ID: 944654565

View in Genome Browser
Species Human (GRCh38)
Location 2:201864718-201864740
Sequence CAAAGGAAACAGAAGGGGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1009
Summary {0: 1, 1: 0, 2: 6, 3: 81, 4: 921}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944654555_944654565 0 Left 944654555 2:201864695-201864717 CCGGCCACCCCTGCTATTTTATT 0: 1
1: 1
2: 0
3: 42
4: 434
Right 944654565 2:201864718-201864740 CAAAGGAAACAGAAGGGGGAAGG 0: 1
1: 0
2: 6
3: 81
4: 921
944654553_944654565 9 Left 944654553 2:201864686-201864708 CCACTGTGCCCGGCCACCCCTGC 0: 1
1: 6
2: 71
3: 615
4: 4133
Right 944654565 2:201864718-201864740 CAAAGGAAACAGAAGGGGGAAGG 0: 1
1: 0
2: 6
3: 81
4: 921
944654559_944654565 -8 Left 944654559 2:201864703-201864725 CCCTGCTATTTTATTCAAAGGAA 0: 1
1: 0
2: 2
3: 23
4: 363
Right 944654565 2:201864718-201864740 CAAAGGAAACAGAAGGGGGAAGG 0: 1
1: 0
2: 6
3: 81
4: 921
944654551_944654565 28 Left 944654551 2:201864667-201864689 CCGGGATTACAGGCATGAGCCAC 0: 1406
1: 3588
2: 4650
3: 4179
4: 4000
Right 944654565 2:201864718-201864740 CAAAGGAAACAGAAGGGGGAAGG 0: 1
1: 0
2: 6
3: 81
4: 921
944654556_944654565 -4 Left 944654556 2:201864699-201864721 CCACCCCTGCTATTTTATTCAAA 0: 1
1: 0
2: 0
3: 25
4: 273
Right 944654565 2:201864718-201864740 CAAAGGAAACAGAAGGGGGAAGG 0: 1
1: 0
2: 6
3: 81
4: 921
944654554_944654565 1 Left 944654554 2:201864694-201864716 CCCGGCCACCCCTGCTATTTTAT 0: 1
1: 0
2: 3
3: 45
4: 430
Right 944654565 2:201864718-201864740 CAAAGGAAACAGAAGGGGGAAGG 0: 1
1: 0
2: 6
3: 81
4: 921
944654560_944654565 -9 Left 944654560 2:201864704-201864726 CCTGCTATTTTATTCAAAGGAAA 0: 1
1: 0
2: 1
3: 27
4: 432
Right 944654565 2:201864718-201864740 CAAAGGAAACAGAAGGGGGAAGG 0: 1
1: 0
2: 6
3: 81
4: 921
944654558_944654565 -7 Left 944654558 2:201864702-201864724 CCCCTGCTATTTTATTCAAAGGA 0: 1
1: 0
2: 1
3: 24
4: 271
Right 944654565 2:201864718-201864740 CAAAGGAAACAGAAGGGGGAAGG 0: 1
1: 0
2: 6
3: 81
4: 921

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944654565 Original CRISPR CAAAGGAAACAGAAGGGGGA AGG Intronic
900667971 1:3828363-3828385 AAAAGGACACAGGAGGCGGAAGG - Intronic
900732437 1:4271181-4271203 TACAGGAAAGAGAAGGGGCATGG + Intergenic
900861040 1:5231581-5231603 CATAGGAAGCAGAAGGAAGAGGG + Intergenic
900911391 1:5599297-5599319 CAGAGGAGACTGATGGGGGATGG - Intergenic
901007394 1:6178750-6178772 GCAAGCAAACAGAAGGGGGCAGG + Intronic
901519054 1:9768871-9768893 CCAAAGCAACAGAAGAGGGAGGG + Intronic
902894145 1:19467341-19467363 TAAAGCAAACAGAAGGGAGAAGG + Intronic
902905985 1:19557799-19557821 GAAGGGGAACAGAAGGGGAAGGG - Intergenic
902906011 1:19557868-19557890 GAAAGGAAAGTGAAAGGGGAAGG - Intergenic
903762271 1:25706997-25707019 CAGAAGAGACAGAATGGGGAGGG + Intronic
903787323 1:25870083-25870105 GAAAGGAAAAAGCAGGGGCAGGG + Intronic
904442931 1:30543456-30543478 CAAAGGAAACAGGAGTGACATGG + Intergenic
904583361 1:31564370-31564392 CAAATGAAGCAGAAGGGACAGGG - Intergenic
904637901 1:31898623-31898645 CAAAGGAAACAGAAGTAACATGG + Intergenic
904683208 1:32242924-32242946 CAAAAGAAAAAGAAGACGGATGG - Intergenic
904783579 1:32968659-32968681 CAAAGTCATAAGAAGGGGGAAGG + Intergenic
905121934 1:35688989-35689011 AAAGAGAAAGAGAAGGGGGATGG + Intergenic
905447014 1:38034179-38034201 CAAAGGACACAAAAGGGAGGAGG - Intergenic
905772086 1:40644883-40644905 AAAAGGACACAGAAAGGGGAGGG + Intronic
905894003 1:41533650-41533672 CAAAGGAGACACAAGCAGGAGGG - Intronic
906056962 1:42924915-42924937 GAAAGGAAACAGACGGGGTGGGG - Intergenic
906085890 1:43134497-43134519 AAAAGGAAAAAAAAGAGGGAGGG - Intergenic
906092942 1:43198154-43198176 CAAAGAAAACAGTAGGGGGTGGG - Intronic
906129129 1:43445597-43445619 GGCAGGAAAGAGAAGGGGGAAGG - Intronic
906724668 1:48035578-48035600 CAAAGGAAAGAGCAGGGGGAGGG + Intergenic
906794862 1:48688829-48688851 AAAAGGAGACACAAGAGGGAAGG + Intronic
907473679 1:54691087-54691109 CAAAGGGAAGAGAATGGTGATGG + Intronic
907868389 1:58420829-58420851 CCATGGAAACAGAAGGGGAGTGG - Intronic
907913297 1:58846101-58846123 CAGAGGAAACAGCATGGGGAAGG - Intergenic
908589833 1:65618625-65618647 CAAAGGAAACAGAATTAGGCTGG - Intronic
908900223 1:68947915-68947937 AAAGGGAAAAATAAGGGGGAAGG + Intergenic
910254793 1:85237222-85237244 TAATGAAAACAGAAGGGGAAAGG + Intergenic
910707635 1:90146679-90146701 AAAAGGAAAAAGAAGGAAGAGGG + Intergenic
910870935 1:91832616-91832638 CAAACCAGACAGCAGGGGGAAGG + Intronic
910927384 1:92410941-92410963 CTAAGGAAACAGAATTGGGCTGG + Intergenic
910981736 1:92965091-92965113 CAGAGGAAACAGGAGTGGCAGGG - Intergenic
911176848 1:94825842-94825864 CAAAGAAGACAGGAGGAGGAAGG + Intronic
911620847 1:100065451-100065473 CAAAGGAAAGGAAAGGGGAAGGG - Intronic
911680517 1:100710126-100710148 CAAAGGAACTAGCAGAGGGAGGG - Intergenic
912047136 1:105472943-105472965 CAAAGGAAACAACAGAGGGAAGG + Intergenic
912190542 1:107334437-107334459 AACAGGGAACAGATGGGGGAAGG + Intronic
912207444 1:107524090-107524112 AAAAGAAGACAGAAGGGGGAAGG - Intergenic
912510489 1:110186457-110186479 AAAAGGAAAGAGAAGAGGAAAGG + Intronic
912869538 1:113291374-113291396 CCAAGGAAACAGACAGGAGAGGG + Intergenic
912921966 1:113877148-113877170 CATAGGGAACAGTAGGAGGAGGG + Intergenic
912949318 1:114109935-114109957 CTAAAGACACAGAAGGGGCAGGG + Intronic
913233948 1:116764458-116764480 CAAAAGGAAGAGAAGTGGGATGG - Intronic
914790641 1:150874694-150874716 CAAAAGAAAAAGAGGGGAGAGGG + Intronic
914943422 1:152042714-152042736 GCAAGGACACAGAAGGTGGATGG + Intronic
914998829 1:152568621-152568643 AACAGTATACAGAAGGGGGAGGG - Intronic
915396121 1:155585800-155585822 GAAAGGAAAAAGATGGGGGCAGG - Intergenic
915592800 1:156880200-156880222 AAAAGGAACCTGAAGGGGCATGG - Intronic
915726167 1:158019191-158019213 CAAAGGCAAGAAAAGGGAGAAGG + Intronic
915727069 1:158025496-158025518 CAAAGGAGAGAGATGGGGGTGGG + Intronic
916534309 1:165688933-165688955 CAAAGGAAAAGTAAAGGGGAGGG + Intronic
916668173 1:166986400-166986422 CATGGGAGACAGAAGTGGGACGG + Intronic
916763197 1:167835280-167835302 CAGAGGACACAGAAGGGTAAAGG - Intronic
916810354 1:168300261-168300283 CGAAGGAAGGAGAATGGGGAAGG + Intronic
916816888 1:168362780-168362802 CAAAGGAAGAAGCAGGGAGAAGG + Intergenic
916841950 1:168609862-168609884 CTGAGGAGACAGAGGGGGGAGGG + Intergenic
917118625 1:171626370-171626392 AAAAGGAAACAGACTGGGCATGG - Intergenic
917291468 1:173476574-173476596 CATAACAAACAGAAAGGGGAGGG + Intergenic
917539566 1:175899694-175899716 TAAAGGAGACAGAGGGAGGATGG + Intergenic
917556205 1:176091700-176091722 CAATCGAACCAGAAGAGGGATGG + Intronic
917931551 1:179826123-179826145 CAAAGGAAACAGTGGTGGGGTGG + Intergenic
918432509 1:184476777-184476799 CAAAGGAAGGAGATGGGGCAAGG - Intronic
918456165 1:184717936-184717958 CAGAGGAAAAAGTAGAGGGAAGG - Intronic
918621907 1:186614909-186614931 AAAAAGAAACAGGAGGTGGAAGG + Intergenic
919120108 1:193328969-193328991 CCAAGAAAACAGAATGGGGAAGG - Intergenic
919224598 1:194679722-194679744 CATTGTAAACAGAAGGGGCAGGG + Intergenic
919301939 1:195781404-195781426 GAATGGAAAGGGAAGGGGGAGGG + Intergenic
919671997 1:200346611-200346633 AAAAGGAAACGGGAGGGGAAGGG + Intergenic
920045436 1:203129348-203129370 CCAGAGAAACAGGAGGGGGATGG + Intronic
920123865 1:203678089-203678111 GAAAGGAAACAGGAGGGGCCCGG - Intronic
920778984 1:208969608-208969630 GATAGCAAAGAGAAGGGGGAGGG + Intergenic
920887064 1:209938809-209938831 AACAGCAAACAGAAGGGGAACGG - Intronic
920952387 1:210584701-210584723 CAAAGGAGGCTGAAGGGCGAAGG - Intronic
921782661 1:219185596-219185618 CTAAGAATTCAGAAGGGGGATGG + Intronic
921934533 1:220785063-220785085 CAAAGGAAAATGGAGGAGGAGGG - Intergenic
922356721 1:224783306-224783328 GAAGGAAAACAGAAGGGGCAAGG + Intergenic
922509960 1:226157155-226157177 AAAAGGAAAGAGACTGGGGAAGG - Intronic
923051340 1:230393159-230393181 AAAAGGGAAGAGAAGGGGAAGGG + Intronic
923082554 1:230672456-230672478 CAAAGGGCACAGGAAGGGGAGGG - Intronic
923131370 1:231077453-231077475 CCAAGGAAACCGAAGGTGTAGGG + Intergenic
923156773 1:231285984-231286006 CAAAAAAAAAAGAAGTGGGATGG + Intergenic
923235758 1:232031350-232031372 AAAAGGAAAGGGAAGGGAGAGGG + Intronic
923321923 1:232842785-232842807 CAAAGGAAACAGATGGAGGATGG + Intergenic
923600416 1:235397996-235398018 CAAAGCAGACAGAAGGAGCAAGG - Intronic
924201381 1:241662871-241662893 CAATGCAAACAGAAGGGAAAAGG + Intronic
1062989758 10:1804447-1804469 TAAAGGAAACAGAAGTGGCCCGG - Intergenic
1063056864 10:2514635-2514657 CAAAGAAAACAAAAGCTGGAAGG + Intergenic
1063291785 10:4757281-4757303 CAAAGTAAACGCAAGGGGAAGGG + Intergenic
1063395595 10:5684802-5684824 CAAAGGAAAAGAAAAGGGGAGGG - Intergenic
1063451533 10:6153550-6153572 CTCAGGAAAGAGGAGGGGGAGGG + Intronic
1063641406 10:7834157-7834179 TAAAGGAAACAGCAGAGTGAAGG - Intronic
1064443343 10:15371993-15372015 AAGAGGAAACATCAGGGGGAAGG + Intergenic
1065292561 10:24245626-24245648 GAAAGGAAAAGGAAGGGGAAGGG - Intronic
1066212271 10:33251881-33251903 TAAATGGTACAGAAGGGGGAAGG + Intronic
1066334512 10:34462865-34462887 AAGAGGAAAGAGAAGGGGAAGGG + Intronic
1066334606 10:34463130-34463152 AAAGGGAAAGAGAAGGGGAAGGG + Intronic
1066435423 10:35393006-35393028 CACAGGAGACAGCAAGGGGAGGG - Intronic
1066474110 10:35727984-35728006 CAAAGGAAATAACATGGGGAAGG + Intergenic
1066676445 10:37892794-37892816 CACTGGAAATAGAAAGGGGAAGG - Intergenic
1066720387 10:38331298-38331320 AAAAGGAAAGAGAAAGGGAAAGG - Intergenic
1067050850 10:43019448-43019470 TAAAGGAAAGAGAAAGGGAAAGG + Intergenic
1067491394 10:46707386-46707408 CAAAGGAAACAGGAGGGTGGAGG - Intergenic
1067516071 10:46945759-46945781 CAAAGGAAACAAAGTGGGTATGG + Intronic
1067603270 10:47632992-47633014 CAAAGGAAACAGGAGGGTGGAGG + Intergenic
1067646177 10:48106051-48106073 CAAAGGAAACAAAGTGGGTATGG - Intergenic
1068332953 10:55596948-55596970 CAAAGGAAACAGGAGGGTGGAGG + Intronic
1068342689 10:55728557-55728579 GAAAGGAAAGAAAAGGGGCAGGG + Intergenic
1069060626 10:63891072-63891094 CAAAGGGGAAAGAAGGAGGAGGG - Intergenic
1069329812 10:67278695-67278717 GGAAGGAAAACGAAGGGGGAAGG + Intronic
1069987326 10:72293308-72293330 AAGAGGAAGCAGAATGGGGAGGG - Intergenic
1070025286 10:72626177-72626199 CAGAGGAAAAGGAACGGGGAGGG + Intronic
1070370439 10:75777271-75777293 CAAAGGAAATGGAAGGGGCTGGG - Intronic
1070442104 10:76456359-76456381 CAAAGGAAATAGTAGTGGGAGGG + Intronic
1070466783 10:76732028-76732050 GAGAGGAAAAAGAAGGGGGCTGG - Intergenic
1071038763 10:81280949-81280971 CAGGGGAGACAGTAGGGGGATGG + Intergenic
1071052086 10:81462731-81462753 CAAAGAAAACATCTGGGGGAAGG - Intergenic
1071437184 10:85658218-85658240 GAAAGGAAGGAGAAGAGGGAAGG - Intronic
1071752472 10:88496062-88496084 CAAAGGGGACAGAAGGAAGAGGG + Intronic
1071948552 10:90676498-90676520 TAATGGAAACAGAAGGGAGAAGG - Intergenic
1072305903 10:94106982-94107004 CCAAGGAAGCAGAGGGGAGAGGG - Intronic
1072645550 10:97251328-97251350 GAAAGGGAAAGGAAGGGGGAGGG + Intronic
1073125854 10:101148719-101148741 CAAAAGAAACAGAATGGAAAAGG - Intergenic
1073325876 10:102643848-102643870 AAATAGAAACGGAAGGGGGAGGG - Intergenic
1073703244 10:105954154-105954176 CAAAGGAAAGAACAGGAGGAAGG + Intergenic
1073773506 10:106761029-106761051 CAAAGCAAACAGAAGTTGCAGGG + Intronic
1074073625 10:110099396-110099418 GGAAGGAAACGGAAGGGAGAAGG - Intronic
1074732795 10:116395550-116395572 TAAATGATACGGAAGGGGGAAGG - Intergenic
1075136092 10:119787613-119787635 GGAAGGAAAGGGAAGGGGGAGGG + Intronic
1075209701 10:120480770-120480792 GAAAGGAAAGACAAGGGGGCAGG - Intronic
1075356998 10:121788602-121788624 CAAATGAAAGATAAGGGGGTGGG - Intronic
1075382184 10:122028750-122028772 GGAAGGGAACAGAAGGGGAAGGG - Intronic
1075667671 10:124242674-124242696 CAGGGGAAACAGAGGGGGAAGGG + Intergenic
1075794147 10:125106928-125106950 TAAAGCAAAAAGAAGGGGAATGG + Intronic
1076204796 10:128588539-128588561 CAAATGAAAAGGATGGGGGATGG - Intergenic
1076989077 11:260197-260219 CAAAGGGAACAGTATGGGAAGGG - Intergenic
1077999925 11:7485468-7485490 AAAAGGAAATAGCTGGGGGAAGG + Exonic
1078363360 11:10687345-10687367 CTAGAGAAACAGAAGAGGGAGGG - Intronic
1078391444 11:10938665-10938687 AAGAGGAAAAAGAAGGGGAAGGG - Intergenic
1078670268 11:13358081-13358103 GAAAGGAAAGAGAAGGGAGGTGG - Intronic
1078911919 11:15740454-15740476 CAAAAGAAAAGGAAGGAGGAAGG + Intergenic
1078975068 11:16464486-16464508 GAAAGGAAAAGGAAGGGGAAGGG + Intronic
1079100084 11:17535679-17535701 CCATGGGAACAGAAGGGGAAGGG + Intronic
1079140510 11:17806269-17806291 GCAAGGAAAGAGAAGGAGGAAGG + Intronic
1079454259 11:20623469-20623491 CAAAGGACAAAGAATGGGGATGG - Intronic
1079704393 11:23595747-23595769 CAAAGGAACCAGAAGGTACAGGG + Intergenic
1080157400 11:29127895-29127917 GAAAGGAAAGGGAAGGGGAAGGG + Intergenic
1080186521 11:29493846-29493868 CAAAGAAGACAGAAGGAAGAGGG - Intergenic
1080565356 11:33504460-33504482 AAAAGGAAAGAGAAAGGGAAAGG - Intergenic
1080865817 11:36194080-36194102 CAAATGAAACAACAAGGGGAAGG - Intronic
1081896097 11:46588034-46588056 GAAAAGAAATAGAAGGAGGATGG + Intronic
1081983363 11:47284131-47284153 CAAACAAAACAGAAAGGGGCAGG - Intronic
1082216986 11:49583380-49583402 GGAAGGAAAGAGAAGGAGGATGG - Intergenic
1082790154 11:57341611-57341633 CAAAGGATCCAGAACGGGGATGG - Intronic
1082821690 11:57548288-57548310 CAGAGGAAACAGCAGGTGCAAGG - Intronic
1083190708 11:61050075-61050097 CAGAGGAAACTGGAAGGGGAAGG - Intergenic
1083275257 11:61593464-61593486 CAAAGGAGACAGAGAGGGAAAGG + Intergenic
1083361694 11:62113118-62113140 CTAAAGAAAAAAAAGGGGGACGG - Intergenic
1083402450 11:62433304-62433326 AAGAGGAAAGAGAAAGGGGAGGG + Intergenic
1083784596 11:64936638-64936660 CAAAGGAAAGGGATTGGGGAAGG + Intergenic
1083951383 11:65958506-65958528 CAAGGGAAAGAGGATGGGGAGGG + Intronic
1084115679 11:67041754-67041776 AGAAGGAAACTGGAGGGGGAGGG - Intronic
1084275117 11:68047451-68047473 CACAGCAAACAGGAAGGGGAAGG - Exonic
1084333010 11:68440654-68440676 CAGAGGAAGCAGAAGGGGGCTGG - Intronic
1084359874 11:68662218-68662240 CGTAAGAAACAGAAGGTGGAGGG + Intergenic
1084467118 11:69330550-69330572 GAAAGAAAAAAGAAGGAGGAGGG - Intronic
1084583413 11:70038908-70038930 GAGAGAAAATAGAAGGGGGAAGG + Intergenic
1084612432 11:70212181-70212203 GAGAGGAAACAGCAGGGGCAAGG - Intergenic
1085085607 11:73664481-73664503 GAAAGGAAAGGGAAGGGGAAGGG - Intergenic
1085374403 11:76045808-76045830 AAAAAGAAACAGAAAAGGGAAGG + Intronic
1086165442 11:83772480-83772502 GGAAGGAAGGAGAAGGGGGAGGG + Intronic
1086354469 11:85980234-85980256 CAGAGGATAGAGAAGGAGGATGG + Intronic
1086518694 11:87645930-87645952 GGAAGGGAAGAGAAGGGGGAAGG - Intergenic
1086595899 11:88570035-88570057 CAAAGGAAAGAGAAGGGGAAGGG + Intronic
1086632568 11:89040786-89040808 GGAAGGAAAGAGAAGGAGGATGG + Intronic
1087028369 11:93675009-93675031 TACAGGAAAGGGAAGGGGGAAGG + Intronic
1087492071 11:98840979-98841001 AAAAGGAAAGAGAAGAGAGAGGG - Intergenic
1088170978 11:106996241-106996263 CATAGGAAAAAGAAGGGGAGGGG + Intronic
1088234510 11:107708078-107708100 CAAAGGAAACAGAAGTGTTGTGG + Intronic
1088569985 11:111213501-111213523 GAAAGGAGAGGGAAGGGGGAAGG + Intergenic
1089375821 11:117993886-117993908 CAAAGGATACTGAAGGGGGTTGG + Intronic
1089539001 11:119178642-119178664 CAAAGGAAGAAGTTGGGGGAGGG + Intronic
1089581310 11:119483430-119483452 CCAAGGTAAAAGAGGGGGGAAGG - Intergenic
1089636637 11:119818098-119818120 AAAAGGAAACAGCAGCAGGAAGG + Intergenic
1090480277 11:127061760-127061782 CAAAGAAAGGAGAAGGGGGAAGG - Intergenic
1090667866 11:128926874-128926896 CAGAGGACACAGAAGCGGGATGG - Intergenic
1090745139 11:129699323-129699345 CACAGGAAGCAAAATGGGGAGGG + Intergenic
1090770753 11:129917832-129917854 AAAAGGAAACAGCTGGGGGCTGG + Intronic
1090824485 11:130374650-130374672 AAAAAGAAACGGAAGGGAGAGGG + Intergenic
1090910515 11:131114696-131114718 CAAGGGAGACCGAAGGGAGAAGG - Intergenic
1091007415 11:131965978-131966000 GAAAGGAAACATGAGAGGGAAGG + Intronic
1091526713 12:1309596-1309618 AAAGGGAGAGAGAAGGGGGAAGG - Intronic
1091863917 12:3813127-3813149 GAAAGGAAATAGAAACGGGAGGG - Intronic
1092092159 12:5812214-5812236 GAAAGGGAAGGGAAGGGGGAAGG + Intronic
1092164246 12:6333265-6333287 CACAGAATACAGGAGGGGGAAGG + Intronic
1092788054 12:12047295-12047317 GAAAGGAAAGAAAAGGGGAAAGG + Intergenic
1093837257 12:23848926-23848948 CAAAGATAACAAAAGGGGTAAGG - Intronic
1094340195 12:29402524-29402546 AAAAGGAAAGGGAAGGGGAAGGG + Intergenic
1094608247 12:31968391-31968413 AAAAGGAAACAGAAGTGGTCAGG + Intronic
1094627268 12:32135865-32135887 GAAAGGAAAATAAAGGGGGAAGG + Intronic
1094629952 12:32164059-32164081 GAAAGGAAACACACGGGAGATGG - Intronic
1094822906 12:34240818-34240840 CACAGGGGACAGAAGTGGGAGGG + Intergenic
1095392634 12:41727082-41727104 CAAAAGGAACAAAAGTGGGATGG + Intergenic
1095516272 12:43009412-43009434 CAAAGGAAAGAGGAGGGTAATGG - Intergenic
1095662304 12:44751632-44751654 CAAAGTAAACACAGGAGGGAGGG - Intronic
1095823972 12:46512189-46512211 CAAAATAAACATAAGGTGGAAGG - Intergenic
1095912052 12:47437738-47437760 CAAAGCAAACAGAAGGAAGGAGG + Intergenic
1096152840 12:49325463-49325485 AGAAGGAAAAGGAAGGGGGAAGG - Intronic
1096305863 12:50474640-50474662 CAAAAGAAACAGAATGGGCCAGG - Intronic
1096446251 12:51695078-51695100 CAAAGGAAAAAGAAGAAGAAAGG - Intronic
1096546641 12:52344705-52344727 CAAATGAAACAGGAGGAGCAAGG + Intergenic
1096729982 12:53601660-53601682 AAATAGAATCAGAAGGGGGAAGG - Intronic
1097480311 12:60116106-60116128 GAAAGGAAACAGAAGAGAGGAGG + Intergenic
1097543189 12:60965573-60965595 GGATGGAGACAGAAGGGGGAAGG + Intergenic
1097605263 12:61745886-61745908 GAAAGGGAACAGATGGGGGAAGG + Intronic
1097728290 12:63099348-63099370 GAAGGAAAACAGAAGGGGCAAGG + Intergenic
1097734021 12:63162355-63162377 CCAAAGAAACTGAAGGAGGAGGG + Intergenic
1098110579 12:67117755-67117777 TATAGGAAACAGGAGAGGGAGGG - Intergenic
1098407349 12:70140505-70140527 CAAGGGAAAGAGAAAGGGCAAGG - Intergenic
1098976870 12:76911967-76911989 CAAAGGAAACAAAAGCTGAAGGG - Intergenic
1099567230 12:84267755-84267777 CAAGGGAAACCAAAGGAGGAGGG + Intergenic
1100263884 12:92957795-92957817 CAATGGAGGGAGAAGGGGGAGGG - Intergenic
1100332373 12:93596530-93596552 CAAAGGAAACTGCAGGGGCTGGG + Intergenic
1100508387 12:95243464-95243486 CCAAGAAAAAAGATGGGGGAGGG - Intronic
1100604907 12:96143636-96143658 CAAAGGCAAGAAAATGGGGAGGG + Intergenic
1100643292 12:96503280-96503302 AAAAGGGAAGAGAAGGGGAAAGG - Intronic
1100867293 12:98870471-98870493 CAAAGAAAAGAAAAGGGTGAGGG - Intronic
1101358139 12:104000038-104000060 CCAAGAAAACAGAAGGGGAGAGG - Intronic
1101626492 12:106448036-106448058 CAAATCAAACAGAAAGGGGGAGG - Intronic
1101693010 12:107098347-107098369 AGAAAGAAAAAGAAGGGGGAGGG + Intergenic
1101986502 12:109451495-109451517 CAAGGGAAGCAGAAGGGGCCCGG + Exonic
1102091711 12:110195535-110195557 GAAAGGGAAAAGAAGGTGGAAGG - Intronic
1102496724 12:113324700-113324722 CAAAGGAAAAAAAAGGGGCTGGG - Intronic
1102520874 12:113476910-113476932 GAAAAGAAAGGGAAGGGGGAGGG - Intergenic
1102942027 12:116951531-116951553 CAAAAGAAAGAGAAAAGGGAAGG - Intronic
1103172464 12:118833420-118833442 CAAAGGGAACAGAAGCAGAAAGG - Intergenic
1103195900 12:119043686-119043708 CAAAGAAAAAAGAAAGGGCATGG + Intronic
1103514511 12:121498624-121498646 CAAAGAAAACAAAGGGGGGTGGG - Intronic
1104085946 12:125474291-125474313 AAAAGGAAAGGGAAGAGGGAAGG - Intronic
1104107368 12:125675712-125675734 CATAGGAAACAGAAAAGGGAAGG + Intergenic
1104369866 12:128215089-128215111 CAACGGAAGCAGAGGTGGGAGGG + Intergenic
1105814106 13:24017734-24017756 TAAAGGAGAAAGAAGGAGGAAGG - Intronic
1106299755 13:28453014-28453036 GAAAGGAAAGGGGAGGGGGAGGG - Intronic
1106622639 13:31385737-31385759 TAAATGATACAGAAGGGGGCGGG - Intergenic
1106636558 13:31534847-31534869 CAAAAGAAACATAAGGAGGAAGG - Intergenic
1106841931 13:33693019-33693041 AAAAGGAATCAGAAAAGGGAGGG - Intergenic
1106878817 13:34106648-34106670 CAAAAAAAAAAGAAAGGGGAGGG - Intergenic
1106969997 13:35128071-35128093 CAAAGAAAGCAGAAAGGGGTGGG + Intronic
1107014735 13:35698988-35699010 GAAAGGAAATAAAAGAGGGAAGG - Intergenic
1107337982 13:39375699-39375721 AAAAGGAAAGTGAAGTGGGATGG + Intronic
1107348066 13:39484518-39484540 CAAAGGAAAGAGAGAGGGAAGGG - Intronic
1107376806 13:39812437-39812459 GAAAGCAAACAGCAAGGGGATGG - Intergenic
1107833930 13:44398578-44398600 GAAAGGAGGAAGAAGGGGGAAGG - Intergenic
1108364226 13:49693892-49693914 CAAAGGAAACAGAATGGCTAAGG - Intergenic
1108480723 13:50867509-50867531 AAAAGGAAAGGGAAGGGAGAAGG - Intergenic
1108498379 13:51046358-51046380 CCCAGGAAACACAAAGGGGAGGG + Intergenic
1109636460 13:65124446-65124468 AAGAGGAAACAGGAGGGGCAAGG - Intergenic
1109711456 13:66165519-66165541 TAAATGATACGGAAGGGGGAAGG - Intergenic
1109758557 13:66795647-66795669 CAAATGAAAGAGAAAAGGGAGGG + Intronic
1110413959 13:75232295-75232317 CAGAGGGAACAGAAGGTGCATGG - Intergenic
1110651105 13:77942121-77942143 CAAGGGAGACAGCAGAGGGAAGG - Intergenic
1110688633 13:78405049-78405071 CAAAGGAAACAGAAGCTGAGTGG + Intergenic
1110712536 13:78665425-78665447 CAAAGGAAACAGAAAGGGACGGG - Intergenic
1110743622 13:79027023-79027045 CAAAGGAAAGAGCAGAGGAATGG - Intergenic
1110788364 13:79560198-79560220 GAAGGGAAAAGGAAGGGGGAAGG - Intergenic
1111883682 13:93990913-93990935 GAAAGGAAAAAAAAGCGGGAGGG + Intronic
1111944282 13:94647495-94647517 CAAAGGAATGAGAAAGGGGATGG + Intergenic
1113270914 13:108673347-108673369 AAAAGGAAGAAGAACGGGGAGGG - Intronic
1113331846 13:109334905-109334927 CATAGGAGACAGAACGGGGCGGG + Intergenic
1113697218 13:112354922-112354944 GAAGGGAGACAGAAGGGGGAGGG + Intergenic
1114080774 14:19200273-19200295 CAGAGGACACAGAAGGAGGGAGG + Intergenic
1114287930 14:21262746-21262768 CAAGGGAAACAGGAGGAAGATGG + Intronic
1114833593 14:26176072-26176094 CAAAGTAAGAAGATGGGGGAAGG + Intergenic
1114879035 14:26760965-26760987 CACAGGAGAAAGAAGGGGGGAGG - Intergenic
1114980156 14:28153554-28153576 CCAAGGAAAGAAAAGGGAGAAGG - Intergenic
1115075518 14:29385179-29385201 CAAAGGAAAAAAAAGAGGTAGGG - Intergenic
1115084171 14:29493284-29493306 AAAGGGAAACAGAAGAGGAAGGG + Intergenic
1115346527 14:32348707-32348729 CAAAAGAAACACAATGGGGCTGG - Intronic
1115620117 14:35132830-35132852 CAAAGGAAAGGGAAGGAAGAAGG + Intronic
1116464201 14:45213015-45213037 CCAAGGAAACATAAGGCAGAAGG - Intronic
1116825356 14:49668278-49668300 GAAAGGAAAGGGAAGGAGGAAGG + Intronic
1116922315 14:50592477-50592499 CAGGGTAAACAGAAGGAGGAAGG + Intronic
1117810042 14:59536186-59536208 CTAAGGAATCACAAGGGGGTGGG - Intronic
1118331660 14:64820200-64820222 CAAAAGAAACATTAGGGAGAAGG - Intronic
1118447333 14:65863613-65863635 CAAAGGAAACTCTAGAGGGATGG - Intergenic
1118478777 14:66143367-66143389 CAAAGAAAACAGAGAGGGGATGG + Intergenic
1118618906 14:67596771-67596793 CAAAGGAAACATCAGGGGCAAGG - Intronic
1118710720 14:68517234-68517256 GAAAGGAAAGGGAAGGGGAAGGG + Intronic
1118913270 14:70079686-70079708 CTGAGGAAAATGAAGGGGGAGGG - Intronic
1119012604 14:71010966-71010988 CAATGGAAACAGTAGGAGGAGGG + Intronic
1119199834 14:72744149-72744171 ATAAAGAAACAGAAGAGGGATGG + Intronic
1119297251 14:73543015-73543037 CAAAGGAAAAAGAAGAAGAATGG - Intronic
1119535564 14:75400168-75400190 TAGAGGCAAAAGAAGGGGGAAGG - Intergenic
1119783588 14:77296024-77296046 CAGAGAAAACAGAAGGGTGCAGG + Intronic
1119884638 14:78130048-78130070 CAAAGGGAACAGACTGGGGAAGG - Intergenic
1120081001 14:80216178-80216200 CAAAGGAAATAAAAAGGAGAGGG + Intronic
1121317925 14:92973326-92973348 CACTGGAAACAAAAGGAGGAGGG + Intronic
1121347098 14:93144239-93144261 CAAAACAAAAAGAAGGGGGTTGG + Intergenic
1121703048 14:95970642-95970664 CAAGGCAAACAGAATGGAGAAGG + Intergenic
1121726179 14:96152125-96152147 CAAAGGAAATAGAAGAAAGAAGG + Intergenic
1121799661 14:96764045-96764067 GGAAGGAGACAGAAGGAGGAAGG + Intergenic
1122171051 14:99876130-99876152 CAGAGGAGACAGAGAGGGGAAGG + Intronic
1122312376 14:100805210-100805232 CCAGGGAAGCAGAATGGGGAGGG + Intergenic
1122385662 14:101344398-101344420 GAAAGTAAAAAGATGGGGGAAGG + Intergenic
1122546008 14:102523272-102523294 GAAAGGAAAGAGGAGGGGAAGGG + Intergenic
1122630943 14:103107539-103107561 CACAGGTACCACAAGGGGGAGGG + Exonic
1122752662 14:103950018-103950040 GGAAGGAAACAGAAGAGGGCAGG - Intronic
1122837706 14:104438158-104438180 CAAAGGAAAGAAAGAGGGGAGGG + Intergenic
1123412255 15:20070528-20070550 AAAAGGAAAAACAAGCGGGAAGG - Intergenic
1124045803 15:26148815-26148837 CATGGGAAGCAGAAGAGGGAAGG - Intergenic
1125245836 15:37638045-37638067 CAGAGCAAACAGAAGGGAGGAGG + Intergenic
1125434369 15:39629370-39629392 CAAAGTAACCAGAAAGGGGCTGG + Intronic
1125536527 15:40443707-40443729 CAAAGGAAGCAGGAGGGAAAGGG - Intronic
1125587482 15:40831116-40831138 GATAGGAAACAGAAGAGGCAGGG - Intergenic
1126445241 15:48735783-48735805 TAAAGCAAACAGAAGGAAGAGGG + Intronic
1127054804 15:55120722-55120744 CAAATGAAACAGAGGGAGCAAGG - Intergenic
1127467003 15:59253925-59253947 CCAAGAAAACAAAAAGGGGAAGG + Intronic
1127568276 15:60214914-60214936 AAAAGGAGAGAGAAGGAGGAAGG + Intergenic
1128572255 15:68742322-68742344 GAAGGGAAATAGAAAGGGGATGG + Intergenic
1128839646 15:70839830-70839852 CAAAGCAGACAAAAGGGGAAGGG - Intronic
1128951451 15:71887550-71887572 CAAAGGTAACAAAACTGGGAAGG - Intronic
1128981855 15:72194015-72194037 GAAAGGAAGGAGGAGGGGGAGGG - Intronic
1129148824 15:73673829-73673851 CTAAGGAAGCAGAAAGGGGCAGG - Intergenic
1129153120 15:73701567-73701589 TAGAGGAAACAGCAGGTGGAAGG - Intronic
1129268666 15:74408290-74408312 CAGAGCAAACTGAAGTGGGAGGG + Intergenic
1129594136 15:76946449-76946471 AAAAAAAAAAAGAAGGGGGAGGG + Intronic
1129695677 15:77739496-77739518 CAAGGGAAAAAGGAGGGGAAAGG - Intronic
1129718581 15:77865639-77865661 CAAGGGAAACAGATGGTAGAAGG - Intergenic
1129887877 15:79051369-79051391 CAAAGGATCGAAAAGGGGGAGGG - Intronic
1130171626 15:81520559-81520581 GAAAGGAAAGGGAAGGGGAAGGG + Intergenic
1130226006 15:82058867-82058889 GAGAGGAAGGAGAAGGGGGAAGG - Intergenic
1130333015 15:82935780-82935802 CAGAGGAGACAGAAGTGGGTGGG - Intronic
1130460347 15:84155227-84155249 CAAGGGAAACAGATGGTAGAAGG + Intergenic
1131531581 15:93197608-93197630 AAAAGGAAAAAGAAGGAAGATGG - Intergenic
1131901131 15:97088768-97088790 AAAAGGAAGGAGAAGGAGGAGGG - Intergenic
1131919997 15:97315733-97315755 CAAAGGAAATAAAAGGGGTAGGG - Intergenic
1131951218 15:97683701-97683723 AAAAAAAAAGAGAAGGGGGAGGG + Intergenic
1132406290 15:101543381-101543403 CAAGGGAAGCGGAAGGAGGAAGG - Intergenic
1132447313 15:101936187-101936209 AAAAGGAAAGAAAAGGAGGAAGG + Intergenic
1132630024 16:912767-912789 CAAAGAAAACAGAAGCAGGTGGG - Intronic
1132986684 16:2771005-2771027 CAAAGAAAAAAAAAAGGGGAGGG - Exonic
1133319280 16:4903011-4903033 CTCAGGAAACTGATGGGGGAAGG - Intronic
1133568849 16:7022050-7022072 GAAAGGAAAGGGGAGGGGGAAGG - Intronic
1134105862 16:11485633-11485655 CAAAGGAAAGAAAAGATGGAAGG - Intronic
1134268972 16:12717078-12717100 CAAAGGTAATAGTAGGGTGAGGG + Intronic
1134488943 16:14681180-14681202 AAAAGAAAAGAAAAGGGGGAGGG + Intronic
1134667290 16:16028094-16028116 CAAAGGAAAAGGAAGGCGGCAGG - Intronic
1135164787 16:20129601-20129623 GAAAGGGAAAGGAAGGGGGAAGG - Intergenic
1135282591 16:21165557-21165579 GAGAGGGAAGAGAAGGGGGAGGG - Intronic
1135547850 16:23377729-23377751 AGAAGGAAACAGAAGTGGGGAGG - Intronic
1135624395 16:23982055-23982077 GAAGGGAAAGAGAAGGGGAAGGG - Intronic
1135624507 16:23982354-23982376 CAAGGGAAAGGGAAGGGGAAGGG - Intronic
1135708712 16:24696862-24696884 CAAGGCAAAAAGAAGGGGAATGG - Intergenic
1135943554 16:26843665-26843687 CAAAAGAAGCTGAAGGGGGCTGG - Intergenic
1136397532 16:30001329-30001351 AAATGCAAACAGAAGGAGGATGG - Intronic
1136407721 16:30058284-30058306 ACAAGGAAACTGAAGAGGGAGGG - Intronic
1136581130 16:31151499-31151521 AAAAGGAAACCAAAGAGGGATGG + Intergenic
1137276849 16:46940520-46940542 CAAAGTAAACACAATGGAGAAGG + Intergenic
1137408791 16:48210661-48210683 CTAAGGACACAGAAAGGAGAAGG - Intronic
1138157639 16:54720799-54720821 CCAATGAGACAGCAGGGGGATGG + Intergenic
1138222529 16:55265093-55265115 CAAAGAAAACAGGAGGGGCAAGG + Intergenic
1138396533 16:56708976-56708998 CACTGGCAACAGCAGGGGGATGG + Intronic
1138835410 16:60428870-60428892 GAAGGGAAAGAGAAGGAGGATGG + Intergenic
1139123398 16:64047768-64047790 CAAAGGGAAAAGAAGGGAGAGGG - Intergenic
1139194212 16:64899430-64899452 CAAAGAAAAGAGAAGGGTCAGGG + Intergenic
1139197204 16:64933388-64933410 CAAAGGAAACTGAACTGGAAAGG - Intergenic
1139391078 16:66606342-66606364 CATAGGAGACAGGAAGGGGAGGG + Intronic
1139522130 16:67489609-67489631 CAAAGGCCACAGCAGGGGGAAGG - Intergenic
1139640050 16:68285065-68285087 AAAAAGAAGCAGAAGTGGGAGGG - Intronic
1139770829 16:69274971-69274993 AAAAGGAAAGGGAAGGAGGAAGG - Intronic
1140216867 16:73015727-73015749 CAAAGGAAACAGAATGGCTCGGG + Intronic
1140257556 16:73349905-73349927 GAAAGGAAAAAGGAGGGGAAGGG - Intergenic
1140480254 16:75258559-75258581 CAAAGCAGACAGCAGAGGGATGG + Intronic
1140540093 16:75749102-75749124 AAAAGGAAAGGGAAGGAGGAAGG + Intronic
1140764279 16:78141419-78141441 AAAAAAAAAAAGAAGGGGGATGG - Intronic
1140908387 16:79429519-79429541 CAAAGGAAGCAGCAGAGAGAGGG + Intergenic
1141159216 16:81617916-81617938 CAGTGGACACAGAAGAGGGAGGG + Intronic
1141534129 16:84667163-84667185 CAAAGGAAACAGACAAGGAAGGG - Intronic
1141623285 16:85248390-85248412 CAGAGGAAACAGAAAGAAGAGGG - Intergenic
1141779978 16:86152886-86152908 CACAGGACACAGAACGGGGAAGG + Intergenic
1141921483 16:87138560-87138582 CAGAGGAGACAGAAGGGCAAAGG + Intronic
1141942485 16:87286891-87286913 CAAACTAAACACAAGGAGGAAGG + Intronic
1141967024 16:87452562-87452584 CAAAGGAAACAGAGAGGCAAGGG + Intronic
1143744807 17:8984467-8984489 GAAAGGAAAGGAAAGGGGGAGGG + Intergenic
1143965817 17:10755942-10755964 GAAAGGAAAAGGAGGGGGGAGGG - Intergenic
1145019720 17:19420173-19420195 TCAAGGAAATAGAAAGGGGAGGG + Intergenic
1145173479 17:20679818-20679840 AAAAGAAAAAAGAAGGGAGAAGG - Intergenic
1145264136 17:21371417-21371439 CACAGGAAACATATGGTGGAGGG + Intergenic
1145709581 17:26958835-26958857 AAAAGTAAAGAGGAGGGGGAGGG - Intergenic
1145930608 17:28682703-28682725 TAAAGCAAACAGAAGAGTGAAGG - Intronic
1146652160 17:34613615-34613637 CAAAGGAAAGAGATAGGGGGAGG - Intronic
1147228244 17:38997708-38997730 AAAAAGAAAAAGAAAGGGGAGGG - Intergenic
1147312871 17:39605419-39605441 CAAAAGAAAAAGAAGGGAGCCGG + Exonic
1147499405 17:40948470-40948492 CAAAGGAAACAGAGAGAGGGAGG - Intergenic
1147715283 17:42502741-42502763 GAAAGAAAACAAAAGAGGGAGGG - Intronic
1147738724 17:42657941-42657963 CAGAGGAATCAGGAGAGGGAAGG - Intergenic
1147948837 17:44095792-44095814 GAAGGGTAACAGCAGGGGGAGGG + Intronic
1148193300 17:45695207-45695229 TAAAGGAGTCAGAAGGAGGAGGG + Intergenic
1148219074 17:45849650-45849672 CTAGGGAACCAGCAGGGGGAGGG - Intergenic
1148282641 17:46361155-46361177 AAGAGGAAAGAGAAGGGAGAGGG - Intronic
1148304859 17:46579080-46579102 AAGAGGAAAGAGAAGGGAGAGGG - Intronic
1148897797 17:50850084-50850106 GAGAGGAAAAAGAAGAGGGATGG + Intergenic
1149013674 17:51884034-51884056 CAAAGAAAAAAGAAGGGTCAAGG - Intronic
1149039264 17:52168473-52168495 CAAAGGCAAAAGCAGGGGCAGGG + Intergenic
1149567364 17:57649737-57649759 CTAATGGAACAGGAGGGGGATGG + Intronic
1149660696 17:58332667-58332689 GACAGGAAACAGAAGGGGGTGGG + Intergenic
1150145972 17:62769776-62769798 AAAAGAAAAAAGAAAGGGGAAGG - Intronic
1150747207 17:67825682-67825704 AGAAGGAAAGCGAAGGGGGAGGG - Exonic
1151001132 17:70377735-70377757 CAAGACAAACAGAAGTGGGATGG + Intergenic
1151138025 17:71966353-71966375 AAAAGGAAAGAAAAAGGGGAGGG + Intergenic
1151777774 17:76218987-76219009 CAAAAAATAAAGAAGGGGGATGG + Intronic
1152191181 17:78888754-78888776 CCAAGGAGGCAGCAGGGGGATGG + Intronic
1152609237 17:81307485-81307507 AAAGGGAAAGTGAAGGGGGAGGG - Intergenic
1153309529 18:3664542-3664564 CAAAGGATCAAGAAGGGTGAGGG - Intronic
1153682382 18:7512831-7512853 CAAATGAAAGAGAAGGGAGGGGG - Intergenic
1154518680 18:15201921-15201943 AAAAGTAAAGAGGAGGGGGAGGG + Intergenic
1155326163 18:24666963-24666985 GAGAGGAAAGAGAAAGGGGAAGG - Intergenic
1155345188 18:24850667-24850689 CACAGGAGACAGAAGGGAGGGGG - Intergenic
1155352194 18:24917685-24917707 CAAAGGACACAGAAAGGAGACGG + Intergenic
1156550477 18:38011143-38011165 CAAAGAAGACAGAAGGAGGGAGG + Intergenic
1156706549 18:39889313-39889335 AGAAGGGAACAGGAGGGGGATGG - Intergenic
1156916702 18:42470446-42470468 CAAATGAAATAGAAGGTGGGAGG - Intergenic
1157121767 18:44917883-44917905 AGAAGGAAATAGAAGGGGAAAGG + Intronic
1157740228 18:50086231-50086253 AAAAGGCAACGGAAGAGGGAAGG - Intronic
1158127739 18:54120716-54120738 CAAAGGAAACAGAAGAAGGCTGG + Intergenic
1158181333 18:54717910-54717932 CTAATCGAACAGAAGGGGGAAGG - Intronic
1158440108 18:57467911-57467933 AAAAGGAGACAGGAGGGAGAAGG - Intronic
1158529768 18:58248730-58248752 CAAACCAAACTGGAGGGGGAGGG - Intronic
1158744495 18:60183643-60183665 CAGAGGAAACAGCAGGGATAGGG + Intergenic
1159074809 18:63668286-63668308 CACAGGGACCAGTAGGGGGATGG - Intronic
1159238753 18:65713097-65713119 AGAAAGAAACAGAAGGAGGAAGG - Intergenic
1159436996 18:68431200-68431222 CAAAGACAACAGAAGTGGGTTGG + Intergenic
1159584957 18:70275042-70275064 AAGAGGAAACATAAGGGGTAAGG - Intergenic
1159673815 18:71256261-71256283 CCAAGGAAACAGGATGGGAATGG - Intergenic
1159705973 18:71688192-71688214 CACAGCAAAGAGAAGGGGAAAGG + Intergenic
1159927385 18:74281455-74281477 AAAAGGAGACAGGAGGTGGAGGG + Intronic
1160141931 18:76332124-76332146 GAAAGGAAGGGGAAGGGGGAGGG + Intergenic
1160286306 18:77546866-77546888 TAGAAGAAACAGAAGAGGGAGGG - Intergenic
1160570803 18:79816398-79816420 CAGAGGGCAGAGAAGGGGGAGGG - Intergenic
1160637963 19:96346-96368 AAAAGGAAAGAAAAGGAGGAAGG - Intergenic
1160699614 19:499577-499599 GAAACGAAACAGAAGGGAAAGGG - Intronic
1160791888 19:927044-927066 CGAAGGGAAGAGGAGGGGGAGGG - Intronic
1160841261 19:1147912-1147934 CAAAGGACACAGCAAGGAGAAGG + Intronic
1161332837 19:3696573-3696595 CAAAGGACACAGATGGGAGGAGG + Intronic
1161689250 19:5721305-5721327 AAAAAGAAAAAGAAGTGGGAGGG - Intronic
1162021592 19:7870643-7870665 CAAAGGAGACAGAGGGGGTGAGG + Exonic
1162021626 19:7870736-7870758 CAAAGGAGACAGAGGGGGAGAGG + Exonic
1162082980 19:8230123-8230145 GAAAGGAAAGAGAATGGGGCAGG - Intronic
1162393315 19:10402749-10402771 CTAAGGATCCTGAAGGGGGACGG + Intronic
1162450827 19:10753429-10753451 AAAGGGAAAGGGAAGGGGGAAGG - Intronic
1162459955 19:10808951-10808973 CATAGGAGATAGAAGGAGGAGGG - Intronic
1162790287 19:13059312-13059334 AAAAGGAGAGAGAAGGGGAAGGG - Intronic
1163085388 19:14975890-14975912 GGAAGGAAAGGGAAGGGGGAAGG + Intronic
1163351336 19:16777890-16777912 GGAAGGAAAGAGAAAGGGGAGGG + Intronic
1164756221 19:30691742-30691764 CAAAGAAAAAAAAATGGGGAGGG + Intronic
1164856324 19:31527460-31527482 GAAGGGAAACAGAAGGGTGAGGG + Intergenic
1164969187 19:32516323-32516345 GAAAAGAAAAAGAAAGGGGAGGG - Intergenic
1165140204 19:33694940-33694962 GGAAGGGAACAGAAGGGGAAGGG - Intronic
1165426188 19:35746681-35746703 CATGGGAAACAGAAGCTGGAAGG - Intronic
1165930045 19:39351671-39351693 CAAAGTCAAGAGATGGGGGAGGG - Intronic
1166009183 19:39928404-39928426 GAAAGGAAAGAGAAGGGTGGTGG - Intronic
1166140367 19:40802158-40802180 CAGGAGAAGCAGAAGGGGGAGGG + Intronic
1166318036 19:41999426-41999448 TAAAGGGAAGAGAAGTGGGAAGG - Intronic
1166738761 19:45101717-45101739 CAAAAGAAAAAGGAGGGGCATGG + Intronic
1167163128 19:47780442-47780464 CAAGAGACAGAGAAGGGGGAGGG - Intronic
1167173391 19:47848827-47848849 CAGAGGAAACAGCTGGGGGAAGG - Intergenic
1167374601 19:49104079-49104101 AAAATGAACCAGAAGGGGGTGGG - Intronic
1167608024 19:50492215-50492237 CAAAGGAGGCAGAGGAGGGAGGG + Intergenic
1168025557 19:53641094-53641116 CAGAGGAAACAGGAGGGAAAAGG + Intergenic
1168030948 19:53679274-53679296 CAAGAGAAAAAAAAGGGGGAGGG - Intergenic
1202682847 1_KI270712v1_random:25123-25145 AAAAGTAAAGAGGAGGGGGAAGG - Intergenic
925056865 2:863070-863092 GGAAGGAAAGAGAAGGTGGAGGG - Intergenic
925424680 2:3739255-3739277 TAAATGATACAGAAGGGGGAAGG + Intronic
925625779 2:5841215-5841237 CAAAGTCAACAGAAGAGGAAAGG - Intergenic
926509895 2:13761786-13761808 CAAAGGAGGCAGAAGTGGGAAGG + Intergenic
927067828 2:19491762-19491784 GAAGAGAAACAGAAGAGGGAGGG + Intergenic
927090473 2:19706889-19706911 GAAAGGAAAATGAAGGGGGAAGG + Intergenic
927259864 2:21077426-21077448 CAAAGGAGTCAGAAGGGAGTGGG + Intergenic
927498682 2:23567203-23567225 CAGATGAAACAGAAAAGGGACGG + Intronic
927578298 2:24219077-24219099 AGGAGGAAACAGAAGTGGGATGG - Intronic
927866386 2:26590554-26590576 GAAAGGAGACAGAAAGGGAAAGG - Intronic
930084040 2:47480163-47480185 GAAAGGAAAGGGATGGGGGAAGG - Intronic
930196507 2:48516083-48516105 CAGAGAAAACAGAAAGGGCAAGG - Intergenic
930696552 2:54417217-54417239 GAAAGGAAACAGAAGTAGGAGGG + Intergenic
930752253 2:54945194-54945216 GAAGGGAGAGAGAAGGGGGAGGG - Intronic
931960392 2:67475898-67475920 CAAAGGACAAATAAGGGGAAAGG - Intergenic
932149980 2:69361985-69362007 AAAAGGAAAAAAAATGGGGAGGG + Intronic
932230493 2:70080219-70080241 AAAAAAAAACAGAAGGGGCAGGG - Intergenic
932531537 2:72539196-72539218 AAAGGAAAAAAGAAGGGGGAGGG + Intronic
932624529 2:73286778-73286800 GAAGGGAAACAGAAAGGGGAAGG - Intergenic
932668608 2:73718106-73718128 AAAAGGGAACAGAGGGAGGAGGG - Intergenic
932822585 2:74914220-74914242 AAAAGGAAAAAAAAGGAGGAAGG + Intergenic
932943943 2:76204755-76204777 CAAATTTAACAGAAGGGGGCAGG - Intergenic
933264177 2:80164646-80164668 GAAAGGAAAGGAAAGGGGGAGGG - Intronic
933811591 2:86036057-86036079 GAAAGGGAACAGGAGGGGCAGGG + Intronic
933990244 2:87628651-87628673 CAAGGGAGACAGAGGGTGGAGGG + Intergenic
934248953 2:90330051-90330073 AAAAGTAAAGAGGAGGGGGAAGG + Intergenic
934260626 2:91473425-91473447 AAAAGTAAAGAGGAGGGGGAAGG - Intergenic
934946049 2:98542814-98542836 ACAGGGTAACAGAAGGGGGAAGG - Intronic
935277057 2:101484181-101484203 CTAGGGAAGGAGAAGGGGGAAGG - Intergenic
935308483 2:101759815-101759837 AAAAGGGAAGGGAAGGGGGATGG - Intronic
935335709 2:102014028-102014050 CAAAAGAAAGAGAAGGGTGAGGG - Intronic
935521042 2:104105453-104105475 CAAAGTAAATAGATGGGGGCAGG + Intergenic
935556841 2:104519356-104519378 GAAAGGAAACAGAGGGAGGGAGG + Intergenic
936281525 2:111144530-111144552 ATAAGGAAACATAAGGGGGCTGG + Intronic
936303602 2:111322173-111322195 CAAGGGAGACAGAGGGTGGAGGG - Intergenic
936674528 2:114699787-114699809 CAGAGGAACCAGAAGGGGCAAGG + Intronic
937284759 2:120743293-120743315 CAAAGGACAAAGAAGCAGGAAGG - Intronic
937629591 2:124085544-124085566 CAAAGGTAGCAGAAGGAAGAGGG - Intronic
937721294 2:125099899-125099921 CAAAGGAAGAATCAGGGGGAAGG + Intergenic
937811866 2:126208263-126208285 GAAAGGAAACACAGAGGGGAGGG - Intergenic
937868110 2:126768979-126769001 AAAAGTAAACAGAAGAGGTAGGG + Intergenic
938313282 2:130308786-130308808 AGAAGGAAAGAGAAGGAGGAGGG + Intergenic
938389673 2:130894855-130894877 CAAAAGAAACTAATGGGGGAGGG - Intronic
938579788 2:132635622-132635644 TAAAGAAAAGAGATGGGGGAGGG + Intronic
938657332 2:133447598-133447620 GGAAGGGAACAGAAGGGGAAAGG - Intronic
939008639 2:136819436-136819458 TGAGGGAAAAAGAAGGGGGAGGG - Intronic
939115638 2:138057112-138057134 TAAAAGACACAGAAGTGGGAAGG - Intergenic
939277050 2:140012307-140012329 AAAAGGAAACATAAAGGGAAGGG - Intergenic
940110594 2:150148298-150148320 TGAAGGAAAAAGAAGGAGGAAGG + Intergenic
940159565 2:150696886-150696908 GGAAGGGAAGAGAAGGGGGACGG + Intergenic
940887462 2:159001964-159001986 CAAAGGAATGAGAAGTCGGATGG + Intronic
941078471 2:161033081-161033103 CAAAGGAAAGGGAAAGGGAAAGG + Intergenic
941087601 2:161135440-161135462 CAAAGTAAATAGAGGAGGGAGGG + Intergenic
941812842 2:169771200-169771222 GAAAGGAAACAGAAACGGGAAGG - Intronic
942076596 2:172361935-172361957 AAAAGGAAAAAGAATGGGGTGGG + Intergenic
942080051 2:172391744-172391766 CAGAGGAAAAACAAGGGGGTGGG + Intergenic
942308705 2:174633936-174633958 GGAAGGAAAGAAAAGGGGGAAGG + Intronic
942308788 2:174634819-174634841 CAAAGGAACCTGAAGGGGGAAGG + Intronic
942634704 2:177990748-177990770 AAAAGGAAAAAAAAGGCGGAGGG + Intronic
943011956 2:182460937-182460959 CAAGGAAAACAAAAGGTGGAGGG + Intronic
943409138 2:187523739-187523761 CAAAGGGAATAGAGGAGGGAAGG - Intronic
943729896 2:191291481-191291503 GAAAGGAAAGAGATGTGGGAGGG - Intronic
944654565 2:201864718-201864740 CAAAGGAAACAGAAGGGGGAAGG + Intronic
945193535 2:207215678-207215700 CAAAGGAAAAAGAAGTGTAATGG + Intergenic
945438112 2:209843127-209843149 AAAAGGAATCAGAATGGTGATGG - Intronic
945571821 2:211477508-211477530 CAAAGGAAAGAGAATGGAAAGGG + Intronic
946023830 2:216659975-216659997 CAAAGGAGTGAGAAGGTGGAAGG - Intronic
947223980 2:227822515-227822537 CAAAGGAAAAGGAAAGGAGATGG - Intergenic
947497458 2:230648352-230648374 CAAAGAAAAAAAAAGAGGGAGGG + Intergenic
948860553 2:240750728-240750750 CACAGGAGACAGGAGGTGGAGGG + Intronic
1169567349 20:6869481-6869503 AAATGGAAACAGAGGTGGGAAGG - Intergenic
1169819124 20:9689441-9689463 CAAAGGAAGAAGAGGGGTGAAGG - Intronic
1170016384 20:11786812-11786834 AAAAGGGCTCAGAAGGGGGAGGG - Intergenic
1170323183 20:15124747-15124769 CAAAGAAATGAGATGGGGGAAGG - Intronic
1170558430 20:17534614-17534636 TAATAAAAACAGAAGGGGGATGG + Intronic
1170797984 20:19566392-19566414 CACAGGAAACAGCAGGGTGTGGG - Intronic
1170936937 20:20818573-20818595 CAAAGGACCCAGAAGGGTGAAGG + Intergenic
1170948919 20:20916630-20916652 GAAAGGAAAAAGGAGGAGGATGG + Intergenic
1171152880 20:22843192-22843214 TCAAGGAAACAGAAGGAAGAGGG + Intergenic
1171157377 20:22888780-22888802 CAATGGAAACAGATTGGGGGTGG + Intergenic
1171383859 20:24753762-24753784 CAAAGGAAAAAAAAAGGGGCGGG + Intergenic
1171517641 20:25750580-25750602 CAAATGATACGGAAGGGGGAAGG - Intergenic
1171878559 20:30599850-30599872 AAAAGAAAACAGAAAGGGGTCGG + Intergenic
1172034803 20:32003156-32003178 AAAAGGAAACAGAAGAGGACAGG - Exonic
1172130084 20:32649786-32649808 TCAGGGAAACAGAAGGGGGCTGG + Intergenic
1172242054 20:33419659-33419681 CAAAGGAAAAAGAGGGGAGATGG - Intronic
1172673887 20:36653831-36653853 CAAATGATACAAAATGGGGATGG - Intronic
1173117906 20:40263452-40263474 AAAAGGTAGCAGATGGGGGAGGG + Intergenic
1173216862 20:41093449-41093471 GAAAGGGGACAGAAGAGGGAAGG - Intronic
1173522404 20:43709784-43709806 CGGGGGAAACAGAAGGGAGAGGG - Intronic
1173534045 20:43795244-43795266 TAAAGGAAACAAAAGGGGGCTGG + Intergenic
1173890682 20:46507228-46507250 CAAAGGAAAAACAAGGGAAAGGG + Intronic
1173890687 20:46507239-46507261 CAAGGGAAAGGGAAGGGGAAGGG + Intronic
1173957035 20:47041264-47041286 TAAAGGAAAGAGCATGGGGAGGG - Intronic
1174131173 20:48344221-48344243 CTAAGGAAATAGAAGTGGGAGGG + Intergenic
1174265135 20:49325786-49325808 GAAAGGAAACAGAAAGAGGGAGG - Intergenic
1174398376 20:50261771-50261793 CAAACGAAACAGAAGGGTCCTGG - Intergenic
1174636874 20:52008460-52008482 AAAAGGAAAAAAAAAGGGGAGGG + Intergenic
1174638543 20:52023020-52023042 CAAAGAAAGCAGAAGGAAGAAGG - Intergenic
1174684349 20:52439169-52439191 CAAAGGGAACAGAAGGCAAAAGG - Intergenic
1175045586 20:56101911-56101933 GAAGGAAAACAGGAGGGGGAAGG + Intergenic
1175115067 20:56676353-56676375 CAAAGGAAACAGAATGGATGTGG + Intergenic
1175128995 20:56775112-56775134 CAGGAGAAAGAGAAGGGGGAGGG - Intergenic
1175533808 20:59693286-59693308 CAAAGAGAAGAGAAGGGAGATGG - Intronic
1175593370 20:60211665-60211687 CAAAGGAAACACATGGAGAATGG + Intergenic
1178031724 21:28535297-28535319 GAAGGAAAACAAAAGGGGGAGGG + Intergenic
1178361052 21:31948720-31948742 CCAGGGAAACAGAAGCTGGAAGG + Intronic
1178644403 21:34373613-34373635 CAAAGGTAACTGAGTGGGGATGG - Intergenic
1178857211 21:36260201-36260223 GAAAGGGAAGGGAAGGGGGAAGG + Intronic
1179135763 21:38678814-38678836 CAAAGGAAAGGGAAGGGGAGGGG + Intergenic
1179246477 21:39638107-39638129 TAAATGATACTGAAGGGGGAAGG + Intronic
1179296809 21:40070211-40070233 AAAAGGAGAGAGAAGGGGAAAGG + Intronic
1179369802 21:40794392-40794414 CCAATGAAACACAAGTGGGATGG - Intronic
1179551164 21:42144914-42144936 GTATGGAAACAGAAGGAGGAAGG + Intergenic
1179671000 21:42948285-42948307 AAAAGGAAAAAAAAGGGGGCGGG - Intergenic
1180002141 21:45000034-45000056 CACAGGAAACCCAAGAGGGACGG + Intergenic
1180499999 22:15922412-15922434 CAGAGGACACAGAAGGAGGGAGG - Intergenic
1181341860 22:22187518-22187540 CAAAGGAAATAAAATGGGAAAGG + Intergenic
1181395485 22:22618387-22618409 CAAGGGACACAGAGAGGGGAGGG - Intergenic
1181410024 22:22712234-22712256 CAAAGGAAACAGAGAGAGGAGGG - Intergenic
1181904897 22:26186524-26186546 GAAAGGAAACATCAGGGGTAAGG + Intronic
1181960164 22:26617045-26617067 CAGAGGAAGCAGACGGGGAAAGG - Intronic
1182015790 22:27038648-27038670 CAGAGGAAACAGCAGGTGCAAGG + Intergenic
1182266505 22:29120015-29120037 TGAAGGAAACAGAGGGAGGAAGG + Intronic
1182344375 22:29650645-29650667 AAAAAGAAACAGAAGGGGAGGGG - Intronic
1182565800 22:31198145-31198167 TAAAGCAAACAGAATGGTGATGG - Intronic
1183383008 22:37499836-37499858 GAAAGGACACAGCAGGGAGAGGG + Intronic
1183929164 22:41226278-41226300 AAAACAAAACAGAAGGGGCAGGG + Intronic
1184210854 22:43034894-43034916 AAAAGGAAAGAAAGGGGGGAGGG + Intergenic
1184310781 22:43640999-43641021 GGAAGTAAACAGAAGGGGTATGG - Intronic
949243424 3:1897001-1897023 CAGAGGAAACAGAAGGCATAAGG - Intergenic
949271533 3:2223354-2223376 ACCATGAAACAGAAGGGGGAAGG - Intronic
949551575 3:5116244-5116266 CAAAGGGAAGGGAAGGGGAAGGG - Intergenic
950456987 3:13098610-13098632 CAGAGGAAACAGCAGTGGAAAGG + Intergenic
950661954 3:14472179-14472201 GAAAGGAAAGAAAACGGGGAGGG - Intronic
950837605 3:15935774-15935796 AAAAGGAAACAGAGGGAGCAAGG - Intergenic
950907364 3:16551567-16551589 CAAAGGAAGAAAAAGAGGGAAGG + Intergenic
951795925 3:26538228-26538250 AAAGGGAAGGAGAAGGGGGAGGG + Intergenic
952949925 3:38514767-38514789 CAAAAAAAAAAGCAGGGGGAGGG - Intronic
953150147 3:40317198-40317220 CAGAAGAAATTGAAGGGGGACGG + Intergenic
953336415 3:42098118-42098140 GAAAGGAGACAGCAAGGGGAAGG - Intronic
953474703 3:43195474-43195496 CAAGGGAAACAGAGGTGGGGAGG - Intergenic
954457891 3:50609858-50609880 CAAAGGAAGGAGCTGGGGGAAGG + Intronic
955281721 3:57600438-57600460 AAAAGGGAACAGAAGGGGGAAGG - Intergenic
955774482 3:62418764-62418786 CAAAAGAGATAGAGGGGGGAAGG - Intronic
956626674 3:71273535-71273557 CAAGGAAGACTGAAGGGGGATGG - Intronic
956631487 3:71320990-71321012 CAAAGGAAATAGAATGAGCAAGG + Intronic
956856376 3:73279035-73279057 CAAAGGAAACAGGATGAGAATGG - Intergenic
957019426 3:75108404-75108426 CCAAGGAGAGAGAAGGGGAAGGG + Intergenic
958687553 3:97419326-97419348 CAAACAAAACAGAAGGGGTCAGG + Intronic
958734578 3:97993799-97993821 AAAAGGAAAGGGAAGGGGGAAGG - Intronic
958766282 3:98372117-98372139 GAAAGGAAAGGGAAAGGGGAAGG + Intergenic
958772113 3:98437391-98437413 AAAAGAAAGCTGAAGGGGGAGGG + Intergenic
958822576 3:98992464-98992486 CAGAGGAAACTGAAGGGAGAGGG - Intergenic
958869188 3:99537233-99537255 CAAAGAAGACAGAAAGTGGAGGG - Intergenic
959143878 3:102520793-102520815 CAAAGGAAACAAAATCGGAAAGG - Intergenic
959369470 3:105504876-105504898 TAAATGATACAGAAGGGGGAAGG - Intronic
959480231 3:106863925-106863947 CAAAGGAAACAAATCGGGAAGGG + Intergenic
960136488 3:114110774-114110796 AGAAGGAAAGTGAAGGGGGAAGG + Intergenic
960190333 3:114696747-114696769 CCAATGAAAGAAAAGGGGGAGGG + Intronic
960213431 3:114999215-114999237 GAAAGGAAAGGAAAGGGGGAGGG + Intronic
960213446 3:114999276-114999298 GAAAGGAAAGGAAAGGGGGAGGG + Intronic
960456965 3:117884196-117884218 AGAAGGAAACAGAGTGGGGAAGG + Intergenic
960486818 3:118262978-118263000 TAAAGGAAACAAGAGCGGGAAGG - Intergenic
960883070 3:122365791-122365813 CAAAGGAAACTGCAGGGCAAAGG - Intronic
961203676 3:125063853-125063875 GAGAAGAAACAGAAGAGGGAAGG - Intergenic
961605826 3:128094744-128094766 CGAAGGAAAGAGAGGGGGAAGGG - Intronic
962381204 3:134899426-134899448 CAGAAGAAACAGCAGGGCGAAGG - Intronic
962557160 3:136565140-136565162 GAAAGGAAAGAGAAGGGAAAGGG + Intronic
962832560 3:139157446-139157468 CAAAACAAACAGAAGGGCCAAGG - Intronic
962856994 3:139355954-139355976 CAATAGAAACAGACAGGGGAGGG + Intronic
963550250 3:146711777-146711799 AAAAGGAGACAGAAGAGGAAGGG - Intergenic
963642362 3:147876506-147876528 AAAAGGAAACAAAAGTGGGTAGG - Intergenic
963734577 3:149005306-149005328 AATAGGAAAAAGAGGGGGGAAGG + Intronic
964422798 3:156521791-156521813 CAAAGGAAACAAAAGTGTGTTGG - Intronic
964445236 3:156751422-156751444 GAAAGGAAAGAGAAGGGGAAAGG - Intergenic
964969451 3:162542036-162542058 GAAAGGAAAAGAAAGGGGGAAGG - Intergenic
964988543 3:162775091-162775113 GAAAAGAAAAACAAGGGGGAGGG - Intergenic
965141715 3:164845850-164845872 GAAAGGAAACAGAATAGGTAAGG + Intergenic
965347146 3:167565650-167565672 CAAAGGAAACAGCAGTGCAAAGG + Intronic
965878597 3:173360028-173360050 GAAAGGAAAGAGAAAGGGAAGGG - Intergenic
966958564 3:184910093-184910115 CAAAGAAAAGAGAAAGAGGAAGG - Intronic
967246985 3:187497833-187497855 CAGAGGGAACAGAAAGGGGTAGG - Intergenic
967467230 3:189821972-189821994 CTAAGGAAACAGGAGGGTGTAGG + Intronic
967526413 3:190499333-190499355 CACAGAAAACAGAAGAGGAAGGG - Intergenic
967603872 3:191420957-191420979 CAAAGAAAACAGATCGGGGAAGG + Intergenic
967667422 3:192189881-192189903 CAAAGGAAAGAGGAAAGGGAGGG - Intronic
967909313 3:194528054-194528076 CAAAAGAAAGAGAAGGGCGGGGG - Intergenic
968257306 3:197287622-197287644 AAAAGGAAAAAGGAGGAGGAAGG + Intronic
968476429 4:811770-811792 CAAAGGACAGAGAAGCAGGAAGG - Intronic
968529297 4:1082126-1082148 AAAAGGAAAAGGAAGGGGAAAGG + Intronic
968620037 4:1599918-1599940 GAGAGGAAATAGGAGGGGGAGGG - Intergenic
969630951 4:8335888-8335910 TATAGGTAACAGAAGAGGGAAGG + Intergenic
970382288 4:15519961-15519983 CACATGAAACAGAATGGGGTGGG + Intronic
970641125 4:18067212-18067234 CATAGGAAACAGTAAGGGAAAGG - Intergenic
970652737 4:18196511-18196533 GAAAGCAAAAAGAAGAGGGAAGG - Intergenic
970755986 4:19427776-19427798 CAAAGGAAGAAGAAAGGGAATGG + Intergenic
970767198 4:19563952-19563974 ATAAGGAAACAGAAGGGCGGGGG - Intergenic
970924868 4:21439667-21439689 CAAAGCAAGAAGAAGGGAGAAGG - Intronic
971095517 4:23398002-23398024 CAAAGGAAACAAAAGTCAGAGGG - Intergenic
971153789 4:24061431-24061453 CAAAGGAAGTAGAAGCAGGATGG - Intergenic
971439174 4:26661323-26661345 GTAAGGAAAAAGAAGGTGGAGGG - Intronic
971473466 4:27050974-27050996 TGAAGGATGCAGAAGGGGGAGGG - Intergenic
972191580 4:36598540-36598562 GAAAGGAAACAGAAGAAGGTAGG + Intergenic
972199483 4:36696851-36696873 CAAAGGAAGCAGAATGGGCAAGG - Intergenic
972356544 4:38284511-38284533 CAATGGAAATGAAAGGGGGATGG + Intergenic
972899324 4:43663301-43663323 CAATTTAAACAGAAGCGGGAAGG - Intergenic
973897860 4:55433872-55433894 CAAAGAAAAAAGAAGGGGTAGGG - Exonic
974018592 4:56673046-56673068 CATGGGAAACAGAAAGGGAAAGG - Intronic
974385804 4:61201164-61201186 AAAAAGAAAGAGAAGGGGGGTGG + Intergenic
974508545 4:62807725-62807747 CAATGGGAACAAAAGGGGGCTGG + Intergenic
974838442 4:67276927-67276949 CAAAGCCATCAGAAAGGGGAAGG - Intergenic
976080078 4:81345924-81345946 CAAAGGAAACAGAGGTGTGATGG - Intergenic
976353995 4:84093870-84093892 CAAAGGAGAAAGAAAGGGAAAGG - Intergenic
976848057 4:89512600-89512622 CATAGGAATCAGAAGGGTTAGGG + Intergenic
977004463 4:91547530-91547552 AAAAGTAAACAGAAGGAAGAAGG - Intronic
978070339 4:104459760-104459782 TAAAGGAAAGAGAAGGAAGAGGG - Intergenic
978193026 4:105938140-105938162 TAAAGAAAATAAAAGGGGGAAGG - Intronic
978270185 4:106879117-106879139 GAAGGGAAACAGAATGGGAAGGG + Intergenic
978331545 4:107618571-107618593 AAGAGGAAACAGAAGGTGGTGGG + Intronic
980332683 4:131429863-131429885 TAAAGTAAAGAGAAGGGGTAGGG - Intergenic
981145309 4:141317053-141317075 CAAAGGAAACACAATGGGTTGGG + Intergenic
982317736 4:154048309-154048331 CAAAGGATACAGGAGGAGGGTGG + Intergenic
982465159 4:155721460-155721482 CAGAGGAAGCAGAAAGTGGAAGG - Intronic
982606585 4:157523798-157523820 CAAATGAAACAAAGGGGGTAAGG + Intergenic
982778541 4:159466407-159466429 GAAAGGAAAGGGAAAGGGGAGGG - Intergenic
982804677 4:159748991-159749013 AAAAGGAAAGGGAAAGGGGAAGG - Intergenic
982959609 4:161820727-161820749 CAAAGGAGCCAGAAGATGGAAGG + Intronic
983034201 4:162842414-162842436 CAAAGAAAACATAAGGGGTGAGG - Intergenic
983090216 4:163494155-163494177 GAAAGGAAAGAGAAGAGGGGCGG + Intergenic
983671408 4:170241850-170241872 CCAAGGAAATAGAAGGAGGCTGG - Intergenic
983967244 4:173827909-173827931 AAAAACAAACAGAAGGGGGCAGG - Intergenic
984769605 4:183425945-183425967 CTGAGGACACAGGAGGGGGAGGG - Intergenic
984859024 4:184220123-184220145 GAAAGGAAAGGGAAAGGGGAAGG + Intronic
984911352 4:184676726-184676748 GAAAGGGAAGGGAAGGGGGAAGG - Intronic
984911361 4:184676748-184676770 GAAAGGGAAGGGAAGGGGGAAGG - Intronic
984911381 4:184676799-184676821 AAAAGGGAAGGGAAGGGGGAAGG - Intronic
984911489 4:184677053-184677075 GAAAGGAAAGGGAAAGGGGAAGG - Intronic
985854852 5:2416794-2416816 ATAGGGAACCAGAAGGGGGATGG - Intergenic
986359519 5:6962973-6962995 CAAATGAAACAGAAGAGTGGAGG + Intergenic
986374182 5:7113606-7113628 CAAAGGACCCAGAAGAGGAAGGG + Intergenic
986686243 5:10277801-10277823 CAAAGGACTCAGCAGAGGGAAGG + Intronic
986735169 5:10662846-10662868 TAAAGGAAAGAGGAGGGTGACGG - Intergenic
987219875 5:15780099-15780121 CAAAGGGAGCTGAAGGGGAAGGG + Intronic
987397988 5:17443576-17443598 CAGGGGAGACAGAAGGGAGATGG - Intergenic
988349951 5:30089518-30089540 CAAAGCAGTCAGAAGTGGGATGG + Intergenic
988427775 5:31083596-31083618 CAAAGGAAAGGAAAGGAGGAAGG + Intergenic
989069746 5:37497523-37497545 GAAAGGAAAGGGAAGAGGGAAGG - Intronic
989756219 5:44958781-44958803 AGAAGGAAAAAGAAGGAGGAAGG - Intergenic
990918110 5:60932871-60932893 AAAGGGAAAGAGAAGAGGGAAGG + Intronic
991195851 5:63931202-63931224 CAAAGGAAAGAGAAGCTTGATGG + Intergenic
991236586 5:64406641-64406663 CAAAAGAAAAAAAAGGGGGTCGG + Intergenic
991646658 5:68807937-68807959 GAAAGGAAGGAGAAGGGGAAGGG + Intergenic
991971818 5:72148682-72148704 AAAAGGAAACAGGAACGGGAAGG + Intronic
992203909 5:74411330-74411352 GAAAAGAAACAGAAAGTGGAAGG - Intergenic
992457908 5:76933137-76933159 CAAAGGAGAGAGAAAGAGGAAGG + Intergenic
993029849 5:82693715-82693737 CAGAGGAAATATAAGGGGAATGG - Intergenic
993136570 5:83974239-83974261 CAAAGGAAGTGGAAGGGGCATGG + Intronic
993415731 5:87627766-87627788 AAAATGAAACAGAATGAGGAGGG + Intergenic
994056545 5:95423019-95423041 GAAAAGAAACAGGAGAGGGAGGG - Intronic
994141668 5:96348231-96348253 GAAAGGTAACAGAAGAAGGAAGG + Intergenic
994164854 5:96597925-96597947 AAATGGAAAAAGAAGGGGGGAGG + Intronic
994346042 5:98687467-98687489 AAAGGGAAGCAGAAGGAGGAAGG + Intergenic
994996350 5:107068202-107068224 CAAAAGAAACAGAAATGGGCAGG + Intergenic
995156163 5:108915743-108915765 CAAAAGAAACAGGTGAGGGAAGG + Intronic
995442432 5:112206623-112206645 AAAAGCAAAGAGAAGGGAGAAGG + Intronic
995456207 5:112354978-112355000 CAAAATAAACAAAAGGAGGAAGG + Intronic
995502724 5:112825492-112825514 CAAAGGAAACAGCATGTGAAAGG - Intronic
995532638 5:113106485-113106507 CAAAGGAAACAGCAAAGGAAAGG - Intronic
996087576 5:119320659-119320681 AAAAAGAAAAAGAAGGGGGCCGG - Intronic
996337033 5:122395663-122395685 CACACAAAACAGAAGGGGGCAGG - Intronic
996382898 5:122880075-122880097 CAAAGTAAACAGAAGGTTGGAGG - Intronic
997413546 5:133708110-133708132 GAAGAGAAAGAGAAGGGGGAGGG + Intergenic
997680440 5:135746446-135746468 CAAAGGCGACAGAATGGAGAAGG - Intergenic
997889823 5:137665845-137665867 GAAAGGAAAGGGAAGGGGAAAGG + Intronic
997908513 5:137844640-137844662 CAAAGGAAATAGAAGTTTGAGGG + Intergenic
998951301 5:147395516-147395538 AAAAGATAAGAGAAGGGGGAAGG - Intronic
998964746 5:147527097-147527119 CAAAGGAAACAGAAAGCAGTAGG - Intergenic
998993894 5:147849533-147849555 CAAAAGAAATAGAAGTTGGAAGG - Intergenic
999524162 5:152384154-152384176 GAAAGGAAAGAGAAGAAGGAAGG - Intergenic
999537004 5:152528682-152528704 ATAAGGAGCCAGAAGGGGGATGG + Intergenic
999758523 5:154682850-154682872 AAAAGGAGAGAGAAGTGGGATGG - Intergenic
1001266432 5:170277840-170277862 AAGAGGAAAGAGAAGGAGGAAGG + Intronic
1001520179 5:172385681-172385703 CAAATGGACCAGAAGGGGAAGGG + Intronic
1001555035 5:172631340-172631362 CAAAGCAAACAGGAGTGGCAGGG + Intergenic
1001798578 5:174523487-174523509 TAAAGAAAAGAGAAGAGGGAAGG + Intergenic
1001838484 5:174852920-174852942 CAAAGGACAGTGGAGGGGGATGG + Intergenic
1001859686 5:175043075-175043097 CATAGGCAACAGAAAGGAGATGG - Intergenic
1002367138 5:178722500-178722522 AAAAGCAAACAAAAGGGAGATGG - Intronic
1002687852 5:181028313-181028335 TAAATGATACGGAAGGGGGAAGG - Intergenic
1002890271 6:1325948-1325970 AAAAGGAAAAAAATGGGGGAAGG + Intergenic
1002905903 6:1449070-1449092 CAAAGGAGACAGCAGAAGGATGG - Intergenic
1003721973 6:8713606-8713628 CAAATGAAACATAAGTGGCAAGG + Intergenic
1003903047 6:10673045-10673067 CAAAGGAAACTCAAAAGGGATGG - Intronic
1003959651 6:11197234-11197256 AAAAGCAAACAGAGGGGGAAAGG - Intronic
1004320412 6:14627599-14627621 TAAAAGAAATAGAACGGGGATGG + Intergenic
1004354795 6:14921562-14921584 CAAATGAGGGAGAAGGGGGAAGG + Intergenic
1004582684 6:16969711-16969733 GAAAGAAAAGAGAGGGGGGAGGG + Intergenic
1004662599 6:17723371-17723393 CAAAGGGAAGATAAGGTGGAGGG + Intergenic
1004682130 6:17906415-17906437 AAAGGGAAAGGGAAGGGGGAAGG - Intronic
1004986914 6:21092653-21092675 CAAAGCAAACAGAATAGGAATGG + Intronic
1005300554 6:24466046-24466068 CAAAAGAAACAGATGGAGGCTGG + Intronic
1005352203 6:24947712-24947734 AGAAGGAAAAAGTAGGGGGAAGG + Intronic
1005471127 6:26163689-26163711 AAAAAGAAAGAGAAAGGGGAAGG + Intronic
1005726218 6:28651248-28651270 CAAAAAAAAAAGTAGGGGGATGG + Intergenic
1006095177 6:31651908-31651930 CCCCGGAATCAGAAGGGGGATGG - Intronic
1006616583 6:35332133-35332155 CACAGGAAGCAGAAGGGGTTGGG + Intergenic
1006748096 6:36359143-36359165 CAGATTAAACAGAAAGGGGATGG + Intronic
1006822997 6:36913419-36913441 AAAAGGACACAGAAGAGGAAAGG - Intronic
1007267756 6:40610044-40610066 GAATGGAGACAGAAGTGGGAGGG - Intergenic
1007372429 6:41434952-41434974 CACAGGAAGCGGAGGGGGGAGGG - Intergenic
1007408133 6:41646428-41646450 CACAGGCAGCAGAAAGGGGAAGG + Intronic
1007620799 6:43213386-43213408 CAAAGGAAAGAAAAGGAAGAGGG - Intronic
1007961748 6:45966644-45966666 AAAAGGAAACAAAAAGAGGAGGG - Intronic
1008124751 6:47655650-47655672 CTAAGGAAACAAAATGAGGAAGG + Intergenic
1008335659 6:50301773-50301795 CATAGTAAACAGAAATGGGATGG - Intergenic
1008803686 6:55401953-55401975 AAAAAGAAACAGAGAGGGGAGGG - Exonic
1008862977 6:56173369-56173391 CAAAGGAAAGGGAAAGGAGAAGG + Intronic
1008891510 6:56497869-56497891 CAAAGGAAGCAGCAGCTGGATGG - Exonic
1008938286 6:57016660-57016682 AAAAAGAGACAGAAGAGGGAGGG - Intronic
1009484476 6:64202752-64202774 AAGAGGAAAGAGAAGGGGAAAGG + Intronic
1009543696 6:64999446-64999468 TAAATGATACAGAAGGGGGAAGG + Intronic
1009773554 6:68176338-68176360 GAAAGAAAAGAAAAGGGGGAAGG - Intergenic
1009865269 6:69390138-69390160 TAAAGGAAATACCAGGGGGAAGG + Intergenic
1010982307 6:82382100-82382122 CAAAAAAAAAAGAGGGGGGAGGG - Intergenic
1010987802 6:82445731-82445753 AAAAGGAAAAAGAGGGGAGAAGG - Intergenic
1011143293 6:84184605-84184627 CAAAGGAAACAGAGTGAGGTTGG - Intronic
1011463306 6:87628794-87628816 CAAAAGAAACAGAAAGAGGTGGG - Intronic
1011717822 6:90125612-90125634 CAATGGAAAAAAATGGGGGACGG + Intronic
1012406134 6:98900911-98900933 CAAAGGAAGCAGCAGTGAGAGGG - Intronic
1012533331 6:100265165-100265187 CAAAGGGAACACAAAGGGAAAGG + Intergenic
1012611150 6:101222624-101222646 GAAGGGAAGCAGGAGGGGGAGGG - Intergenic
1013036771 6:106392538-106392560 CACAGGAAAGAGATGGTGGAGGG + Intergenic
1013800268 6:113933519-113933541 GAATGGAAATAGAAGTGGGAAGG - Exonic
1014489491 6:122044679-122044701 CAGAGGAAAAAAAAGGGGGAGGG - Intergenic
1015186373 6:130421041-130421063 CAGATGAAACAGAAGGGGAGGGG - Intronic
1015282688 6:131450797-131450819 CCAAGAAAACAGAAGGAGGTTGG - Intergenic
1015498509 6:133906423-133906445 CAAAGGAAACTGGAGTGGAAGGG + Intergenic
1015619986 6:135121248-135121270 AAAAGGAAACAGACAGAGGAAGG + Intergenic
1015906304 6:138120821-138120843 CAAAAGAAATAGACGTGGGAGGG - Intergenic
1017124474 6:151052460-151052482 CAAGGGATACAGAAGAAGGATGG + Intronic
1017541713 6:155409338-155409360 CAGAGGAAACCGATGGGGGTGGG + Intronic
1017647912 6:156556097-156556119 CAAAGGAAACTGAAAAGGGAAGG - Intergenic
1017820144 6:158043286-158043308 ACAAGGAAACAGAAAGGGAAAGG - Intronic
1017842165 6:158231561-158231583 CAAATTTAACAGGAGGGGGAAGG + Intergenic
1018461689 6:164004770-164004792 AAAAAGAAAAAGAAGAGGGAGGG + Intergenic
1019265175 7:111115-111137 CGAAAGAAACAGAAGGAGCATGG - Intergenic
1019647807 7:2140341-2140363 CAAAGGACCCTGAAGGGTGAAGG + Intronic
1019654152 7:2179572-2179594 CAGAGGGAACAGAATGGGGCTGG + Intronic
1020002994 7:4766158-4766180 GAAAGCAAGCAGAAGAGGGATGG - Exonic
1020133780 7:5574658-5574680 GGAAGGAAACGGAAAGGGGAAGG + Intergenic
1020345372 7:7156642-7156664 CAAAAGCAACAGAAAGGAGATGG - Intergenic
1020749289 7:12120168-12120190 CATAGTGAACAGATGGGGGATGG + Intergenic
1021073992 7:16277936-16277958 AAAAGGAATGAAAAGGGGGATGG + Intronic
1021312396 7:19110627-19110649 GAAGGAAAACAGGAGGGGGATGG + Intronic
1021638684 7:22716992-22717014 CAAGGGAAACAGAGAGGAGAAGG - Intergenic
1021989941 7:26131413-26131435 TGAGGGAAACAGAAGGGGAATGG + Intergenic
1022012414 7:26320367-26320389 CAAGGTAAACAGAAGTGGGATGG - Intronic
1022052567 7:26692113-26692135 CAAAGGAAATGGAAAGGAGATGG + Intronic
1022095142 7:27135705-27135727 CAAAGGCAACAGAATGGTGCAGG - Intronic
1022291591 7:29009731-29009753 CAAAGAAAAAAGAAAGGGGATGG + Intronic
1022492637 7:30832583-30832605 CCCAGGAAACAGAGGGCGGAGGG - Intronic
1022971101 7:35518144-35518166 CAAAGACTACAGAAGGGGAAGGG + Intergenic
1023155074 7:37242071-37242093 GAGAGGAAAAAGAATGGGGAAGG - Intronic
1023188993 7:37559153-37559175 AAAAAGAAAGAGAAGGAGGAGGG - Intergenic
1023859599 7:44210203-44210225 CACAGGAAACAAAAGGCGGTGGG - Intronic
1023911998 7:44562912-44562934 CAAAGGATACAGAAGATGGAGGG - Intergenic
1024161209 7:46678375-46678397 TAAAGAATACTGAAGGGGGAAGG - Intronic
1024360444 7:48462445-48462467 ATAAGGAAACAGTAGGGGGGGGG - Intronic
1024737714 7:52323437-52323459 GGAAGGGAACAGAATGGGGAAGG - Intergenic
1024808293 7:53175837-53175859 CAAAGGAAACAATAGGCAGAGGG + Intergenic
1024997676 7:55285950-55285972 TAAAGGAAACAGAATGAGGCAGG + Intergenic
1025035270 7:55589713-55589735 CACAGAAAAGAGAAGGGTGAGGG - Intergenic
1025092459 7:56075097-56075119 CAAAAGAAAAAGCGGGGGGATGG + Intronic
1025614238 7:63104580-63104602 CAAATGAAACAGACGGGGCATGG - Intergenic
1026154977 7:67818839-67818861 GAAAGGAAAGGGAAGGAGGAGGG - Intergenic
1026969876 7:74461288-74461310 CACAGGGAACAGGAGGGGAAAGG - Intronic
1027837566 7:83264613-83264635 CAAATGAAAAAGAAGGGGAAGGG + Intergenic
1028157383 7:87446963-87446985 CAAAGAAAAGAGAAGGTAGATGG + Intronic
1028406756 7:90483770-90483792 TAAAGGAAACAAAATGGTGAGGG - Intronic
1028455070 7:91029638-91029660 TGCAGGAAACAGAAGGGGAAGGG - Intronic
1028611520 7:92717355-92717377 GAAAGGAAAGGGAAAGGGGAAGG + Intronic
1028655980 7:93207519-93207541 GAAAGGCAAAAGAAGGAGGAAGG + Intronic
1029089303 7:98035614-98035636 AAAAAGAAAGAGAAGGGGGTTGG + Intergenic
1029409283 7:100398449-100398471 GAAAGGAAAGAGAGGTGGGAGGG - Intronic
1029646480 7:101859957-101859979 GGAAGGAAAAAGAAAGGGGAAGG - Intronic
1029670788 7:102029322-102029344 CACAGGGAACACATGGGGGAAGG + Intronic
1029977959 7:104851952-104851974 GAAAGGAGACAGAAGGGAGGAGG - Intronic
1030235354 7:107253932-107253954 TAAAGGATAGAGAATGGGGATGG - Intronic
1030319935 7:108155557-108155579 CCAAGGGAACAGAAGCAGGAAGG - Intronic
1030360087 7:108586622-108586644 GAAAGGAAAGGGAATGGGGACGG - Intergenic
1030814156 7:114013628-114013650 AAAAGGAAAAGGAAGGGGAAGGG + Intronic
1031329290 7:120443997-120444019 CTAAGGAAACAGCAGGAGCAAGG - Intronic
1031445233 7:121845697-121845719 AAAAGGAAAGAGAGGGGAGAAGG + Intergenic
1031467100 7:122126153-122126175 CAAAGGAAAAAGCAGGGAGAAGG - Intronic
1031483618 7:122304950-122304972 CAGAGGAAGCAAAAGGGGGGTGG - Intronic
1031912482 7:127532724-127532746 GGAAGGAAAGAGAAGGGGAAAGG + Intergenic
1031970617 7:128062399-128062421 AAAAGGAAAGAGAAGGGGCAAGG + Intronic
1032782286 7:135173046-135173068 AAAAGGAAAGAAAAGGGGGGAGG + Intergenic
1033038686 7:137898994-137899016 GAAAGGAAGGAGAAGGGGAAAGG + Intronic
1033132867 7:138760069-138760091 CAAAGAAAACAGAAGGTCAAAGG - Intronic
1033608786 7:142946129-142946151 CAAAGTTAATAGAAGAGGGAAGG + Intronic
1033884734 7:145931572-145931594 AAAAGGACACTGAAGGTGGAAGG + Intergenic
1033891768 7:146021683-146021705 TAAAGGAAACAGAAGGCATAGGG - Intergenic
1034119877 7:148617494-148617516 GAAAGGAAAAAGAAGGGAGGAGG + Intergenic
1034672099 7:152866714-152866736 GAAGGGAAACAGGAAGGGGAAGG - Intergenic
1035263302 7:157675081-157675103 CAAAAGAAACAGTAGGCGGTGGG - Intronic
1035304876 7:157925525-157925547 CAAAGGAAGCTGGAGGGAGAGGG - Intronic
1035368788 7:158365393-158365415 CAAAGGGAAGAGAAGGGGAAGGG - Intronic
1036035148 8:5010508-5010530 CAAAGGAAACAGACGGATAAAGG + Intergenic
1036057644 8:5275903-5275925 CAAAGGAAACAGAAGAAGGAAGG - Intergenic
1036172038 8:6496530-6496552 GAAAGGAAAAAGGCGGGGGAAGG - Intronic
1036210995 8:6841399-6841421 CACAGCAGACAGAAGAGGGATGG - Intergenic
1036919372 8:12836648-12836670 CTAGTGATACAGAAGGGGGAAGG - Intergenic
1038169298 8:25114250-25114272 GGAAGGAAACATTAGGGGGATGG + Intergenic
1039047843 8:33466449-33466471 GAAAGGAAAGAGAAAGGAGAAGG + Intronic
1039640555 8:39216496-39216518 TGAAGGAAACAGAAAGGGAAGGG - Intronic
1039716243 8:40112648-40112670 CAAATGAAAGAGAGGGGGCAAGG + Intergenic
1039798102 8:40932642-40932664 CAAAGGCAAGAGAAGGGAGGTGG - Intergenic
1039854317 8:41399190-41399212 CAAAGGAAACAGAGAGGGAGTGG - Intergenic
1040095924 8:43442436-43442458 CAAAGGAAGATAAAGGGGGAAGG - Intergenic
1040564804 8:48555894-48555916 CAAAAGAAAGAGAAAGAGGAGGG - Intergenic
1040696968 8:50011654-50011676 CAAAGGAAACAGAAGGAACCAGG - Intronic
1040720018 8:50308574-50308596 AAAAGAAAACAGAAGGAAGATGG - Intronic
1041242911 8:55863639-55863661 AAAAAGAAAGAGAAGAGGGAAGG + Intergenic
1041578983 8:59434644-59434666 GAAAGAAAACATAAGGGGAAAGG + Intergenic
1042337795 8:67646782-67646804 CAAAGGAAACACAAGCGCAAAGG + Intronic
1042734591 8:71974193-71974215 AAAAGTAAAGAAAAGGGGGAGGG + Intronic
1043610609 8:82057920-82057942 AAAAGGAAACATCAGGGAGAAGG - Intergenic
1043665820 8:82811720-82811742 CTAAGGAAACAGAAGTGAAATGG + Intergenic
1044123110 8:88422811-88422833 AAAAGGAAACATCAAGGGGAAGG - Intergenic
1044550023 8:93501562-93501584 GCAAGAAAACAGAAGGAGGAAGG - Intergenic
1045455663 8:102376445-102376467 GCCAGGAAACAGAAGAGGGAGGG + Intronic
1045629018 8:104094480-104094502 CAAAGGGAATAGAAGAGGGAGGG + Intronic
1046516202 8:115264807-115264829 CAAAAGAAACAGGAGGGGTATGG - Intergenic
1046541692 8:115591710-115591732 CAAAGGAAACAGAAAGTGCAGGG + Intronic
1047432552 8:124805412-124805434 CAGAGGAAGCAGGAGAGGGAAGG + Intergenic
1047531081 8:125676013-125676035 CTAAGGAAACAGCAGGAGAATGG + Intergenic
1047640973 8:126821231-126821253 TAAATGATACGGAAGGGGGAAGG - Intergenic
1047691341 8:127357862-127357884 CAAAGGATAGAAAAGGGGAAAGG - Intergenic
1047752613 8:127893073-127893095 CAAAGGACACAGAATGGTTATGG + Intergenic
1047767772 8:128003306-128003328 CAGAGGAGACAGAAGGGGAGGGG - Intergenic
1047953200 8:129952720-129952742 CAAAGCAAACAGAAGGCTCATGG + Intronic
1048072515 8:131037651-131037673 AGAAGGAAAAAGAAGGAGGAAGG + Intronic
1048258775 8:132926934-132926956 CAAAGGAAACAGAAGATCAAAGG - Intronic
1048520677 8:135151471-135151493 TAAAGGAAAGAGAAGGAGGGAGG + Intergenic
1049052455 8:140209431-140209453 TTAAGGACAGAGAAGGGGGACGG - Intronic
1049300840 8:141868566-141868588 TAAAGGCAGCAGAAGTGGGAAGG - Intergenic
1049352566 8:142171952-142171974 CAAATGACTCAGAAGGGTGAGGG + Intergenic
1049451542 8:142664706-142664728 GAAGGGAGGCAGAAGGGGGACGG - Exonic
1049932522 9:470558-470580 GAAAGGAAGCAGGAGGAGGAGGG + Intronic
1050737321 9:8779041-8779063 AAAGGGAAAAAGAAGGTGGAGGG + Intronic
1050818118 9:9840791-9840813 AAAAAAAAACAGAAAGGGGAAGG + Intronic
1051012558 9:12436252-12436274 CAAAAGACTCAGAAGGGGGAAGG - Intergenic
1051072405 9:13187562-13187584 AAAAAGAAAGAGAAGGAGGAGGG - Intronic
1051251435 9:15162651-15162673 CAAAGGAAAGACAAGCAGGAAGG + Intergenic
1051485821 9:17606697-17606719 GAAAGAAAACAGAAGGTGGCAGG - Intronic
1051539003 9:18193516-18193538 TAAAGGAAAAAGAGTGGGGAGGG - Intergenic
1051563034 9:18464276-18464298 CATATGACACAGAAGGGAGAGGG - Intergenic
1051932565 9:22404566-22404588 CAAAGGTAATTGAAGGGGAAAGG + Intergenic
1054943659 9:70771557-70771579 AAAAGGAAACTGAAGGTGGGTGG + Intronic
1054983745 9:71237077-71237099 GAAAGGAAAGGGAAGGGGGATGG + Intronic
1055003546 9:71480941-71480963 CAAAGCAAACAGGAAGGAGAAGG - Intergenic
1055241130 9:74187840-74187862 CACAAGACAAAGAAGGGGGATGG + Intergenic
1055298870 9:74862444-74862466 CAAAGGAGAAAGAAGGGAAATGG + Intronic
1055954231 9:81759222-81759244 CAGAGGAAAGAAAAGGGGAAAGG - Intergenic
1057006122 9:91561879-91561901 TTAAGAAAACAGAAGTGGGATGG + Intergenic
1057490081 9:95513790-95513812 GGGAGGAAACAGAAGGTGGAAGG - Intronic
1057516607 9:95727274-95727296 AAGAGGAAAGAGAAGGGGGGTGG - Intergenic
1058115434 9:101079388-101079410 GAAAGGATACACAAGAGGGAAGG + Intronic
1058129916 9:101239852-101239874 CAAAGGAAACAACAGTGTGAAGG - Intronic
1058605320 9:106715392-106715414 TAAAGGAAAAAGATGGGAGAGGG + Intergenic
1058663652 9:107289115-107289137 GAAAGGAGAGGGAAGGGGGAAGG - Intronic
1059207809 9:112483198-112483220 CAAAGGTGACAGCAGGGGGTTGG - Intronic
1059575795 9:115486945-115486967 CAGAGGCAAAAGAAGTGGGATGG - Intergenic
1059811656 9:117861889-117861911 AAAAGGGAAGAGAAGGGTGAGGG - Intergenic
1059902120 9:118939501-118939523 CAAAACAACCAGAGGGGGGAAGG + Intergenic
1060606261 9:124917188-124917210 CAAAGGAAAAAGGAATGGGATGG + Intronic
1060838811 9:126778286-126778308 CAAAGAAAAGAAGAGGGGGAGGG - Intergenic
1061332613 9:129905602-129905624 CAAAGGAAATAGAAGCGGCTGGG - Intronic
1061525568 9:131158783-131158805 AAAGGGAAACAGAATGGGTATGG - Intronic
1062050606 9:134444641-134444663 GAAAAGAAAGAGAAGAGGGAAGG - Intergenic
1062050630 9:134444725-134444747 AGAAGGAAGGAGAAGGGGGAAGG - Intergenic
1062069428 9:134547609-134547631 GAAAGGTAACAGAAGGGTTATGG + Intergenic
1062709334 9:137965328-137965350 CACAGGACACAGGAGGGGCAGGG - Intronic
1185684556 X:1917645-1917667 CAAAAGAAAAAGAAGGGGGGGGG + Intergenic
1185966470 X:4610683-4610705 GAAAGGAAAAAGAAGGAGGAAGG + Intergenic
1186129020 X:6446349-6446371 AAGAGCAAACAGAAGGGGAAGGG - Intergenic
1186161234 X:6779103-6779125 GAAAGCAAAGAGCAGGGGGAGGG + Intergenic
1186228734 X:7429562-7429584 AAAAGGATAAAGAAGGTGGAGGG + Intergenic
1186610747 X:11135949-11135971 CAAAGGGGCCAGAATGGGGATGG - Intergenic
1186980193 X:14950380-14950402 CAAAGAACTTAGAAGGGGGAAGG + Intergenic
1187009994 X:15268975-15268997 CAAAGGGAGCAGCAGGGTGAGGG - Intronic
1187144693 X:16626767-16626789 CAGAGGTCACAGAAGGGGAAGGG - Intronic
1187323011 X:18257952-18257974 GAGAGGAAAGGGAAGGGGGAAGG + Intronic
1187460924 X:19486027-19486049 CAAACGGAAAAGAAGTGGGATGG - Intronic
1187827484 X:23346426-23346448 AAGAGGAAACATCAGGGGGAAGG + Intronic
1187948118 X:24446240-24446262 CAATGGAAACAGAGGTTGGAGGG + Intergenic
1188036679 X:25325891-25325913 CCAAGAAAACACAAGGGGAACGG - Intergenic
1188817875 X:34737802-34737824 CAAAGCTAACAGAAGCCGGAAGG + Intergenic
1189110517 X:38285844-38285866 GAAAGGGAAAAGGAGGGGGAAGG - Exonic
1189265224 X:39710301-39710323 CAAAGGAAAAGGAAAGGGGATGG + Intergenic
1189317015 X:40063641-40063663 CAAAGGCAACAGAAGCTGGTCGG - Exonic
1189528179 X:41848737-41848759 CAAAGGAGGCTGAATGGGGATGG - Intronic
1189739661 X:44104999-44105021 AAAAGGAAACTGAGGCGGGAAGG - Intergenic
1189857548 X:45238455-45238477 GAGAGGAAACAGAACGGGGCAGG + Intergenic
1189892794 X:45622972-45622994 CAAAAGAAAAAGAATGGAGAGGG + Intergenic
1190053470 X:47169039-47169061 CAAAGAATAGAGTAGGGGGAGGG + Intronic
1190323017 X:49189292-49189314 CAAAAGACACAGAAAGGAGAGGG + Intronic
1190379712 X:49828209-49828231 AAAAGGAAACATCAGGGGTAAGG + Intergenic
1190447840 X:50547700-50547722 GAAAGGAGAAAGAAGAGGGAGGG + Intergenic
1190810724 X:53880926-53880948 AAAAGGAAAACAAAGGGGGAAGG - Intergenic
1192778361 X:74268589-74268611 CAAAGGAAACTGAAGCTGAAAGG + Intergenic
1193085271 X:77443314-77443336 CAAAGAAAACAGAAGGAGAGAGG + Intergenic
1193234568 X:79091117-79091139 CAAAGGAAACAGCTGAGGGCAGG + Intergenic
1193347835 X:80424509-80424531 CAAAGGAAACAAAAGGGAATGGG - Intronic
1195350647 X:103993280-103993302 ACAAGAAAACAGAAGAGGGAGGG + Intergenic
1195666951 X:107440439-107440461 CTGAGCAAACAGAAGAGGGAGGG + Intergenic
1195763495 X:108272118-108272140 CAATGGAAACAGAGAGGGGCAGG - Intronic
1196341156 X:114600029-114600051 AAAAGGAAAGAGAAAGGGAAAGG + Intronic
1196569512 X:117249065-117249087 CAAGGGAAATAGGAGGTGGAGGG - Intergenic
1197326584 X:125101989-125102011 CAAAGAAAAAAGAGTGGGGAAGG + Intergenic
1197384151 X:125782764-125782786 CAGAGGAAACAGAAAGGGATGGG - Intergenic
1197551292 X:127895933-127895955 CAAATGAAACACAAGAGGTAAGG + Intergenic
1197711872 X:129677574-129677596 CTAAGGAAACAGGAGGAAGAAGG + Intergenic
1198217778 X:134572006-134572028 AAAAGGAAACAGCAGGGAAAAGG + Intronic
1198433879 X:136596278-136596300 CAAAGGAAACAGAAATGCAAAGG + Intergenic
1198576227 X:138012886-138012908 CAAAACAAACGGAAAGGGGAGGG + Intergenic
1198621024 X:138509989-138510011 CAAAGAATACACAATGGGGAAGG + Intergenic
1199805871 X:151299868-151299890 AAGAGGAAACAGAATGGGCAGGG - Intergenic
1201595196 Y:15660488-15660510 CAAAGCAAGAAGAAGGGGGAAGG - Intergenic
1201731639 Y:17210850-17210872 CAAAGGAGCTGGAAGGGGGATGG - Intergenic
1201942392 Y:19473938-19473960 CAAAGGCAACAGAAGCTGGTTGG - Intergenic
1202378903 Y:24259946-24259968 CAAGGGAAACGGATGGTGGAAGG - Intergenic
1202491879 Y:25410175-25410197 CAAGGGAAACGGATGGTGGAAGG + Intergenic