGCCTCCTGCAGGCGG + Exonic
1105247325 13:18665595-18665617 CTTCGAGGGCCTCCTGGAGGTGG + Intergenic
1105274490 13:18906671-18906693 CTGCGGGGGCCTCCTGGAGGTGG + Intergenic
1105857380 13:24385649-24385671 CTGGGTGGGCCTCCTTGAGTGGG - Intergenic
1111125408 13:83907418-83907440 CTGCGTGGGCTTCCTGCTGCGGG - Intergenic
1113738676 13:112696421-112696443 CTGCGCTTGCCTCCTCCGGTTGG + Intronic
1118669835 14:68112038-68112060 CTGCCAGGCCCTCCAGCAGTAGG + Intronic
1121452537 14:94018353-94018375 CTGCGCAGGGCTCCTCCAATGGG - Intergenic
1123119159 14:105908999-105909021 TTGCCCGGGCCCCCTGCAGGAGG - Intergenic
1128758771 15:70200625-70200647 CTGGGCGGGCAGCCTGCTGTGGG - Intergenic
1130555338 15:84918571-84918593 CCACGTGGGCCTCATGCAGTGGG + Exonic
1130564587 15:84982300-84982322 CGGCGCCGGCCTCTTGGAGTCGG + Exonic
1132619237 16:856514-856536 CTGGGAAGGCCTCCTGCAGTGGG + Intronic
1132649591 16:1014469-1014491 CCGAGGGGGCCTCCTACAGTGGG + Intergenic
1133303113 16:4795250-4795272 CTCCCTGGGCCTCCAGCAGTGGG + Intronic
1137811720 16:51359128-51359150 CTGGGCTGGCCTCCTGCTGCTGG + Intergenic
1142377973 16:89716711-89716733 CTTGGTGGGTCTCCTGCAGTAGG - Exonic
1142967478 17:3590525-3590547 CTGGCCTGGCCTCCTGCAGTGGG - Intronic
1143346185 17:6250805-6250827 CTGTGTGGGGCTCCTGCAGCGGG + Intergenic
1144961538 17:19046931-19046953 CTGCTCGGGGCTCCAGCAGCTGG + Exonic
1144973622 17:19127593-19127615 CTGCTCGGGGCTCCAGCAGCTGG - Exonic
1145093986 17:20009233-20009255 CTGCGCCGTCCTCCTTCAGCCGG - Intergenic
1147646368 17:42036711-42036733 CTGCAGGGGCCCCCTGCAATTGG + Intronic
1152496539 17:80676741-80676763 CTGCCCGGTTCTGCTGCAGTGGG - Intronic
1154441514 18:14393526-14393548 CTTCGAGGGCCTCCTGGAGGTGG - Intergenic
1163536041 19:17877102-17877124 CAGCGAGGGCCTCCTGGAGCAGG - Intronic
1166729833 19:45052781-45052803 CTGCCAGGGCATCCTGAAGTGGG - Exonic
1167290200 19:48620342-48620364 CTGGAAGGGCCTCCTGCAGTTGG + Intronic
929080883 2:38121088-38121110 GTTCGGGCGCCTCCTGCAGTGGG + Intergenic
934737590 2:96697799-96697821 CTCTGCTGGCCTCCTCCAGTGGG - Intergenic
935807025 2:106759442-106759464 TTGGGCTGGCCTCCTGCACTGGG + Intergenic
937317366 2:120940494-120940516 CTGAGAGGGCTTCCTGCAGGAGG - Intronic
944653944 2:201859080-201859102 CTGCGCGGGCCTCCTGCAGTGGG + Intronic
1174287512 20:49483400-49483422 CTGCCCGCCCCTCCTGCGGTAGG - Intergenic
1176454545 21:6897649-6897671 CTTCGAGGGCCTCCTGGAGGTGG + Intergenic
1176832718 21:13762697-13762719 CTTCGAGGGCCTCCTGGAGGTGG + Intergenic
1179242211 21:39602286-39602308 CTGCCCGCGCCTCCTTCTGTGGG + Intronic
1179882222 21:44297661-44297683 CTTCGATGGCATCCTGCAGTGGG + Exonic
1181173472 22:21023108-21023130 CAGCAGGGGCCTCCTGCAGGTGG - Exonic
1181512423 22:23394860-23394882 CTGCGCTGGCCCCCTGCACACGG + Intergenic
1183490788 22:38114634-38114656 CAGGGCGGGCTTCCTGCAGGCGG - Intronic
1183560548 22:38569754-38569776 CTGCCCAGGCCTCCTGCTGAGGG - Intronic
1185038024 22:48489778-48489800 CCCCGCGGGCCTCCCGGAGTCGG + Intronic
950967849 3:17158706-17158728 CTCCGCTGGCTCCCTGCAGTTGG - Intronic
954451091 3:50572105-50572127 CTGCACCGGCATCCTGCAGAGGG - Exonic
968081552 3:195849852-195849874 CTGCGCGCGCCCCCTGCCGGCGG - Intergenic
968911171 4:3477670-3477692 CCGCACGTGCCTCCTGCAGCTGG - Intronic
969463843 4:7343253-7343275 TTGCTGGGGCCTCCTGCATTTGG + Intronic
976398502 4:84582905-84582927 CTGCCCGGGCCTCCCGCACCAGG - Intergenic
980913766 4:139016005-139016027 CTGCTCGGCCCTGCTGCAGAGGG + Exonic
982702500 4:158672112-158672134 CTGCGCGTGCGTCGTGCTGTGGG + Exonic
985651769 5:1111032-1111054 GTGCCCGGGTCTCATGCAGTGGG - Intronic
985792806 5:1939498-1939520 CAGGGAGTGCCTCCTGCAGTGGG - Intergenic
989016343 5:36939248-36939270 CTGCCTCGGCCTCCTGAAGTTGG + Intronic
1000075206 5:157778184-157778206 CTGCCAGGTCCTCCTGTAGTGGG + Intergenic
1001980819 5:176035974-176035996 CTGCACTGCCCTCCTGCAGGGGG - Intergenic
1002236643 5:177808091-177808113 CTGCACTGCCCTCCTGCAGGGGG + Intergenic
1003571251 6:7258060-7258082 CAGGGCCGGCTTCCTGCAGTGGG - Intergenic
1006793310 6:36717366-36717388 CCGCCTGGGCCTCCTGCAGGCGG - Exonic
1018647346 6:165960885-165960907 CTGCGCTGGCCCCCAGGAGTGGG + Intronic
1018731737 6:166656704-166656726 CTGCGCGGTTCACCTGCTGTGGG + Intronic
1019388012 7:769406-769428 CGGGGCGGCCCTACTGCAGTGGG + Intronic
1019519547 7:1454546-1454568 CTGGGCAGTCCCCCTGCAGTAGG + Intronic
1019597922 7:1866928-1866950 CACAGCGGTCCTCCTGCAGTAGG + Intronic
1019702359 7:2480139-2480161 CTGCCCGCGCCTCCTCCAGCGGG - Intergenic
1024012264 7:45279047-45279069 CTGGGGGGGCCTGCAGCAGTTGG + Intergenic
1025087322 7:56034002-56034024 CGGCGCTGGCCCCCTGCAGCCGG - Exonic
1026676865 7:72435486-72435508 CTGCGGGGGCCTCCTGGAAGTGG + Intronic
1029403564 7:100359690-100359712 TCTCGGGGGCCTCCTGCAGTGGG + Intronic
1030453943 7:109748526-109748548 CTGTGCAGGCCTCTTCCAGTCGG - Intergenic
1035025272 7:155820846-155820868 CTGTGCAGGCCTCCTACTGTGGG - Intergenic
1035287040 7:157813273-157813295 CTGCCCGGTCCTCCTGCTGTGGG + Intronic
1037761576 8:21745266-21745288 ATGCCCAGGCCTCCTGCAGGGGG - Intronic
1042894523 8:73651653-73651675 CTGAGTGGGCCTGCTGCTGTGGG + Intronic
1045476921 8:102561048-102561070 CTCTGCAGGGCTCCTGCAGTGGG - Intergenic
1046560084 8:115825251-115825273 CTGAGCAGGCATCCTGCTGTGGG + Intergenic
1047335469 8:123931557-123931579 CTGCACTGGCCTATTGCAGTGGG - Intronic
1049337432 8:142093879-142093901 CTGGGAGGGCTTCCTGGAGTGGG + Intergenic
1049353978 8:142178721-142178743 CTGCACAGGCCTCCTGCAGACGG + Intergenic
1060246241 9:121948834-121948856 CTGCACTAGCTTCCTGCAGTGGG - Intronic
1061390515 9:130315084-130315106 CTGAGAGCGCCTCCTGCAGGGGG + Intronic
1061598093 9:131645757-131645779 CTGCGCACCCCTCCTGCTGTGGG + Intronic
1062414971 9:136443863-136443885 CTGGGAGGGCCCCCTGCAGCAGG + Exonic
1185611797 X:1397529-1397551 CTTCGGGGGCCTCCTTCAGAGGG - Intergenic
1200011590 X:153124551-153124573 ATGCGCGGGGCACCTGGAGTAGG + Intergenic
1200028011 X:153275368-153275390 ATGCGCGGGGCACCTGGAGTAGG - Intergenic