ID: 944654769

View in Genome Browser
Species Human (GRCh38)
Location 2:201866618-201866640
Sequence TCTTGTCTTTGGAAGGAGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 508
Summary {0: 1, 1: 0, 2: 6, 3: 47, 4: 454}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944654769 Original CRISPR TCTTGTCTTTGGAAGGAGAA GGG Intronic
901004375 1:6164799-6164821 TCTGGTTCTTGGAAGGGGAAGGG - Intronic
901379165 1:8861424-8861446 TCAATTCTTGGGAAGGAGAAAGG + Exonic
901874894 1:12161817-12161839 CCTCTTCTTTGGAAGGAGATGGG + Intergenic
902161648 1:14535262-14535284 TCTTGTCACAGGGAGGAGAAGGG - Intergenic
905321453 1:37120251-37120273 TCATCTTTTTGGAAGCAGAAGGG - Intergenic
907534483 1:55137317-55137339 TGCTGATTTTGGAAGGAGAATGG + Intronic
907746847 1:57222254-57222276 TCATGTATTTTGAAGGAGCAAGG - Intronic
908074204 1:60496266-60496288 TCTTGGCTTTGGGAGCAGAAGGG + Intergenic
908179620 1:61591012-61591034 TCATGTCTTTTGAAGGAACATGG + Intergenic
908580992 1:65516902-65516924 CCTTGCCTTTGGAAGGGAAAAGG - Intronic
908725201 1:67168353-67168375 TCCTGCATTTGGAAGGAGATTGG - Intronic
909571358 1:77115485-77115507 ACCAGTATTTGGAAGGAGAAGGG + Intronic
909775842 1:79483721-79483743 GTTCGTCTTTGGAAGAAGAAAGG + Intergenic
910726259 1:90342678-90342700 TCTAGTGTTTGAAAGGGGAAAGG + Intergenic
911256783 1:95642339-95642361 CCTTGTCTCTAGAAGGAGACAGG - Intergenic
911556171 1:99347394-99347416 TCTAGTCTTCCAAAGGAGAAAGG - Intergenic
913442833 1:118917254-118917276 TCATGTCCTTGGAAGGAACATGG + Intronic
914679964 1:149932118-149932140 TCTGCTCTTTAGAAGGAGGAGGG - Intronic
914860666 1:151383242-151383264 CCCTGTCTCTGGAAGAAGAAAGG + Intergenic
916438146 1:164795929-164795951 TTTTGTTTTTGGAGGGATAAGGG - Intronic
917382747 1:174432265-174432287 TCATATCTTTTGCAGGAGAATGG - Intronic
919851548 1:201676368-201676390 TTCAGTCTTGGGAAGGAGAAAGG - Intronic
920355971 1:205372919-205372941 ATTTGTCTCTTGAAGGAGAATGG - Intergenic
921111518 1:212042666-212042688 TTGTCTCTTTGGTAGGAGAAGGG + Intronic
921254965 1:213330770-213330792 TCTTTTCTTGAGAAGGTGAACGG + Intergenic
921496372 1:215847076-215847098 ACTGGTCTTTGAAAGGATAAGGG - Intronic
921555262 1:216591180-216591202 TCTTCTCTTTGGAAGTTGATGGG - Intronic
923327741 1:232895885-232895907 TCTTTTCATGGGGAGGAGAATGG - Intergenic
1063725989 10:8638184-8638206 ACTTGTCTTTGGGAGGGGCAGGG - Intergenic
1065602554 10:27384488-27384510 TCCTTTCTTTGAAAAGAGAAAGG - Intergenic
1065777286 10:29132593-29132615 TCGTGTTTCTGGGAGGAGAAGGG - Intergenic
1065982289 10:30911901-30911923 TCTGGCATTTGGAAGGAGGAGGG - Intronic
1066312379 10:34210521-34210543 TCTTCTCCTTGTAAGTAGAAAGG - Intronic
1068080318 10:52311290-52311312 ACATGTCTTAGGAAGGAGAGAGG - Intergenic
1068776068 10:60869740-60869762 TCTTATCGATGGAAGGAGAAAGG - Exonic
1069944338 10:71975616-71975638 TCTCTTCTCTGGAAGGAGCACGG + Intronic
1070156989 10:73841297-73841319 TCTTATTATGGGAAGGAGAAGGG + Intronic
1071131251 10:82396101-82396123 TCCAGTCTTTGAAAGGAGTATGG - Intronic
1072090648 10:92123840-92123862 GGTTGTCTTTCAAAGGAGAATGG - Intronic
1072280235 10:93859322-93859344 TCTTGGGTTTGGAAGGGCAAGGG + Intergenic
1072573784 10:96681202-96681224 TGGTGTCTTTAGAAGGAGAGGGG - Intronic
1074671750 10:115799366-115799388 CCTTTTCTCAGGAAGGAGAAGGG + Intronic
1074679689 10:115892271-115892293 TATTTCCTTTGGAAGGAGTATGG + Intronic
1076839028 10:133036247-133036269 TCTTGCTTTTGGGAGGAGGAAGG - Intergenic
1077195662 11:1278802-1278824 TCTTGTTTGAGGAAGAAGAAAGG - Intronic
1077588259 11:3471246-3471268 TCTTGTGTCTGGAATGAGACTGG + Intergenic
1078735346 11:14014531-14014553 TCTGGAGTTTGGGAGGAGAAAGG + Intronic
1078837566 11:15045829-15045851 TCTGGTCCTTGGAAAGAGGAAGG + Intronic
1078866286 11:15301130-15301152 GCTTGGCTTTGCAAGGAGATGGG + Intergenic
1078954888 11:16181547-16181569 TTTTTTTTTTGGAAGGGGAAAGG - Intronic
1079336556 11:19575356-19575378 TCTTGCCATTGCAATGAGAAAGG + Intronic
1080263529 11:30376578-30376600 TCTTGTCTATGGCATGAGAAGGG - Intergenic
1080634634 11:34112873-34112895 TCTTGTCTTTTTTGGGAGAATGG - Intronic
1080854305 11:36098544-36098566 TATTGTGTTTGGAATGGGAATGG - Intronic
1080967390 11:37229081-37229103 TCTTGTCCTTGGTTGGAAAATGG + Intergenic
1084828734 11:71751691-71751713 TCTTGTGTCTGGAATGAGACTGG - Intergenic
1085210173 11:74769571-74769593 AGTTGTCTTTGATAGGAGAAGGG + Intronic
1085567494 11:77527600-77527622 TCTTGGCTTTGGAATCAGAAAGG - Intronic
1085592584 11:77778092-77778114 TCCTGTCTTGGGAAGGGGAGGGG + Intronic
1085929941 11:81069922-81069944 TGTTGTGTTTGCAAGGAGAAGGG - Intergenic
1086951153 11:92891192-92891214 CATTGTCTGTGGAATGAGAAGGG + Exonic
1087722763 11:101685335-101685357 ACTTGACTTTGGAATTAGAAAGG + Intronic
1088635939 11:111820655-111820677 TCTTGTCTGTGAATTGAGAAAGG - Intronic
1089043501 11:115477354-115477376 TCTTGTCCTTGGGAAGAGAATGG - Intronic
1089056609 11:115590742-115590764 TTTTCTCTTAGGAAGGTGAATGG + Intergenic
1089653541 11:119930991-119931013 TAGAGTCTTTGGAAGGAGCATGG - Intergenic
1089981509 11:122776655-122776677 CCTTGTCTTTGGAGGGACATGGG + Intronic
1090233100 11:125124256-125124278 GCTTTTCTTTGGAAGGAGAAAGG + Intergenic
1090599186 11:128352771-128352793 TATAGTCTTTGGGAGGAGAGGGG - Intergenic
1090799943 11:130164117-130164139 AGTTGTCTTTGGAAGAGGAAGGG + Intronic
1090968145 11:131616258-131616280 TCTTGGGTGAGGAAGGAGAAAGG - Intronic
1091150159 11:133320969-133320991 TCCTGTTTATTGAAGGAGAATGG - Intronic
1091237473 11:134031704-134031726 CCTTGTCTGTGGCAGGTGAATGG - Intergenic
1091546265 12:1503258-1503280 TCTTGTGTTTGGAGGAGGAAGGG - Intergenic
1091564201 12:1636026-1636048 TCTTGTCTTGGAAGGTAGAAAGG - Intronic
1091774564 12:3175968-3175990 GCTTGTACTGGGAAGGAGAAAGG - Intronic
1092018500 12:5180283-5180305 TGTTTCCTCTGGAAGGAGAAGGG - Intergenic
1092414514 12:8280004-8280026 TCTTGTGTCTGGAATGAGACTGG + Intergenic
1092474831 12:8809555-8809577 TCTGGTGTCTGGAAGGAGACTGG - Intergenic
1093056219 12:14558409-14558431 TATTGCCTTTGGGTGGAGAAGGG - Intronic
1093127106 12:15343803-15343825 TCTGGTCTGAGGCAGGAGAATGG - Intronic
1093244931 12:16724516-16724538 TCATCTCCTTGGAAGGAAAAGGG - Intergenic
1093967854 12:25345970-25345992 TTTTGCTTTTGGAAGGAGACTGG - Intergenic
1094198921 12:27778436-27778458 TTTTACCTTAGGAAGGAGAAAGG - Intergenic
1094373951 12:29770271-29770293 TACTGTTTTTGGAAGGAGAAAGG - Intronic
1094468975 12:30785020-30785042 TATTTTCCTTGGAAGCAGAAGGG + Intergenic
1094605101 12:31943028-31943050 TTTTGCCTTTGGGAGAAGAAGGG + Intergenic
1095634005 12:44409857-44409879 TCTTATTTTTGGTAGGAGGAGGG + Intergenic
1096200769 12:49680935-49680957 TGTTTTCTTTGTAAGGAGATGGG - Intronic
1098259187 12:68650357-68650379 TCTTTTCTTTAGAAGTATAATGG + Intronic
1099171844 12:79374356-79374378 TTTTCTCTTTGGTAAGAGAAAGG - Intronic
1099713550 12:86261893-86261915 TCTTGTTCTTATAAGGAGAAAGG + Intronic
1099997015 12:89789077-89789099 TCTAGTCTTTTGAAAAAGAAAGG + Intergenic
1100029262 12:90165922-90165944 AGGTGTCTTTGGAAGTAGAATGG - Intergenic
1100255569 12:92879820-92879842 CCTTATCTGTGGGAGGAGAATGG - Intronic
1100287758 12:93183568-93183590 TCATGTCTTTGGCAGGAACATGG - Intergenic
1101208461 12:102512759-102512781 CCTTCTGTTTAGAAGGAGAAAGG - Intergenic
1101530803 12:105571638-105571660 TATGGGCTTTGGAAGGAGAGGGG - Intergenic
1103770256 12:123317007-123317029 TCTTTTCTTTTGGTGGAGAAAGG + Intronic
1103967440 12:124648871-124648893 TCTTTTCTTTGGAATGTGCAGGG - Intergenic
1104225485 12:126828537-126828559 TCATGTCTTTGGCAGGAAAATGG + Intergenic
1104257419 12:127151955-127151977 TGTTCTCTTGGGAATGAGAAAGG + Intergenic
1104292297 12:127481764-127481786 TCTTGTCTTGGGAAGGAGATGGG + Intergenic
1104496030 12:129239974-129239996 TCTTCTCTTTGCAAGGAAAAGGG + Intronic
1106121957 13:26867397-26867419 TTTTGTCTTTGTATGGAGAATGG - Intergenic
1106947464 13:34844905-34844927 ACTTGTTTTAGGAAGCAGAAGGG + Intergenic
1107293321 13:38882086-38882108 CCTTGGCTTTGGGAGGTGAATGG - Exonic
1107673232 13:42768410-42768432 TTTTCTCTCTGGTAGGAGAAAGG + Intergenic
1107882965 13:44849456-44849478 TCTTGTCTATTGAAGCGGAACGG + Intergenic
1107934396 13:45332990-45333012 TCTTGTCTCTTGAAAGAGAAAGG - Intergenic
1108096666 13:46908902-46908924 TAGTGTCATTGAAAGGAGAAAGG + Intergenic
1108187730 13:47905079-47905101 TCTTTTGTTTGCAAGCAGAAAGG + Intergenic
1109263183 13:60167247-60167269 TCCTGTCTTGGGCAGGTGAAAGG - Intergenic
1109460163 13:62645748-62645770 TCTTGGCTTTAGAAGGAGCCAGG - Intergenic
1110876618 13:80517933-80517955 TGTTATCCTTTGAAGGAGAAGGG - Intergenic
1111179501 13:84644465-84644487 TCTTGTCTTCATAAGTAGAATGG - Intergenic
1111586409 13:90289174-90289196 TCATGTCTTTGTAAGGAGAGAGG + Intergenic
1114787100 14:25613421-25613443 TCTTGTCTTTTGCAGGAACATGG + Intergenic
1114839003 14:26240315-26240337 TCTTATCTTTGGAAGGATTCTGG - Intergenic
1115227813 14:31122877-31122899 TCCTATCTTTGTAAAGAGAATGG + Intronic
1115307625 14:31948606-31948628 CCTTGTGTTTGGTAGGACAATGG - Intronic
1116535689 14:46026486-46026508 TCATGTCTTTTGCAGGAGCATGG - Intergenic
1116580147 14:46630485-46630507 TCTTGGCTGAGGCAGGAGAATGG + Intergenic
1117026872 14:51629618-51629640 TGATGTCTTTAGAAGCAGAAAGG + Intronic
1118878547 14:69806330-69806352 TGTTCTCTTTGGTAGGAGAGAGG + Intergenic
1120645939 14:87074086-87074108 TCTTATCTATGGAACGTGAAAGG - Intergenic
1120819459 14:88898789-88898811 GCTTTTCTTTCAAAGGAGAACGG + Intergenic
1121048802 14:90806502-90806524 TCTTGTGTGTGGAAGTAGGATGG - Intronic
1121415122 14:93774179-93774201 TCTTGCCTTTGCCAGAAGAAGGG + Intronic
1121444995 14:93973112-93973134 TCTTCTCTTTGTATGGAGTAGGG + Intronic
1121563012 14:94888048-94888070 ACTTGTCCTTGGAAGGAGGAGGG - Intergenic
1121958449 14:98236494-98236516 TGTTGTCATTGAAAGGAGAGGGG - Intergenic
1122583844 14:102790187-102790209 TCTTGTATATGGAATGAGATAGG + Intronic
1123214375 14:106792640-106792662 TCCTGCCTGTGGAAGCAGAATGG - Intergenic
1124192477 15:27592379-27592401 TCTTTTCTTTGGAAGTTTAAGGG - Intergenic
1124548706 15:30657224-30657246 GCTTGTCTTTGGAAAGAGATAGG + Intronic
1124700902 15:31910930-31910952 ACAGGTCTTTGAAAGGAGAATGG + Intergenic
1126166814 15:45660476-45660498 GCTTCTCTTTGTAAGGAGACTGG + Intronic
1126580096 15:50234805-50234827 GCCTGTCATTGTAAGGAGAAAGG - Intronic
1126615680 15:50577100-50577122 TCCTGTCTTTGGCAGGGGAGGGG + Intronic
1126951553 15:53887169-53887191 GTTTGTGTGTGGAAGGAGAAGGG + Intergenic
1127713922 15:61628842-61628864 TCTTATCTTTTGAAAAAGAAAGG + Intergenic
1127942548 15:63714250-63714272 TATGGACTTTGGAAGGGGAAAGG - Intronic
1129352273 15:74963031-74963053 TGGTGTCTGTGGAAGGGGAAAGG + Intronic
1129949896 15:79576366-79576388 TCTTGAATTTATAAGGAGAAAGG + Intergenic
1130154881 15:81341673-81341695 TCTTATCTTTAGAAGGTGGAGGG - Intronic
1130523043 15:84678653-84678675 TTTTGTGTGTGAAAGGAGAATGG - Intronic
1130563182 15:84974597-84974619 TCTTGTGTGAGGGAGGAGAATGG + Intergenic
1131386798 15:92014759-92014781 CCTTCTCTGTGGAGGGAGAAGGG + Intronic
1131796678 15:96024728-96024750 TCTAGGCATTTGAAGGAGAATGG - Intergenic
1132087415 15:98919644-98919666 ACTTGTCTTAGGAGAGAGAAAGG - Intronic
1132313503 15:100874396-100874418 TCTTGAATTTTGAAGGAGATTGG + Intergenic
1132947816 16:2541925-2541947 TCTTCTCTTAGTGAGGAGAAAGG + Intronic
1132966625 16:2659412-2659434 TCTTCTCTTAGTGAGGAGAAAGG - Intergenic
1133060655 16:3172315-3172337 TCTGGGGTTGGGAAGGAGAAGGG - Intergenic
1133063515 16:3190256-3190278 TCCTGGTTTTGGAAGGAGTACGG + Intergenic
1133214715 16:4284837-4284859 TCGTGACTTTGAAAAGAGAAGGG - Intergenic
1133494136 16:6299999-6300021 CCTTGTCTTTTGAAGCTGAATGG - Intronic
1133561266 16:6952637-6952659 TCTTTTTTTTGGAGGGAGGAGGG - Intronic
1133710890 16:8400207-8400229 TCATGTCTTTTGAAGGAACATGG + Intergenic
1134272082 16:12741724-12741746 TGTTGTCTTTGAGAGGAGAGAGG - Intronic
1134817119 16:17214937-17214959 TCCTGTCTTTGGAAAAGGAAAGG - Intronic
1135654486 16:24235822-24235844 TCTTGGCTTTGGGAGGAAGAGGG - Intergenic
1138768122 16:59628624-59628646 TCTTGTCTTTGGAAGGGCAATGG + Intergenic
1139704929 16:68734760-68734782 TTTTGTCTTTTGATGGAGGACGG + Intergenic
1139707255 16:68749750-68749772 ACCTGGTTTTGGAAGGAGAAAGG - Intronic
1140376528 16:74449394-74449416 TCTTCTCTTGGGAAGGCCAAGGG + Intergenic
1140982479 16:80124129-80124151 TCTTCTCTGTGGAAAGACAATGG - Intergenic
1140990108 16:80202561-80202583 TCTTGTCTTTTGAGGGAAAAGGG - Intergenic
1141109992 16:81264550-81264572 TCTGGTTTTTCAAAGGAGAAAGG - Intronic
1141214984 16:82015046-82015068 TCTTGGCTCTGGATAGAGAAAGG + Intergenic
1141813791 16:86395457-86395479 CCTTGTCTCAGGAAGGACAATGG - Intergenic
1143308321 17:5967251-5967273 TTATGGCTTTGGAAAGAGAATGG - Intronic
1143840793 17:9730216-9730238 TTTTCTCTTAAGAAGGAGAATGG + Intergenic
1144224347 17:13130551-13130573 TCATGTCTTTGGAGGGAATATGG + Intergenic
1145779188 17:27550819-27550841 TCTAGTCTTGAGAAGGAGGATGG + Intronic
1146198406 17:30832493-30832515 TCCTGACTTTGTAAGGGGAAAGG + Intronic
1146597092 17:34178966-34178988 TTTTTTTTTTGGAAGGAGAAAGG - Intergenic
1147843581 17:43389452-43389474 TGTTGTGTTAGGAAGGAGGACGG - Intergenic
1148252575 17:46096995-46097017 TCGTGTCTTTGGGAGGCTAAAGG - Intronic
1148261499 17:46187931-46187953 TCTTGTCTTTGGTAGAATAAAGG - Intronic
1148369257 17:47083243-47083265 TCATGTCTTTGGGAGGCCAAAGG - Intergenic
1148736752 17:49869418-49869440 TCTTCTCCTGGGAAAGAGAATGG - Intergenic
1148879765 17:50716986-50717008 TCTGGCCTTTGATAGGAGAAAGG - Intergenic
1149423700 17:56534610-56534632 CCCTGTCTTTGGAGGGAAAATGG + Intergenic
1149539800 17:57460424-57460446 TCCTGTCTTTGGAAGGAAAGAGG + Intronic
1149676353 17:58466289-58466311 ACTTTTCTTTTTAAGGAGAAAGG - Intronic
1150451730 17:65274562-65274584 TTTTGTCTTTGAAAAGGGAAGGG - Intergenic
1150940708 17:69690717-69690739 TGTTTCCTTTGGAAAGAGAAGGG + Intergenic
1153534274 18:6083964-6083986 TATTGTCTTGTGAAGGGGAATGG - Intronic
1153611239 18:6887384-6887406 TCTTGTCTTCCTCAGGAGAAGGG - Intronic
1154043318 18:10880276-10880298 TCTGGTCTTTGACAGGAGAATGG - Intronic
1154424109 18:14258953-14258975 TCTTCCCTTTGGATTGAGAAAGG + Intergenic
1156020514 18:32594741-32594763 AATTGTCTTTGGTAGGGGAAAGG + Intergenic
1156706105 18:39884339-39884361 TCTTCTCTATGGGAGGTGAAAGG - Intergenic
1156939857 18:42754201-42754223 TCTTGTATTGTAAAGGAGAAGGG + Intronic
1157062289 18:44305678-44305700 TCATGTCTTTGGAGGGACATGGG + Intergenic
1157139700 18:45093527-45093549 TCATGTCTTTTGCAGGAGCATGG + Intergenic
1157198100 18:45636412-45636434 TCTTTTCCTTGGAAGGAGAATGG - Intronic
1157342681 18:46793501-46793523 TGATGTTTCTGGAAGGAGAATGG - Intergenic
1157909440 18:51601643-51601665 TCTTGTATGTGAAAAGAGAAAGG - Intergenic
1158551546 18:58440248-58440270 TCCTGTCCTGAGAAGGAGAAGGG - Intergenic
1159083176 18:63758637-63758659 TCTGGTCATTGGAGGGAGCAGGG - Intronic
1159849514 18:73510912-73510934 TCTTGTATCTGGCAGGAGAAGGG - Intergenic
1159970859 18:74650472-74650494 ACTTGTCTGTGGATGCAGAAAGG - Intronic
1160040096 18:75337419-75337441 TCTTCTGTTAGGAAGGAAAAAGG + Intergenic
1160128099 18:76197894-76197916 TCTTGTCTCTGGGTGGGGAAAGG - Intergenic
1160814039 19:1027153-1027175 TCTTAGCTTTGGGAGGGGAAGGG + Intronic
1163661577 19:18581085-18581107 TATTGTCTTTGGTAAGGGAAAGG - Intronic
1163675064 19:18651575-18651597 TGTTGTCTTTGGAAGGTGCTGGG + Intronic
1165039018 19:33055691-33055713 TCTTCTCTCTGCAAGGAGCAGGG - Intronic
1166126401 19:40717535-40717557 ACTTGTCTTTGGACGGAGACCGG + Exonic
1168665591 19:58202621-58202643 TCATGTCTGTGGAATGAGATGGG + Intronic
926212702 2:10882965-10882987 TCCTCTCCTGGGAAGGAGAATGG + Intergenic
928900947 2:36316910-36316932 TCTGATCTTTGGAAGAAGACTGG + Intergenic
930605721 2:53491033-53491055 TTTTGTCTTTGTAAGGAAAATGG - Intergenic
931960043 2:67472265-67472287 TCTTGTAATTGCAAGGACAATGG + Intergenic
931989182 2:67772361-67772383 TCTGGTCTGTGAAAGGAGATTGG - Intergenic
932114434 2:69033506-69033528 TCTTTTCTTTGGAAGAAGCTGGG + Intronic
933321344 2:80779323-80779345 TCTTTTCTTGTGAAGGGGAATGG + Intergenic
933488801 2:82958446-82958468 ACATGTCTTTGGAAGAAGACAGG - Intergenic
933849642 2:86355540-86355562 TCAGGTCTTTGGAACAAGAAAGG + Intergenic
935065526 2:99643958-99643980 TGTTGCCTTTGCAAGGAGAAAGG - Intronic
935384666 2:102487752-102487774 TCTTTTCTTTGTCAGGAGATGGG + Intronic
936809822 2:116384506-116384528 TCTTGCCTCTGGCAGGGGAAAGG - Intergenic
936834682 2:116694299-116694321 TCTTATCTATGAAAGGGGAAGGG + Intergenic
937458488 2:122065215-122065237 TCAAGTCTTTGGAAGCATAATGG - Intergenic
937814435 2:126235808-126235830 ACTTGGCTTTAGAAGGAAAAGGG - Intergenic
937854814 2:126664627-126664649 TCTAATATTTGGGAGGAGAAGGG + Intronic
938688408 2:133763388-133763410 TCTTGTCCTTGTCAGGAGACAGG - Intergenic
938692295 2:133802707-133802729 TCATGCCTTTGAAAGGAGGAGGG + Intergenic
941453185 2:165684466-165684488 TCTTGCCTTTGAAAGCACAAAGG - Exonic
942635084 2:177994965-177994987 TATTGTCTTAGGAAAGGGAAAGG + Intronic
942896837 2:181067280-181067302 TTTTCTCTTTGGAAGGAGGTAGG + Intronic
942963972 2:181866995-181867017 TCATGTCTTTTGAAGGAACATGG + Intergenic
943016911 2:182523985-182524007 TCTTGTCTGAGAAAGGAAAATGG - Intergenic
943045044 2:182850532-182850554 TCCTGTCATTTGAAGGAAAATGG - Intronic
944654769 2:201866618-201866640 TCTTGTCTTTGGAAGGAGAAGGG + Intronic
944708610 2:202315761-202315783 TCTTGTATATGGAACAAGAAGGG - Intergenic
945638079 2:212384474-212384496 TTGTCTCTTTGGAAGCAGAATGG - Intronic
945683791 2:212944699-212944721 TCTAGTCTTATGAAGTAGAAAGG - Intergenic
945954441 2:216072676-216072698 TCTTGTCTTTTGCAGGAACATGG - Intronic
946465694 2:219910026-219910048 TGTGGTATTTGGATGGAGAAGGG + Intergenic
946539684 2:220670568-220670590 TCAAATCTTTGGAAGCAGAACGG + Intergenic
946800667 2:223412988-223413010 AATTCTCTTGGGAAGGAGAAGGG + Intergenic
947247571 2:228066563-228066585 TGTTCTCTCTGGAAGGTGAAGGG - Intronic
1168917610 20:1504085-1504107 ACTTCTCTTTGGGAGGGGAAAGG - Intergenic
1169923666 20:10760452-10760474 TCTTGTCACTAGAAGGAGGAAGG + Intergenic
1170044232 20:12068440-12068462 TCAAGTCTTAGGAAGGAGAATGG + Intergenic
1170579588 20:17687765-17687787 TCTTGTCTTGGGAAAAGGAAGGG + Intergenic
1170812440 20:19685085-19685107 CTTTGTCTCTGGAAAGAGAAAGG - Exonic
1171013125 20:21519207-21519229 TCTTTTTTTTGGAATGAAAAAGG + Intergenic
1172321845 20:34000976-34000998 ATTTATCTCTGGAAGGAGAAAGG + Intronic
1172718803 20:36983785-36983807 CCTTGGCTTTTGGAGGAGAAGGG - Intergenic
1172886615 20:38235491-38235513 TCCTGGCTTTGGTAGGAGCAAGG + Intronic
1173280616 20:41623698-41623720 ACATGTCCTTGGAAGGAAAAAGG + Intergenic
1173342195 20:42162565-42162587 CCATGTCTTTGGAAGGAGGTTGG - Intronic
1174762993 20:53225005-53225027 TTTTGTCTTTGCAAGCAGTATGG + Intronic
1175116213 20:56684414-56684436 TCTTTTCTTGGGATGGAAAAGGG - Intergenic
1177262203 21:18744995-18745017 TCTTGACTGAGGAATGAGAAAGG - Intergenic
1177323881 21:19557914-19557936 TCTTGTCTTTTTAAGGTGATAGG - Intergenic
1177345254 21:19859250-19859272 TCTTGTAATAGGAAGGAAAAAGG + Intergenic
1177448506 21:21232505-21232527 TCATGTCTTTGGCATCAGAAGGG + Intronic
1178137645 21:29645984-29646006 TCTTCTCTTTGGAATGTGCAAGG - Intronic
1178523278 21:33303789-33303811 TCTGGCCTTTGGCAGGAGGAGGG + Intergenic
1179961469 21:44769339-44769361 ACTCGTATTTGGAAGGAGATGGG - Exonic
1182234425 22:28864367-28864389 TCTAGTCTTTGGAGGGAGGATGG + Intergenic
1182409877 22:30175341-30175363 TTTTTTCTTTGGAAGGAAAATGG - Intronic
1182940938 22:34276590-34276612 TCTTGTCTGTAGAAACAGAAAGG + Intergenic
1182998968 22:34838994-34839016 TCTGGTGTCTGGAAGGAGACTGG - Intergenic
1183575066 22:38682724-38682746 TCCTGTCTCTGGTAGGAGTATGG + Intronic
1184149206 22:42628749-42628771 TACTGTCTTGGGAAAGAGAAGGG + Intronic
1184426085 22:44410096-44410118 CCATGCCTTTGGGAGGAGAAAGG - Intergenic
1184989207 22:48155882-48155904 TCTGGACTTTGGATGGAGCAGGG + Intergenic
1185102833 22:48850666-48850688 TCTTCTCTTTAGATGGAAAAGGG + Intronic
949433091 3:3999530-3999552 TCTTGTCTTTTGCAGGAACATGG + Intronic
949653812 3:6193259-6193281 TCTTGTTTTTGGCAGGAGGAGGG - Intergenic
949845187 3:8362539-8362561 ATTTGTCTGTTGAAGGAGAAGGG + Intergenic
951543065 3:23801268-23801290 TTTTTTCTTTGGATGGAAAAAGG + Intergenic
951750381 3:26028344-26028366 TCTTGGCTCTGGGAGCAGAAGGG - Intergenic
951838995 3:27013351-27013373 TCTTGTCTTTGTATGAAAAAGGG + Intergenic
952872351 3:37912139-37912161 TGTTGTCTTTGGAGGGAGTGAGG + Intronic
953921164 3:46952810-46952832 TCTCATCTGTGGTAGGAGAAAGG - Intronic
954653474 3:52179303-52179325 TGGGGCCTTTGGAAGGAGAATGG - Intergenic
954785317 3:53088305-53088327 TCTTGACTTTGGAAGAGGGATGG - Intronic
955112188 3:55960137-55960159 TCTTGCTGTTGGATGGAGAATGG - Intronic
955159638 3:56451664-56451686 TCTTGTCTATGAATGGATAATGG + Intronic
956240975 3:67130251-67130273 TCTTGCCTTGGAAAGGAGCAAGG + Intergenic
956606559 3:71078854-71078876 TCTTGTGCTTCCAAGGAGAAGGG - Intronic
957474717 3:80708526-80708548 TTTTGTTTTTGTAAGTAGAAGGG + Intergenic
957611198 3:82468975-82468997 TCTCCTCAATGGAAGGAGAATGG - Intergenic
958687738 3:97422035-97422057 TATTTTCCTTGTAAGGAGAAAGG - Intronic
958907839 3:99961469-99961491 TCTTAACTTTGCAAGGAGACAGG + Intronic
959309325 3:104713031-104713053 TCTTGGTTTGGGAAGCAGAAGGG + Intergenic
959321246 3:104878039-104878061 TTGTGTCTTTGACAGGAGAAAGG - Intergenic
959425861 3:106187651-106187673 TCTGGTCAGGGGAAGGAGAAGGG - Intergenic
959831704 3:110870382-110870404 TCTTGTTTTTGGTGGGAGAAGGG - Intergenic
960174862 3:114505025-114505047 GCTTCTCTTTGGAAGCAGACAGG + Intronic
961724468 3:128917308-128917330 TCTAGGATTTGGAAGGAGCAGGG - Intronic
961892061 3:130138625-130138647 TCTTGTGTCTGGAATGAGACTGG + Intergenic
962005275 3:131343328-131343350 TTTTGTCTTTGATAGGAGCAGGG + Intronic
962994423 3:140611408-140611430 CCCTGTCTTTGGAAGGTGAATGG - Intergenic
963336098 3:143974010-143974032 TCTTGTCATGGAAAGGAGCACGG - Intronic
963343030 3:144060582-144060604 TCTTGACTTTAGAAGAAGAGAGG + Intergenic
964376686 3:156054981-156055003 TGTGGAGTTTGGAAGGAGAATGG - Intronic
964616808 3:158674707-158674729 TCTTTTCTTTTCAAGGAGAGAGG - Intronic
964774679 3:160262706-160262728 TTTTGTCTTTAGGAGGAAAAGGG + Intronic
964907886 3:161740765-161740787 TTTTGGCTTTGGATGGTGAAAGG - Intergenic
964959235 3:162403721-162403743 TTTTGCCTTTGGAAGAGGAAGGG + Intergenic
965492889 3:169361454-169361476 CCTTGACTTTGGAAGGATGATGG + Intronic
965750548 3:171970711-171970733 TTTTGCATTTGGAGGGAGAAAGG - Intergenic
965986591 3:174761123-174761145 TATTTTCTTTAGAAGTAGAAGGG - Intronic
967242483 3:187454493-187454515 TGTTAATTTTGGAAGGAGAAGGG + Intergenic
967592176 3:191291274-191291296 TCATGTCTTTTGAAGAACAAAGG + Intronic
969407572 4:7004108-7004130 ACTTGTCCTTGAAAGAAGAATGG + Intronic
969550762 4:7865531-7865553 TCCTGCCTTTGGTAGGAAAATGG - Intronic
969826655 4:9763246-9763268 TCTTGTGTCTTGAAGGGGAAAGG - Intergenic
970619204 4:17799776-17799798 TCTTTTCTTAGGAAGCAGATGGG + Intergenic
971208078 4:24589394-24589416 TCTTGTTTTAGGAAGGATAAAGG - Intergenic
971769510 4:30878420-30878442 TCTTGTACTAGGAGGGAGAATGG + Intronic
971948340 4:33310263-33310285 TGTTGTTTTGGGAAGGAGAATGG + Intergenic
971995854 4:33963038-33963060 TCATGTCTTTGCAAGGACATAGG - Intergenic
972065177 4:34933813-34933835 TCATGTCTTTTGAAGGGGCATGG - Intergenic
972156063 4:36163568-36163590 TCTTGTCTATGAAAGAAAAAGGG + Intronic
972289092 4:37674483-37674505 TTTTGCCTTTAGAAGGAGGATGG + Intronic
972860269 4:43160020-43160042 TCTTAACTTTAGAAGAAGAAAGG - Intergenic
973022470 4:45220550-45220572 TCTTGACTTTGGAAAGAAGATGG - Intergenic
973062292 4:45742503-45742525 TCTTAGCTCTGGAAGTAGAAAGG - Intergenic
973575993 4:52289874-52289896 GCTTGTCTTTGGAAATAGAATGG + Intergenic
974380408 4:61132577-61132599 TCTTTTCTCTAGTAGGAGAATGG - Intergenic
974570155 4:63635465-63635487 TCATGTCTTTTGAAGGAACATGG + Intergenic
976087826 4:81424381-81424403 TCTTGTCTTTGTTAGATGAAAGG + Intergenic
976134132 4:81917665-81917687 TCTTGTCTAAGGCAGCAGAAGGG - Intronic
977579677 4:98711434-98711456 TCTTTCCTTTGGAAATAGAAGGG - Intergenic
977759965 4:100722162-100722184 TCTTTTTTTTGCAAGGGGAAAGG + Intronic
977980222 4:103312638-103312660 TCATGTCTTTGGCAGGAACATGG + Intergenic
978449583 4:108817156-108817178 TCTTTTCTTTGGAATGGAAAGGG - Intronic
978752442 4:112266069-112266091 TCTTTTTTTTGGAAAGGGAAGGG - Intronic
979045129 4:115852733-115852755 TCTTGTCTTTGGTTTCAGAAGGG - Intergenic
980548643 4:134303673-134303695 TCATGTCTTTAGCAGGAGCATGG - Intergenic
982210904 4:153035254-153035276 TATAGTCTTTTGAAGGAGACAGG + Intergenic
982313054 4:154005264-154005286 ACGTGGCTTTGGCAGGAGAAAGG - Intergenic
984314161 4:178104680-178104702 TCCTGTCTTTGGAAGCAACATGG - Intergenic
984359638 4:178711734-178711756 ACTTGACTTTGGAGGGAGAGAGG - Intergenic
984475295 4:180227417-180227439 GCCTTTCTTTGGAAGGGGAAGGG - Intergenic
985754118 5:1703001-1703023 TATTCTCTTTGGAAGTAGAGTGG - Intergenic
985999773 5:3621184-3621206 TCATGGCTGTGGATGGAGAAAGG + Intergenic
986082238 5:4407274-4407296 TTTTCTCTTTGGAAAGAGAAAGG + Intergenic
988722025 5:33888946-33888968 TTTAGTCGTTGGAAGGAGTATGG - Intronic
989530266 5:42499775-42499797 TCTTTTTTTGAGAAGGAGAAAGG + Intronic
989749515 5:44876323-44876345 TTTTTTCTTTGGCATGAGAAAGG + Intergenic
990064410 5:51695357-51695379 TCATGTCTTTTGCAGGAGTATGG + Intergenic
990177745 5:53126717-53126739 TCTTGCCTTGGTGAGGAGAAAGG - Intergenic
990411712 5:55547810-55547832 TCTTTGGTTGGGAAGGAGAAAGG - Intergenic
991252813 5:64582554-64582576 TCTTATCTTTGGGAGAGGAAGGG - Intronic
991392380 5:66160210-66160232 TGTTGTCTTTTGAAGAAAAATGG - Intronic
991482668 5:67099847-67099869 CCTTTTCTTTGGAGGGAGTAGGG - Intronic
991944105 5:71883046-71883068 TTTTGTCTGTGGGAGGAGAAGGG + Intergenic
992370083 5:76134782-76134804 TCTGCTCTTTGGAAGAACAAGGG + Intronic
992410650 5:76502135-76502157 GCTTATCTTTGGAAAGAGAGGGG + Intronic
992541336 5:77767666-77767688 GATTGTCTGTGGAGGGAGAAAGG - Intronic
992775975 5:80089781-80089803 TCTTGATTCTGGAAGAAGAATGG - Intergenic
993000311 5:82374259-82374281 GCTTGTCTTTGAAATGTGAATGG + Intronic
993664566 5:90679837-90679859 TCTGGGTTTTGGAAGCAGAAAGG - Intronic
993855067 5:93064170-93064192 ATGTGTCTTTAGAAGGAGAAAGG - Intergenic
994488665 5:100412429-100412451 TCTTCTTTTTGGGAAGAGAAAGG - Intergenic
995171061 5:109112680-109112702 TCTTGTCTTTATGAGGAGAGAGG + Intronic
995454514 5:112337526-112337548 TTTTGTCTATGAAAGGAGACAGG - Intronic
995945545 5:117640679-117640701 TCTTTTCTGGGGAAGGAGAAAGG + Intergenic
996214519 5:120850501-120850523 TCTTTTATTTGGGAGGAGAAAGG - Intergenic
996968976 5:129340570-129340592 TCTTGTCTGTTGGAGGAGCAAGG + Intergenic
997083777 5:130772093-130772115 TCTTGTTTTTAGGGGGAGAAGGG + Intergenic
997423425 5:133786898-133786920 TCTTATCTGTGAAATGAGAATGG - Intergenic
999704634 5:154261200-154261222 TCTTTGCTTTTGATGGAGAAAGG + Intronic
1000132990 5:158318027-158318049 TGTAGTCTTAGGAAGGAGAAAGG - Intergenic
1000578064 5:163000818-163000840 TCTTTTTTTTGGAGGGAGGAAGG - Intergenic
1002630655 5:180573669-180573691 ACTAGCCTTTGGAATGAGAAAGG - Intronic
1004549050 6:16628771-16628793 TCATGTCTTTTGCAGGAGTATGG - Intronic
1005205718 6:23402253-23402275 TCTTGTCTATGAAGGAAGAAAGG + Intergenic
1005252837 6:23967105-23967127 TGGTGTCCTTGGAAGAAGAAGGG - Intergenic
1006749403 6:36367110-36367132 ACTTGAGTTTGGAAGGAAAAAGG + Intronic
1006905000 6:37527270-37527292 TCTTTTCTGTGGAAGGACATTGG - Intergenic
1008441565 6:51537928-51537950 TCTTGTCCTTAGAAGCAGAACGG - Intergenic
1008987071 6:57557453-57557475 TCTTGTCTTTTGCAGGAACATGG + Intronic
1009379544 6:63010404-63010426 TCTGGTGTCTGGAATGAGAATGG - Intergenic
1009458640 6:63887329-63887351 TTTTGTCTTTGAAAATAGAATGG + Intronic
1009907209 6:69884736-69884758 TCTAATTTTTGGAAGGAGAAGGG + Intronic
1010351384 6:74879042-74879064 TCATGTGTCAGGAAGGAGAATGG - Intergenic
1011382273 6:86755403-86755425 TCATGTTTTGGGAAGGTGAAGGG - Intergenic
1011716935 6:90116328-90116350 TCATGTCTTTGGCAGGAACATGG + Intronic
1012070493 6:94607545-94607567 TCATGGCTCTGGCAGGAGAAGGG + Intergenic
1012127148 6:95444301-95444323 TCTTGTCCCAGGAAGGACAAAGG + Intergenic
1012347017 6:98201828-98201850 TCTTTTATTTGTCAGGAGAAAGG - Intergenic
1013291916 6:108727445-108727467 TCTTGGCTTGGGAAAGAAAAGGG + Intergenic
1013545588 6:111153810-111153832 TCTTATCTTTGTAAGGAGAAAGG - Intronic
1013659123 6:112276588-112276610 TCATGTCTTTTGAAGGGTAATGG - Intergenic
1013738386 6:113254419-113254441 TCATGTCTTTTGAAGGAACATGG + Intergenic
1013740514 6:113278450-113278472 CTATGGCTTTGGAAGGAGAAGGG + Intergenic
1013843355 6:114423511-114423533 TCTTGTGTCTGGAATGAGACTGG + Intergenic
1013971789 6:116028928-116028950 TGTTGTCATTGGAAGGAAAGAGG + Intronic
1014515562 6:122374308-122374330 TCTAGTCTTGGAAAAGAGAATGG - Intergenic
1014579777 6:123122874-123122896 CCTTGTCTTGGGCAGGAGAAAGG + Intergenic
1014583094 6:123162210-123162232 CCTTGCCTTTGGAAAGGGAAAGG + Intergenic
1015288869 6:131515169-131515191 TCTTGTCTTTTGTAGGAACATGG - Intergenic
1015373516 6:132483161-132483183 TGTTGTCTTTGGGAGGTGGATGG - Intronic
1015506029 6:133989526-133989548 TTTTGTTTTTGGAAAGAGAAGGG - Exonic
1017015512 6:150096386-150096408 TTTAGTATTTGGAAGCAGAACGG + Intergenic
1017780876 6:157714307-157714329 TATTATCTTTGGAATGACAATGG + Intronic
1018306805 6:162466397-162466419 TCTTGTTTTTGGAGGGAGGTGGG + Intronic
1018372557 6:163181505-163181527 ACTTGTCCTTGGAAGGGGGAGGG - Intronic
1018451834 6:163916090-163916112 TCTTTTCTCTGGAGGCAGAAGGG + Intergenic
1019157434 6:170048733-170048755 TCCTCTTTTTGGAAGGAGGAGGG - Intergenic
1020322401 7:6949191-6949213 TCTTGTGTCTGGAATGAGACTGG + Intergenic
1021242967 7:18227377-18227399 TCTGGTTTATGGGAGGAGAAAGG + Intronic
1021430266 7:20550675-20550697 TCTGGTGTCTGGAATGAGAATGG - Intergenic
1021434740 7:20601258-20601280 TGTTGTTTTTGGAGGGAGGAAGG + Intergenic
1021840269 7:24716843-24716865 CCCTGTCTCTGGAAGGTGAAGGG - Intronic
1022650811 7:32272615-32272637 GCTAGTCTTTGAAGGGAGAATGG - Intronic
1022961007 7:35426498-35426520 TCCTCTCTTTGGAAAGAGATGGG - Intergenic
1024574394 7:50752424-50752446 TCCTGCCCTTGGAAAGAGAAAGG + Intronic
1025239321 7:57257961-57257983 TCTGGTTTCTGGAAGGAGGATGG - Intergenic
1030931347 7:115526536-115526558 TCCTGTCTTTGTCAGGAGGAGGG - Intergenic
1030992292 7:116314952-116314974 ACTTTTTTTTGGAAGGAGAGAGG + Intronic
1034272615 7:149810784-149810806 GCATGTCTGTGGAAGGAGAGTGG + Intergenic
1035778846 8:2211267-2211289 AGTTGTCTGTGGAAGGTGAACGG - Intergenic
1036373775 8:8182852-8182874 TCTTGTGTCTGGAATGAGACTGG - Intergenic
1036579766 8:10063041-10063063 TCTCGTATTTGGAAACAGAAGGG - Intronic
1036599516 8:10247523-10247545 TCTTATGTTTAGAAGGAAAAAGG + Intronic
1036877128 8:12482789-12482811 TCTTGTGTCTGGAATGAGACTGG + Intergenic
1037034180 8:14144889-14144911 GTTTGTCTTTGGAAAGGGAAGGG + Intronic
1037506759 8:19538466-19538488 ACTTGTAATTGGAATGAGAATGG + Intronic
1038298610 8:26320950-26320972 TCTTGACTTTGGGAGGAGGATGG + Intronic
1038925939 8:32139380-32139402 TCATGACTGTGCAAGGAGAAGGG - Intronic
1039577172 8:38632885-38632907 ACTTTTCTTGGGAAGCAGAAAGG + Intergenic
1039998316 8:42554765-42554787 TGTTTTCTTTGGAAGAAAAATGG + Intergenic
1040920944 8:52616223-52616245 TCTTGTCTCTAGAAGGCCAAAGG + Intergenic
1041602822 8:59741453-59741475 ACTTGTCTTGAGAAGGATAATGG - Intergenic
1041611866 8:59859866-59859888 TATTGTCTTTTGAAGGAGCATGG + Intergenic
1041644494 8:60237738-60237760 TTTTGCCTTTGGAGGGAGAATGG - Intronic
1041997166 8:64076616-64076638 TCTTGTCTATGGAAGTGGAGAGG + Intergenic
1042504951 8:69549943-69549965 CCTTCTGTTTGGAAGGTGAAAGG + Intronic
1043030023 8:75122800-75122822 CCATGTCTATGGAAAGAGAAGGG - Intergenic
1043613983 8:82102983-82103005 TTCTGTTTTTGGAAGGAAAATGG + Intergenic
1043753722 8:83974618-83974640 TCTTATTTCTGGAAGCAGAAAGG + Intergenic
1044237555 8:89849182-89849204 TCTTGTCTGGGAAAGTAGAAAGG - Intergenic
1044717549 8:95114189-95114211 TGTTGTCTTTAAAGGGAGAAGGG + Intronic
1046143882 8:110131659-110131681 TCTTGAGGCTGGAAGGAGAATGG + Intergenic
1046635469 8:116670477-116670499 TTGTGTTTTTGGTAGGAGAAGGG - Intronic
1047150308 8:122253577-122253599 ACTTGTTTTTGCAAAGAGAAAGG - Intergenic
1047521813 8:125600751-125600773 TATTGTCTTGGGGAGCAGAAGGG + Intergenic
1047705256 8:127492813-127492835 TTTTGGCTTTTGAAGGTGAAAGG - Intergenic
1048458925 8:134603598-134603620 TCTTTTCTTGGGAAGAAGTAAGG - Intronic
1048473708 8:134724792-134724814 TCTTGACTCTGTAAGGGGAAGGG - Intergenic
1048638102 8:136322047-136322069 TCTTTTCTCTGCAAGAAGAATGG - Intergenic
1049368038 8:142250220-142250242 TCTTGCCGCTGGCAGGAGAATGG - Intronic
1049679929 8:143913598-143913620 TGTTGTCTTTCCAAGGGGAAGGG - Intergenic
1049781282 8:144430091-144430113 TCTTGTCCCTGGCAGGAAAAGGG - Intronic
1050288816 9:4131921-4131943 TATTTTCTTTAGAAAGAGAATGG - Intronic
1050870037 9:10555576-10555598 TCTTGCCTTTTGTAGGAGACTGG - Intronic
1051315699 9:15828963-15828985 TCCTGTCTCTGCTAGGAGAATGG + Intronic
1051483229 9:17580915-17580937 TCTTGGCTTTGGAGTGGGAAAGG + Intronic
1051570435 9:18550887-18550909 TCTTGTATTTGGGAAGAAAATGG + Intronic
1051589270 9:18759794-18759816 TCTTGACTCTGGAAGTACAAGGG - Intronic
1051718509 9:20010125-20010147 TCTTGTGTTCTGAGGGAGAATGG - Intergenic
1051949961 9:22619585-22619607 TCTTGTCTATGGAATCAGTATGG - Intergenic
1052042673 9:23757205-23757227 TGTCTTCTCTGGAAGGAGAATGG - Intronic
1053009901 9:34627216-34627238 CTCTGTCTTTGGAAGCAGAATGG - Intronic
1053058409 9:35008369-35008391 TCTTGTGTCTGGAATGAGACTGG - Intergenic
1055490288 9:76797890-76797912 TCTGCTCTTAGGAAGGAGGAGGG - Intronic
1057419610 9:94900194-94900216 TCTTGTCTGTGAAATGAGACTGG + Intronic
1057746034 9:97752130-97752152 ACTTTTCTTTTGAAGGAAAAAGG + Intergenic
1058138301 9:101331792-101331814 TCTTGTCTTTGGGGACAGAAAGG + Intergenic
1058621462 9:106887906-106887928 GCTTGTCTTTGGAAGTAGAAAGG - Intronic
1059017692 9:110538462-110538484 TCATTTCTTTGGAAAGAGAGAGG - Intronic
1059477720 9:114561270-114561292 GTTTGTCTTTGGAAGGTGCAGGG + Intergenic
1059613893 9:115927970-115927992 TCTTGTCTCTGGAATCAGAGTGG + Intergenic
1059643889 9:116244995-116245017 TCTTGTCGTTTGAAGCAGCATGG + Intronic
1061845649 9:133386691-133386713 TCTTGTCTTTACAAGGAGCCAGG + Intronic
1062121481 9:134836246-134836268 TCCAGTCTTGGGAAGGTGAAGGG + Intronic
1062384120 9:136302349-136302371 TCTTGTCCTTGGAAGGGTGAGGG - Intronic
1186464450 X:9774212-9774234 TTTTGACTTTGGTAGGAGATAGG - Intronic
1187723565 X:22177521-22177543 TCCTTGTTTTGGAAGGAGAATGG - Intronic
1187919791 X:24190504-24190526 CCTTGTTTTTGGCAGGGGAAGGG - Intronic
1187944595 X:24414006-24414028 ACTTGTCTCTGGAAGAAGAAGGG - Intergenic
1189546441 X:42047123-42047145 TCATGAATGTGGAAGGAGAAGGG - Intergenic
1189886479 X:45550414-45550436 TATTGTCTTTGGAAGTAGAGTGG - Intergenic
1192181909 X:68921486-68921508 TATTGTGTCTGGAAGGAGCAAGG - Intergenic
1192543906 X:71997022-71997044 TCTGATCCTTGGAATGAGAAAGG - Intergenic
1192692600 X:73380519-73380541 TCATGTCTTTTGCAGGAAAATGG + Intergenic
1192804002 X:74493971-74493993 TCTTTTCTTGGGAGGAAGAAAGG - Intronic
1193274407 X:79569566-79569588 TGTTGTCATTTGAAGGAGAGGGG + Intergenic
1193673604 X:84419443-84419465 CTTTGTCTTTGGAAAGAAAATGG + Intronic
1193746679 X:85290265-85290287 TCATGTCTTTTGAAGCAAAATGG - Intronic
1194759621 X:97779692-97779714 TATTTTCTTTGGAATGAAAAGGG + Intergenic
1195451982 X:105025143-105025165 TCTTGTCTTAGGTAGGATCAAGG + Intronic
1195528675 X:105925207-105925229 TTTTGTCTTTGGAAGTAAATAGG - Intronic
1196059028 X:111387561-111387583 TCTTGCTTTTGCAAAGAGAATGG - Intronic
1196090200 X:111732581-111732603 TCTTGACTTTGGATGGAGCTGGG + Intronic
1196214036 X:113029084-113029106 TTTTGTATATGGCAGGAGAAAGG + Intergenic
1196472312 X:116042420-116042442 TCATGTCTTTTGCAGGAGCATGG + Intergenic
1196847823 X:119910582-119910604 TTTCATCTTTTGAAGGAGAAAGG - Intronic
1197841606 X:130753664-130753686 TCATGTCTTTGGCAGCAAAATGG - Intronic
1198136592 X:133757589-133757611 ACTTGTGTTTGGAAGAAGAGAGG + Intronic
1198168026 X:134076873-134076895 TATTCTCTTGGAAAGGAGAATGG + Intergenic
1198301936 X:135342092-135342114 TGTTGTCTTGTGAAAGAGAAAGG - Exonic
1199045040 X:143160000-143160022 TCTGGTATTTGCATGGAGAATGG - Intergenic
1199056310 X:143299180-143299202 TCTTTTCTTTGGAAGGTGGAAGG - Intergenic
1199899259 X:152157107-152157129 TTTTGACTCTGGAAGGAGAGGGG - Intergenic